ID: 920350026

View in Genome Browser
Species Human (GRCh38)
Location 1:205331762-205331784
Sequence CTGAACAAAGGGGCCTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920350026_920350035 12 Left 920350026 1:205331762-205331784 CCCCCAAAGGCCCCTTTGTTCAG No data
Right 920350035 1:205331797-205331819 CTCAAGTCTCCCTTCCCTGCAGG No data
920350026_920350041 30 Left 920350026 1:205331762-205331784 CCCCCAAAGGCCCCTTTGTTCAG No data
Right 920350041 1:205331815-205331837 GCAGGCCCAGTTATAACAGTGGG No data
920350026_920350040 29 Left 920350026 1:205331762-205331784 CCCCCAAAGGCCCCTTTGTTCAG No data
Right 920350040 1:205331814-205331836 TGCAGGCCCAGTTATAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920350026 Original CRISPR CTGAACAAAGGGGCCTTTGG GGG (reversed) Intergenic
No off target data available for this crispr