ID: 920341770

View in Genome Browser
Species Human (GRCh38)
Location 1:205279630-205279652
Sequence CATGGTAGAGGGGAGGCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920341758_920341770 25 Left 920341758 1:205279582-205279604 CCTAAGATGGTGTCTGTGTGCAA No data
Right 920341770 1:205279630-205279652 CATGGTAGAGGGGAGGCTTATGG No data
920341762_920341770 0 Left 920341762 1:205279607-205279629 CCAACTCAAGGGCAGGTTCCCAA No data
Right 920341770 1:205279630-205279652 CATGGTAGAGGGGAGGCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920341770 Original CRISPR CATGGTAGAGGGGAGGCTTA TGG Intergenic
No off target data available for this crispr