ID: 920349290

View in Genome Browser
Species Human (GRCh38)
Location 1:205327335-205327357
Sequence TAACACAGAGGTCCAGCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920349290_920349298 -8 Left 920349290 1:205327335-205327357 CCCAAGGCTGGACCTCTGTGTTA No data
Right 920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG No data
920349290_920349299 18 Left 920349290 1:205327335-205327357 CCCAAGGCTGGACCTCTGTGTTA No data
Right 920349299 1:205327376-205327398 TGATCTGAGAGAGAAAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920349290 Original CRISPR TAACACAGAGGTCCAGCCTT GGG (reversed) Intergenic
No off target data available for this crispr