ID: 920341763

View in Genome Browser
Species Human (GRCh38)
Location 1:205279612-205279634
Sequence TCAAGGGCAGGTTCCCAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920341756_920341763 26 Left 920341756 1:205279563-205279585 CCTGGGGGCTGTGGGAATACCTA No data
Right 920341763 1:205279612-205279634 TCAAGGGCAGGTTCCCAACATGG No data
920341758_920341763 7 Left 920341758 1:205279582-205279604 CCTAAGATGGTGTCTGTGTGCAA No data
Right 920341763 1:205279612-205279634 TCAAGGGCAGGTTCCCAACATGG No data
920341755_920341763 27 Left 920341755 1:205279562-205279584 CCCTGGGGGCTGTGGGAATACCT No data
Right 920341763 1:205279612-205279634 TCAAGGGCAGGTTCCCAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920341763 Original CRISPR TCAAGGGCAGGTTCCCAACA TGG Intergenic
No off target data available for this crispr