ID: 920341756

View in Genome Browser
Species Human (GRCh38)
Location 1:205279563-205279585
Sequence TAGGTATTCCCACAGCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920341756_920341760 10 Left 920341756 1:205279563-205279585 CCTGGGGGCTGTGGGAATACCTA No data
Right 920341760 1:205279596-205279618 TGTGTGCAAAGCCAACTCAAGGG No data
920341756_920341763 26 Left 920341756 1:205279563-205279585 CCTGGGGGCTGTGGGAATACCTA No data
Right 920341763 1:205279612-205279634 TCAAGGGCAGGTTCCCAACATGG No data
920341756_920341761 14 Left 920341756 1:205279563-205279585 CCTGGGGGCTGTGGGAATACCTA No data
Right 920341761 1:205279600-205279622 TGCAAAGCCAACTCAAGGGCAGG No data
920341756_920341759 9 Left 920341756 1:205279563-205279585 CCTGGGGGCTGTGGGAATACCTA No data
Right 920341759 1:205279595-205279617 CTGTGTGCAAAGCCAACTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920341756 Original CRISPR TAGGTATTCCCACAGCCCCC AGG (reversed) Intergenic
No off target data available for this crispr