ID: 920341754

View in Genome Browser
Species Human (GRCh38)
Location 1:205279557-205279579
Sequence TTCCCACAGCCCCCAGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920341754_920341759 15 Left 920341754 1:205279557-205279579 CCAAGCCCTGGGGGCTGTGGGAA No data
Right 920341759 1:205279595-205279617 CTGTGTGCAAAGCCAACTCAAGG No data
920341754_920341760 16 Left 920341754 1:205279557-205279579 CCAAGCCCTGGGGGCTGTGGGAA No data
Right 920341760 1:205279596-205279618 TGTGTGCAAAGCCAACTCAAGGG No data
920341754_920341761 20 Left 920341754 1:205279557-205279579 CCAAGCCCTGGGGGCTGTGGGAA No data
Right 920341761 1:205279600-205279622 TGCAAAGCCAACTCAAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920341754 Original CRISPR TTCCCACAGCCCCCAGGGCT TGG (reversed) Intergenic
No off target data available for this crispr