ID: 920341767

View in Genome Browser
Species Human (GRCh38)
Location 1:205279623-205279645
Sequence TTCCCAACATGGTAGAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920341758_920341767 18 Left 920341758 1:205279582-205279604 CCTAAGATGGTGTCTGTGTGCAA No data
Right 920341767 1:205279623-205279645 TTCCCAACATGGTAGAGGGGAGG No data
920341762_920341767 -7 Left 920341762 1:205279607-205279629 CCAACTCAAGGGCAGGTTCCCAA No data
Right 920341767 1:205279623-205279645 TTCCCAACATGGTAGAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920341767 Original CRISPR TTCCCAACATGGTAGAGGGG AGG Intergenic
No off target data available for this crispr