ID: 920341758

View in Genome Browser
Species Human (GRCh38)
Location 1:205279582-205279604
Sequence TTGCACACAGACACCATCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920341758_920341766 15 Left 920341758 1:205279582-205279604 CCTAAGATGGTGTCTGTGTGCAA No data
Right 920341766 1:205279620-205279642 AGGTTCCCAACATGGTAGAGGGG No data
920341758_920341763 7 Left 920341758 1:205279582-205279604 CCTAAGATGGTGTCTGTGTGCAA No data
Right 920341763 1:205279612-205279634 TCAAGGGCAGGTTCCCAACATGG No data
920341758_920341764 13 Left 920341758 1:205279582-205279604 CCTAAGATGGTGTCTGTGTGCAA No data
Right 920341764 1:205279618-205279640 GCAGGTTCCCAACATGGTAGAGG No data
920341758_920341765 14 Left 920341758 1:205279582-205279604 CCTAAGATGGTGTCTGTGTGCAA No data
Right 920341765 1:205279619-205279641 CAGGTTCCCAACATGGTAGAGGG No data
920341758_920341767 18 Left 920341758 1:205279582-205279604 CCTAAGATGGTGTCTGTGTGCAA No data
Right 920341767 1:205279623-205279645 TTCCCAACATGGTAGAGGGGAGG No data
920341758_920341761 -5 Left 920341758 1:205279582-205279604 CCTAAGATGGTGTCTGTGTGCAA No data
Right 920341761 1:205279600-205279622 TGCAAAGCCAACTCAAGGGCAGG No data
920341758_920341759 -10 Left 920341758 1:205279582-205279604 CCTAAGATGGTGTCTGTGTGCAA No data
Right 920341759 1:205279595-205279617 CTGTGTGCAAAGCCAACTCAAGG No data
920341758_920341760 -9 Left 920341758 1:205279582-205279604 CCTAAGATGGTGTCTGTGTGCAA No data
Right 920341760 1:205279596-205279618 TGTGTGCAAAGCCAACTCAAGGG No data
920341758_920341770 25 Left 920341758 1:205279582-205279604 CCTAAGATGGTGTCTGTGTGCAA No data
Right 920341770 1:205279630-205279652 CATGGTAGAGGGGAGGCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920341758 Original CRISPR TTGCACACAGACACCATCTT AGG (reversed) Intergenic
No off target data available for this crispr