ID: 920350511

View in Genome Browser
Species Human (GRCh38)
Location 1:205335124-205335146
Sequence TTTCCAGAATGGACTTCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 207}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920350504_920350511 8 Left 920350504 1:205335093-205335115 CCTCATTCCTCAGTGAGGCACCC 0: 1
1: 0
2: 3
3: 19
4: 199
Right 920350511 1:205335124-205335146 TTTCCAGAATGGACTTCCAAGGG 0: 1
1: 0
2: 0
3: 18
4: 207
920350503_920350511 9 Left 920350503 1:205335092-205335114 CCCTCATTCCTCAGTGAGGCACC 0: 1
1: 0
2: 0
3: 33
4: 175
Right 920350511 1:205335124-205335146 TTTCCAGAATGGACTTCCAAGGG 0: 1
1: 0
2: 0
3: 18
4: 207
920350505_920350511 1 Left 920350505 1:205335100-205335122 CCTCAGTGAGGCACCCCTAAAGT 0: 1
1: 0
2: 0
3: 8
4: 86
Right 920350511 1:205335124-205335146 TTTCCAGAATGGACTTCCAAGGG 0: 1
1: 0
2: 0
3: 18
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920350511 Original CRISPR TTTCCAGAATGGACTTCCAA GGG Intergenic
900145081 1:1155601-1155623 CTTCCACAGTGGTCTTCCAAAGG - Intergenic
901217675 1:7563849-7563871 TCTCCAGAATGCAGTTCCATGGG - Intronic
906698108 1:47838349-47838371 ATAGCAGAATGGACTTCCCAAGG + Intronic
907782273 1:57578069-57578091 ATGCCAGAATGGAGTCCCAAAGG - Intronic
908479205 1:64520611-64520633 TTTCCACAGTGGGGTTCCAAAGG - Intronic
909395047 1:75161761-75161783 TTTTCAGAATGGACTTCGGAGGG + Intergenic
909645038 1:77907851-77907873 TGGCCAGAAGGGACTTCAAAAGG - Intronic
911061107 1:93748508-93748530 ATTCCAGACTGGACTTCGATCGG + Intronic
911436844 1:97870933-97870955 TTTCCCGAATGGGCATACAATGG - Intronic
915760825 1:158310377-158310399 TGTCCAGAATGGAATTTCACAGG - Intergenic
916264525 1:162877299-162877321 ATTCCAGAATGGATGACCAAGGG - Intergenic
918578260 1:186091649-186091671 ATTCCAGATTGTCCTTCCAAAGG - Intronic
919663512 1:200270658-200270680 CATCCAGAATGCCCTTCCAATGG + Intergenic
920350511 1:205335124-205335146 TTTCCAGAATGGACTTCCAAGGG + Intergenic
920566822 1:206980772-206980794 TTTTCAGACTGAACTTCCAGGGG - Intergenic
922774537 1:228208664-228208686 CTTCCAGCATGAAGTTCCAAGGG - Intronic
1063246034 10:4219683-4219705 TTTTCAGAATGAACTGCAAAGGG + Intergenic
1065834036 10:29640859-29640881 CTTCCAGAATGGCCTTTAAACGG + Intronic
1066821312 10:39493945-39493967 TTTCCATAGTAGGCTTCCAAGGG - Intergenic
1067465599 10:46496433-46496455 TTTCCAGAAGTGGCATCCAAGGG - Intergenic
1067621588 10:47888172-47888194 TTTCCAGAAGTGGCATCCAAGGG + Intergenic
1069645131 10:69991086-69991108 TTTCCAAAATGAACTCCAAAGGG + Intergenic
1069982408 10:72261421-72261443 TTCCCAGAGTGGCCTTCCTATGG + Intergenic
1071711902 10:88058128-88058150 TTTCCACAAGGGAATTCCAAAGG - Intergenic
1072553303 10:96495205-96495227 TTTCCTGAGAGGAATTCCAATGG - Intronic
1072600151 10:96918302-96918324 TTCCCAGAATGGACCTCAGATGG + Intronic
1072802115 10:98399496-98399518 TTCCTAGAATGCAGTTCCAAGGG + Intronic
1073461403 10:103667800-103667822 TTTCCAGAAGGGTCTTCTATGGG - Intronic
1074652336 10:115537949-115537971 TTTCCAGAATGTCATTCAAATGG + Intronic
1076279552 10:129234213-129234235 ATTGCAGAATGGACTTGCAAAGG + Intergenic
1080771132 11:35342981-35343003 TTTCCAGAATGGAACACTAATGG + Intronic
1080991442 11:37541410-37541432 TTCCCAGAATGCACTGCCCAAGG + Intergenic
1081597551 11:44469513-44469535 TTTCCATCATGTCCTTCCAAGGG - Intergenic
1082319686 11:50786586-50786608 TTTCCACAATAGACTTCAAAGGG + Intergenic
1089159118 11:116424179-116424201 ATGCCAGAAAGGACTTCCAGAGG + Intergenic
1091788842 12:3259650-3259672 TTTCCAGAATGATCTTCCTTAGG - Intronic
1093371083 12:18365841-18365863 TATCCAGAATGGCCATCCATAGG - Intronic
1094725588 12:33112166-33112188 TTTCCAGAATTGAATTCTATTGG + Intergenic
1095057532 12:37631480-37631502 TTTCCACAATTGACCTCAAAGGG + Intergenic
1095059901 12:37672330-37672352 TTTCCACCATGGGCTTCAAAGGG + Intergenic
1095062797 12:37721024-37721046 TTCCCACAATAGACCTCCAAGGG - Intergenic
1095062954 12:37724269-37724291 TTTCCACAATAGACCTCCCATGG - Intergenic
1095063210 12:37729235-37729257 TTTCCACAATAGGCCTCCAAGGG - Intergenic
1095182095 12:39158072-39158094 ACTCCAGGATGGACCTCCAAAGG - Intergenic
1095294408 12:40511888-40511910 TTTCAAGAAAGGTCTTCCAGTGG + Intronic
1098956404 12:76694078-76694100 TTTCCAAATTGTCCTTCCAAGGG + Intergenic
1099829851 12:87827453-87827475 GTTCTAGAATGGACCTCCAGGGG - Intergenic
1101323193 12:103691828-103691850 TTTCCAGAAGGGATTTCAACTGG + Intronic
1103680367 12:122689148-122689170 TCTCCAGGAAGGCCTTCCAAAGG + Intergenic
1107381688 13:39863256-39863278 TTTCCAGAATGGAATGACATAGG - Intergenic
1109313852 13:60726976-60726998 TTTCCAGTTGAGACTTCCAATGG + Intergenic
1109821486 13:67662621-67662643 TTTTCAGAATAGACTACCACTGG - Intergenic
1112104262 13:96223625-96223647 ATTCCAGAAAGGACATTCAAGGG - Intronic
1112642800 13:101295870-101295892 TTTCAAAAATGGTTTTCCAATGG + Intronic
1112785327 13:102944960-102944982 TCTCCAGTGTTGACTTCCAAAGG - Intergenic
1113951629 13:114074955-114074977 TTTACAGAATGGACTTAAACTGG - Intronic
1117155928 14:52941230-52941252 TTTCTAGAATGGCCTGCAAATGG - Intronic
1118300118 14:64607670-64607692 CTTTCAGAATTGACTTCCAGGGG + Intergenic
1121510261 14:94507098-94507120 TTTCCTGTATGGACATCCACTGG - Intronic
1122088764 14:99324213-99324235 TTTCCAGTATAGGCTTGCAAGGG + Intergenic
1124602125 15:31143004-31143026 TTTCTATAATGGACTCTCAAAGG + Intronic
1127836605 15:62795599-62795621 TCTCCAGAATGGAGTTCAGAAGG - Intronic
1133317639 16:4894312-4894334 TCTCCTGCATGAACTTCCAAGGG + Intronic
1133381412 16:5333899-5333921 TCTCCAGAATGCACTTGCAATGG - Intergenic
1136916255 16:34201628-34201650 TTTCCACCATAGACTTCAAAGGG + Intergenic
1136916458 16:34205387-34205409 TTTCCACAATAGGCCTCCAAGGG + Intergenic
1137079328 16:36026551-36026573 TTTCCACAATAGGCTTCAAAGGG - Intergenic
1137080236 16:36041419-36041441 TTTCCACAATAGGCTTCAAAGGG - Intergenic
1137081240 16:36058876-36058898 TTTCCACAATGGGCCTCAAAGGG - Intergenic
1141029038 16:80571831-80571853 TTTCAAGAATGGACTACCACCGG - Intergenic
1143204924 17:5134762-5134784 TTTCCAGAATGGCCTAGGAATGG - Intronic
1144875968 17:18397444-18397466 TTTCCAGAATGGCCTAGGAATGG - Intergenic
1145156260 17:20546976-20546998 TTTCCAGAATGGCCTAGGAATGG + Intergenic
1145426980 17:22912321-22912343 TTTCCAGCCTGAACTTTCAAAGG - Intergenic
1145433807 17:23006303-23006325 TTTCCAAACTGAACTTTCAAAGG - Intergenic
1145434854 17:23020580-23020602 TTTCCAGCCTGAACTTTCAAAGG - Intergenic
1145438279 17:23068166-23068188 TTTCCAAACTGAACTTTCAAAGG - Intergenic
1145689102 17:26715590-26715612 TTTCCAAAATAGACCTCAAAGGG - Intergenic
1145798431 17:27668859-27668881 TTTCCAGAATGGTCTAGGAATGG + Intergenic
1146762244 17:35488702-35488724 ATTCTAGATGGGACTTCCAACGG - Intronic
1146843735 17:36171063-36171085 TTTCCAGAATGGCCTAGGAATGG + Intronic
1146856042 17:36258997-36259019 TTTCCAGAATGGCCTAGGAATGG + Intronic
1146864578 17:36329378-36329400 TTTCCAGAATGGCCTAGGAATGG - Intronic
1146871948 17:36382908-36382930 TTTCCAGAATGGCCTAGGAATGG + Intronic
1146879310 17:36433993-36434015 TTTCCAGAATGGCCTAGGAATGG + Intronic
1146883240 17:36455138-36455160 TTTCCAGAATGGCCTAGGAATGG + Intergenic
1147067437 17:37929966-37929988 TTTCCAGAATGGCCTAGGAATGG - Intronic
1147074835 17:37983532-37983554 TTTCCAGAATGGCCTAGGAATGG + Intronic
1147078968 17:38009527-38009549 TTTCCAGAATGGCCTAGGAATGG - Intronic
1147086358 17:38063078-38063100 TTTCCAGAATGGCCTAGGAATGG + Intronic
1147094905 17:38133462-38133484 TTTCCAGAATGGCCTAGGAATGG - Intergenic
1147102302 17:38187041-38187063 TTTCCAGAATGGCCTAGGAATGG + Intergenic
1147631935 17:41937918-41937940 TCTCCAGAATTGGCTTCCCAAGG + Intronic
1148732749 17:49847409-49847431 TTTCCAGAATTTTCTTTCAAGGG - Intronic
1149846892 17:60013548-60013570 TTTCCAGAATGGCCTAGGAATGG + Intergenic
1150085242 17:62270125-62270147 TTTCCAGAATGGCCTAGGAATGG + Intergenic
1150580206 17:66466412-66466434 TTCCCAGAAAGGGCTTCCCAAGG - Intronic
1156311356 18:35925230-35925252 TTTTCAGATTTGGCTTCCAAAGG - Intergenic
1156384374 18:36592614-36592636 TTTGGAGAATGGACTTCAGAAGG + Intronic
1156803559 18:41148383-41148405 TTTCCAGAATTGACCCCCTAAGG - Intergenic
1158226435 18:55206147-55206169 TTTCCAGAAGAGACTCACAATGG + Intergenic
1161782771 19:6304399-6304421 TGTCCAGAATGGACTTGCCCTGG + Intergenic
1164349266 19:27314495-27314517 TTTCCACAATTGCCCTCCAAGGG - Intergenic
1164349361 19:27316212-27316234 TTTCCACAATAGGCCTCCAAGGG - Intergenic
1164349820 19:27323167-27323189 TTTCCACAATAGGCTTCCAAGGG - Intergenic
1164354195 19:27397777-27397799 TTTCAACAATAGACTTCAAAGGG + Intergenic
1164354209 19:27398122-27398144 TTTCCACCATAGACATCCAAGGG + Intergenic
1166389263 19:42400016-42400038 TGTCCAGAATGGCCCTCCACAGG + Intergenic
929230725 2:39557145-39557167 ATTCTAAAATGGATTTCCAAGGG + Intergenic
929664069 2:43820230-43820252 TTTCCAAAACGGCCTTTCAAAGG - Intronic
930646455 2:53914239-53914261 TTTAGAGAATGGACTGCAAAAGG + Intronic
931326313 2:61228539-61228561 GTTCCAGAAGGGACTTTAAAGGG + Intronic
931493725 2:62779004-62779026 TTTCAAGAATACATTTCCAAAGG + Intronic
931836495 2:66104565-66104587 TCTCCAGAATCCACATCCAAGGG + Intergenic
932417840 2:71584394-71584416 CTTCCTGAAGGGGCTTCCAAAGG + Intronic
933464539 2:82635819-82635841 TTTGCTGAATTCACTTCCAAAGG + Intergenic
934513016 2:94963258-94963280 TTCCCAGAATGCACTCACAATGG + Intergenic
935384048 2:102482730-102482752 GCTTCAGAATGGATTTCCAAGGG - Intronic
936951874 2:117985774-117985796 TTTCCAGAGAGGAATTGCAAAGG + Intronic
939660563 2:144883589-144883611 TCTCCATCAAGGACTTCCAAAGG - Intergenic
941745506 2:169082391-169082413 ATTGCAGAATGGACATCCAAAGG - Intronic
943544775 2:189261329-189261351 TTTCCAGAATGTACTTACTTAGG - Intergenic
945918438 2:215729519-215729541 TTTCCAAAATGGACATACAAAGG + Intergenic
946138905 2:217671345-217671367 GTGCCAGAATGAACTTACAATGG - Intronic
946635190 2:221717271-221717293 TTTCCAGAATGCGGTGCCAATGG + Intergenic
947803797 2:232950613-232950635 TTTCCAGAAAAGGCTACCAAAGG + Intronic
1169726344 20:8737317-8737339 TTTTCAGAATGGCTTTCAAAAGG - Intronic
1169757945 20:9063659-9063681 ATTCCAGAAGGACCTTCCAAGGG + Intergenic
1171821245 20:29843449-29843471 TTTCCAGAATAGGCGTCAAAGGG - Intergenic
1171821348 20:29845308-29845330 TTTCCACAATAGACCTCAAAGGG - Intergenic
1172673836 20:36653477-36653499 TTTGAAGGATGGACTTGCAATGG + Exonic
1172761862 20:37328697-37328719 TTCCCAGAATGCACTTGCAGGGG + Intergenic
1172997794 20:39083730-39083752 TTTACAGAACAGACTTGCAAAGG - Intergenic
1174409805 20:50327667-50327689 TGTCCAGGATGGACATCAAAGGG + Intergenic
1175190748 20:57210823-57210845 TGACCAGAATGGATTTCCAAGGG - Intronic
1176318149 21:5271658-5271680 TTTCCACAATAGACCTCAAAGGG + Intergenic
1176476010 21:7208435-7208457 TTTCCACAATAGACCTCAAAGGG + Intergenic
1177367455 21:20155986-20156008 TTTCAACAATGGACTACAAAGGG + Intergenic
1178942574 21:36918747-36918769 TTTGCAGAATGGCCTTGTAATGG + Intronic
1182600031 22:31455234-31455256 TTTTCAGCATGGTCTTCCAATGG + Exonic
1183711114 22:39504024-39504046 TTTCCAGAATGGGCATCCAGAGG + Intronic
1184375152 22:44107362-44107384 TTTCCAGAATGAATAGCCAAGGG + Intronic
1185231593 22:49687014-49687036 TTTCCAGTAGGGGATTCCAAAGG - Intergenic
949416680 3:3822751-3822773 TTTCCAGTATGTATTTTCAAAGG - Intronic
949646013 3:6095024-6095046 TTTCCAGCTTTGATTTCCAATGG - Intergenic
949974969 3:9448024-9448046 TTGCCAGACTGGACTTATAAAGG - Intronic
950038877 3:9906836-9906858 TTCCCAGATTGGACTCACAAAGG + Exonic
950039964 3:9914089-9914111 TTTGCAGAATGGATTTTCCAGGG - Intronic
950146466 3:10653537-10653559 TTTCCAGAATGCTCCGCCAAAGG + Intronic
950797987 3:15526403-15526425 TTTCCAGAATGTCCTACTAATGG - Intergenic
951020862 3:17779476-17779498 TCTCCACAATGAACTTCCATCGG - Intronic
952752085 3:36832772-36832794 CATCCAGAATGGACTTGCAAAGG + Exonic
961864720 3:129945381-129945403 ATTCCAGAGTGGTCTTCTAAAGG - Intergenic
963786011 3:149535084-149535106 TCACCAGAATGCACTTCAAAAGG + Intronic
964307191 3:155354724-155354746 TTTCCAAAAAGGATTTCCAATGG + Intergenic
964692803 3:159471160-159471182 TTTCCAGGATGGACTTTTAATGG - Intronic
964701834 3:159576017-159576039 ATTACTGAATGAACTTCCAAAGG - Intronic
964737339 3:159930189-159930211 TTTTCAAAATGGCCTTTCAAAGG - Intergenic
967917986 3:194592995-194593017 CTTCCAGGAGGGACTTCCTATGG - Intronic
968251208 3:197216479-197216501 TTTCCAGAATCCTCTCCCAATGG + Intronic
969573751 4:8024786-8024808 TTTCCAGAATGTACTCCTGAGGG - Intronic
978829260 4:113064081-113064103 TTTCCAAAAATGACTTCCACTGG - Intronic
980351900 4:131694253-131694275 TTTCCAGAATGGTATTTCCAAGG - Intergenic
980854459 4:138423081-138423103 TTTCCAAAATGCATTTCAAATGG + Intergenic
982712601 4:158771791-158771813 TTTCCATGATGGACTTTCACTGG + Intronic
984718366 4:182947281-182947303 TTTCCAAGATGGAATACCAAAGG - Intergenic
989303291 5:39920109-39920131 TTTCAGAAATGGACTTCTAAAGG + Intergenic
990841476 5:60084566-60084588 TTTCCCAAATGTACTTCAAATGG - Intronic
994143968 5:96372251-96372273 TTTCCAAAATGGAATTTAAAAGG - Intergenic
995156970 5:108927158-108927180 TTACCAGAATGAGCTTTCAAAGG - Intronic
996888903 5:128393330-128393352 TTGCATGGATGGACTTCCAATGG - Exonic
1001222886 5:169917862-169917884 TTTCCAGAATGAAATACCAGTGG - Intronic
1003239010 6:4325906-4325928 TTTTCAAAATGGATTTCCAGTGG - Intergenic
1005155345 6:22799334-22799356 TTTCCTGATTGAACTTCCAGTGG + Intergenic
1005913896 6:30335219-30335241 TTTACAGAAGGAAATTCCAATGG + Intronic
1007185678 6:39970150-39970172 TTAGAAGAATGGACTTCCCATGG - Intergenic
1007999087 6:46339697-46339719 TTTGCAGAATGGATTTAAAAGGG - Intronic
1010043432 6:71414679-71414701 TTAACAGAATGAACTTCCAAAGG + Intergenic
1011327833 6:86170602-86170624 TTCCAAAAATGGAATTCCAAGGG + Intergenic
1011410110 6:87058877-87058899 TTTCCAGAAGGGACTAAGAATGG + Intergenic
1016800784 6:148167052-148167074 TTCACAGAAGGGACTACCAATGG + Intergenic
1018536394 6:164825208-164825230 TCACCAGGTTGGACTTCCAAAGG + Intergenic
1023133847 7:37031331-37031353 TTTCCAGAATGCATTTGCCAAGG + Intronic
1024783466 7:52878823-52878845 TTTCGAGAATGGAGTTATAATGG - Intergenic
1025310768 7:57937467-57937489 TTTCCACAATAGGCCTCCAAGGG + Intergenic
1025499841 7:61273521-61273543 TTTCCACAATAGACCTCAAATGG - Intergenic
1025514694 7:61619730-61619752 TTTCCACAATAGACCTCAAATGG - Intergenic
1025539041 7:62048570-62048592 TTTCCACAATAGACCTCAAATGG - Intergenic
1026573127 7:71549194-71549216 TTTCTGGAATGGAATTCCATAGG + Intronic
1028427688 7:90708381-90708403 TTTGCAGAATAGACTTCAACAGG - Intronic
1028606535 7:92662036-92662058 TTTCCAGAATGGAGAGACAAGGG + Intronic
1029811624 7:103054874-103054896 TTTCCAGAAAGTATTTACAAAGG - Intronic
1030569352 7:111202842-111202864 TTTCCAAAATGGATTTCAAGAGG - Intronic
1030888867 7:114972494-114972516 TTTACATAATGGTCTTCAAATGG + Intronic
1031107218 7:117559457-117559479 TTTCCAGACTTCACTTCTAATGG + Exonic
1033485755 7:141787508-141787530 ATTACAGAATGGCCTTCCGAAGG - Intronic
1035833594 8:2725307-2725329 CTTCCAGAAGGCACTGCCAAAGG - Intergenic
1044944678 8:97379291-97379313 TTTCAAGAACCGACTTCAAAGGG - Intergenic
1045662157 8:104449260-104449282 TTCACATAATGGGCTTCCAAAGG + Intronic
1053563959 9:39227658-39227680 TGTCCAGAATGGTGTTCCATAGG + Intronic
1054133189 9:61391386-61391408 TGTCCAGAATGGTGTTCCATAGG - Intergenic
1054905018 9:70407174-70407196 TTCCCAGATTGAACTTCCCAGGG - Intronic
1055397066 9:75887547-75887569 TTTTGAGAATGGACTTATAATGG + Intergenic
1056946947 9:91005666-91005688 TATGCAGAATGGACTACCCAGGG + Intergenic
1059955397 9:119510525-119510547 GTTCCAGAATGGATTGCCAAGGG - Intronic
1203420512 Un_KI270375v1:1136-1158 TTTCCACAATAGACCTCAAATGG + Intergenic
1203357636 Un_KI270442v1:174713-174735 TTTCCACAATAGGCTTCAAAGGG - Intergenic
1203374869 Un_KI270442v1:360987-361009 TTTCCACAATAGGCTTCCAAGGG - Intergenic
1190033586 X:46998505-46998527 ATTTCAGATTGGACTTCAAATGG - Intronic
1191568683 X:62576967-62576989 TTTCCAAAATAGGCTTCAAAGGG - Intergenic
1191570625 X:62612496-62612518 TTTCCAACATAGACCTCCAATGG - Intergenic
1191834252 X:65446976-65446998 TTTTCAGTATGGACTTCCTTAGG + Intronic
1195859866 X:109372094-109372116 TTTCCAGATTCCACTTTCAAGGG - Intergenic
1196731536 X:118945899-118945921 TTTGCAGAATGCAGTTGCAATGG + Intergenic
1198231236 X:134691637-134691659 TTTCCAGAAGGGCCGTCCTAAGG - Intronic
1199319925 X:146426207-146426229 TTTGGAGAATGAACTTGCAATGG + Intergenic
1200695920 Y:6359457-6359479 TATGCAGAATGGACATCCCATGG - Intergenic
1201023627 Y:9683678-9683700 TATGCAGAATGGACATCCCATGG - Intergenic
1201039357 Y:9815249-9815271 TATGCAGAATGGACATCCCATGG + Intergenic
1201096153 Y:10618405-10618427 TTTCCACCATAGACTACCAAGGG + Intergenic
1202119038 Y:21505896-21505918 TATGCAGAAGGGACATCCAATGG - Intergenic
1202121490 Y:21529436-21529458 TATGCAGAAGGGACATCCAATGG - Intronic
1202123937 Y:21553005-21553027 TATGCAGAAGGGACATCCAATGG - Intergenic
1202155071 Y:21876375-21876397 TATGCAGAAGGGACATCCAATGG + Intergenic
1202157513 Y:21899946-21899968 TATGCAGAAGGGACATCCAATGG + Intronic
1202159962 Y:21923487-21923509 TATGCAGAAGGGACATCCAATGG + Intergenic