ID: 920341760

View in Genome Browser
Species Human (GRCh38)
Location 1:205279596-205279618
Sequence TGTGTGCAAAGCCAACTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920341758_920341760 -9 Left 920341758 1:205279582-205279604 CCTAAGATGGTGTCTGTGTGCAA No data
Right 920341760 1:205279596-205279618 TGTGTGCAAAGCCAACTCAAGGG No data
920341756_920341760 10 Left 920341756 1:205279563-205279585 CCTGGGGGCTGTGGGAATACCTA No data
Right 920341760 1:205279596-205279618 TGTGTGCAAAGCCAACTCAAGGG No data
920341754_920341760 16 Left 920341754 1:205279557-205279579 CCAAGCCCTGGGGGCTGTGGGAA No data
Right 920341760 1:205279596-205279618 TGTGTGCAAAGCCAACTCAAGGG No data
920341755_920341760 11 Left 920341755 1:205279562-205279584 CCCTGGGGGCTGTGGGAATACCT No data
Right 920341760 1:205279596-205279618 TGTGTGCAAAGCCAACTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920341760 Original CRISPR TGTGTGCAAAGCCAACTCAA GGG Intergenic
No off target data available for this crispr