ID: 920349298

View in Genome Browser
Species Human (GRCh38)
Location 1:205327350-205327372
Sequence CTGTGTTAAGGGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920349290_920349298 -8 Left 920349290 1:205327335-205327357 CCCAAGGCTGGACCTCTGTGTTA No data
Right 920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG No data
920349291_920349298 -9 Left 920349291 1:205327336-205327358 CCAAGGCTGGACCTCTGTGTTAA No data
Right 920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920349298 Original CRISPR CTGTGTTAAGGGAGGGAGGA AGG Intergenic
No off target data available for this crispr