ID: 920341764

View in Genome Browser
Species Human (GRCh38)
Location 1:205279618-205279640
Sequence GCAGGTTCCCAACATGGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920341758_920341764 13 Left 920341758 1:205279582-205279604 CCTAAGATGGTGTCTGTGTGCAA No data
Right 920341764 1:205279618-205279640 GCAGGTTCCCAACATGGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920341764 Original CRISPR GCAGGTTCCCAACATGGTAG AGG Intergenic
No off target data available for this crispr