ID: 920351995

View in Genome Browser
Species Human (GRCh38)
Location 1:205343699-205343721
Sequence TCCATCTGGCTCCCGAGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 127}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920351989_920351995 -9 Left 920351989 1:205343685-205343707 CCCCTATCGCCACCTCCATCTGG 0: 1
1: 0
2: 0
3: 13
4: 203
Right 920351995 1:205343699-205343721 TCCATCTGGCTCCCGAGCGCCGG 0: 1
1: 0
2: 1
3: 5
4: 127
920351986_920351995 4 Left 920351986 1:205343672-205343694 CCGGCTCCCACGGCCCCTATCGC 0: 1
1: 0
2: 0
3: 10
4: 149
Right 920351995 1:205343699-205343721 TCCATCTGGCTCCCGAGCGCCGG 0: 1
1: 0
2: 1
3: 5
4: 127
920351988_920351995 -3 Left 920351988 1:205343679-205343701 CCACGGCCCCTATCGCCACCTCC 0: 1
1: 0
2: 2
3: 28
4: 383
Right 920351995 1:205343699-205343721 TCCATCTGGCTCCCGAGCGCCGG 0: 1
1: 0
2: 1
3: 5
4: 127
920351991_920351995 -10 Left 920351991 1:205343686-205343708 CCCTATCGCCACCTCCATCTGGC 0: 1
1: 0
2: 1
3: 10
4: 134
Right 920351995 1:205343699-205343721 TCCATCTGGCTCCCGAGCGCCGG 0: 1
1: 0
2: 1
3: 5
4: 127
920351983_920351995 21 Left 920351983 1:205343655-205343677 CCACCGGCTACTTGGCGCCGGCT 0: 1
1: 0
2: 0
3: 2
4: 39
Right 920351995 1:205343699-205343721 TCCATCTGGCTCCCGAGCGCCGG 0: 1
1: 0
2: 1
3: 5
4: 127
920351984_920351995 18 Left 920351984 1:205343658-205343680 CCGGCTACTTGGCGCCGGCTCCC 0: 1
1: 0
2: 0
3: 12
4: 120
Right 920351995 1:205343699-205343721 TCCATCTGGCTCCCGAGCGCCGG 0: 1
1: 0
2: 1
3: 5
4: 127
920351987_920351995 -2 Left 920351987 1:205343678-205343700 CCCACGGCCCCTATCGCCACCTC 0: 1
1: 0
2: 0
3: 8
4: 150
Right 920351995 1:205343699-205343721 TCCATCTGGCTCCCGAGCGCCGG 0: 1
1: 0
2: 1
3: 5
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920351995 Original CRISPR TCCATCTGGCTCCCGAGCGC CGG Exonic
900389150 1:2426611-2426633 TCCCTCTGTCTCCAGAGTGCCGG + Intronic
901504607 1:9676614-9676636 ACCATCTGGCTCCAGTGCACTGG + Intronic
902533202 1:17103673-17103695 TCCACATGGCTACCGAGCACTGG + Intronic
902818914 1:18931760-18931782 TCCATATGGCTCCCAAGCCTGGG + Intronic
904270909 1:29349484-29349506 TCCATGTGGCCCCCAAGCCCAGG - Intergenic
906060945 1:42948213-42948235 GCCATCTGGCATCCGAGCGTTGG - Intronic
907248508 1:53122859-53122881 TCCATGTGGCTCCAGAGGGCTGG - Intronic
907430259 1:54406988-54407010 CCAGTCTGGCTTCCGAGCGCCGG + Intronic
914097266 1:144554543-144554565 TGCCTCAGGCTCCCGAGAGCTGG + Intergenic
914301728 1:146383073-146383095 TGCCTCAGGCTCCCGAGAGCTGG - Intergenic
919451212 1:197775179-197775201 TCCGTCCGGCCCCCGCGCGCTGG + Exonic
920351995 1:205343699-205343721 TCCATCTGGCTCCCGAGCGCCGG + Exonic
921039470 1:211416460-211416482 TCCCCCTGCCTCCGGAGCGCCGG + Intergenic
922817408 1:228459561-228459583 TACATCCGGCTCCCCCGCGCAGG - Exonic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
1070305489 10:75236497-75236519 TCCATCTGGCCCCCAAAAGCAGG - Intergenic
1071851101 10:89571361-89571383 TGCCTCAGCCTCCCGAGCGCTGG + Intergenic
1085808079 11:79654980-79655002 TCCACCTGGCTCCAGAATGCAGG - Intergenic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1088743642 11:112786709-112786731 TCTATTTGGCTCCAGAGTGCTGG + Intergenic
1089166087 11:116477632-116477654 TCCTTCTGGCTCACAAGCTCTGG - Intergenic
1089330610 11:117686489-117686511 TCCATCAGCCTCCCCAGCCCTGG + Intronic
1096392646 12:51241032-51241054 TCCACCTGGCTCCACAGTGCTGG + Exonic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1100372624 12:93982359-93982381 TCCTTTTGGCTCCTGAGCTCTGG - Intergenic
1102080356 12:110092858-110092880 TCCATATGACTCCAGAGCACAGG - Intergenic
1102203962 12:111077444-111077466 TCCATCAGGCTCACCAGCCCCGG + Intronic
1103339760 12:120215203-120215225 TCCAGCTGGCTCCCGGGCTTCGG + Exonic
1103407592 12:120686956-120686978 TCCATCTGGTGCCCGACTGCTGG + Exonic
1103462393 12:121115381-121115403 TCCATATGACTCCAGAGCCCGGG + Intergenic
1104572594 12:129938215-129938237 TCCAGCTGGCTCACCAGAGCTGG + Intergenic
1104605322 12:130183781-130183803 ACCATCTGGATCCCGAGCCATGG + Intergenic
1105606244 13:21928588-21928610 TCCCGCAGCCTCCCGAGCGCTGG - Intergenic
1112446500 13:99469348-99469370 ACCATCTGGCTCCCAAGGCCAGG + Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1118740898 14:68738528-68738550 TCCATTCGGCTCCTGAGCTCTGG + Intergenic
1119779231 14:77267032-77267054 TCTATCTGGCTCCAGAGCCCAGG - Intronic
1122904187 14:104794585-104794607 TCCATCTGCCTCCAGAACCCTGG + Intronic
1123020304 14:105394882-105394904 TCCTTCTGGCTTCCCAGCCCCGG - Exonic
1129709748 15:77814727-77814749 TCCATCTGGCATCCAAGCCCAGG + Intronic
1131438175 15:92439487-92439509 TCCAGCCGGCTCCCCAGCCCTGG + Intronic
1131517560 15:93089185-93089207 TGCAGTTGTCTCCCGAGCGCTGG - Intronic
1131530560 15:93187735-93187757 TCCATCTGATTCCAGAGCCCAGG - Intergenic
1133823758 16:9259535-9259557 TCCTTCTGGCTCCCGAATGCAGG + Intergenic
1135590313 16:23700599-23700621 TCCGGCTGGCCCCCGAGTGCAGG + Exonic
1135845648 16:25916205-25916227 TCTGTCTGGCTCCAGAGCTCAGG + Intronic
1136037268 16:27549805-27549827 TCCAGCCGGCTCCACAGCGCTGG + Exonic
1137272053 16:46908317-46908339 TCCATCAGTCTCCCAAGCTCAGG - Intronic
1141068944 16:80935955-80935977 TCCACCTGGCGCCCCAGGGCTGG + Intergenic
1141432255 16:83976273-83976295 GCCATCTGGCTCCCAAGTCCAGG - Intronic
1141470601 16:84235934-84235956 ACCATCTGGCTCCCGAGTGGAGG + Intronic
1147341332 17:39754685-39754707 CTCATCGGGGTCCCGAGCGCCGG - Intergenic
1155611743 18:27674192-27674214 TCCAGCTGGCTGGCAAGCGCCGG + Intergenic
1161838778 19:6665883-6665905 TCCTTCAGGCTCCCAAGTGCTGG + Intronic
1162771713 19:12953333-12953355 TCCGTCTGGCTGCAGAGAGCTGG - Exonic
1166647150 19:44540772-44540794 TCCATCTGACTCAAGAGCCCAGG + Intergenic
1167346322 19:48947650-48947672 ACCATCTGGCTCCAGTGCCCAGG - Intergenic
1167814539 19:51868406-51868428 TCCATCTGGCCCATGAGAGCAGG + Intronic
1168070977 19:53951584-53951606 GCCACCTGGCTCCCCAGCGTTGG + Intergenic
1168348233 19:55661115-55661137 GTCATCTGGCTCCCGACCACGGG - Exonic
1168472814 19:56653177-56653199 TCCATCTCACTCCCCAGCCCTGG + Intronic
1168520102 19:57043373-57043395 TCCTTCTGGCTCCTGAGTGGAGG - Intergenic
925288578 2:2731357-2731379 TCCAGCTGGCTCCCAAGGCCTGG - Intergenic
925731844 2:6924629-6924651 TCCATCTCCCTTCCGAGTGCGGG + Intronic
928206487 2:29288214-29288236 TGCATCTGCATCCCGAGCCCTGG - Intronic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
931920148 2:67006385-67006407 TGGATCTGGGTCCCAAGCGCAGG + Intergenic
932495629 2:72144548-72144570 TCCGAGAGGCTCCCGAGCGCGGG - Intronic
938973008 2:136449313-136449335 TCCATCAGGCCCCAGAGCGATGG + Intergenic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
944696080 2:202201571-202201593 TCCACCTGGCTCCACAGTGCTGG - Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
947535874 2:230940176-230940198 TCCATCTGGCTGCTGGGCTCTGG - Intronic
948501265 2:238396787-238396809 TCCATCTGGCCCCTGACCCCTGG + Intronic
948946912 2:241225079-241225101 TTCATGTGGCTCCCCAGCACAGG - Exonic
1169859919 20:10140710-10140732 TCCATCTGGATGCAGAACGCCGG + Intergenic
1170525104 20:17228574-17228596 TCCATCTCGCTCCTGATCCCAGG + Intronic
1170890181 20:20369244-20369266 TGCTTCTGGCTCCGGCGCGCGGG - Exonic
1171348701 20:24486287-24486309 TCCACCTGGCTCCCCAGCCCAGG - Intronic
1172449038 20:35008877-35008899 TCCAACTGGGTCCAGAGCCCCGG + Intronic
1172600723 20:36180881-36180903 GCCATCTGGCCCCAGAGCCCAGG - Intronic
1175835175 20:61989189-61989211 TGCATTTGGGTCCCGAGCTCTGG + Intronic
1185137017 22:49078988-49079010 TCCAGCTGGCTCCAGAGCATGGG - Intergenic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
949922379 3:9013349-9013371 TCCCTCTAGCTCCCGGGGGCTGG + Exonic
951052696 3:18112175-18112197 TCCATCTGGCTTCAGGGCTCGGG - Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953363467 3:42321796-42321818 TCCATCTGGCTTCAGAGCAAAGG - Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
962611699 3:137082896-137082918 TCCATCTGGTTCCTAAGGGCTGG + Intergenic
968092271 3:195906833-195906855 TCCCTCTGGCCCCTGAGCCCGGG - Intronic
968640579 4:1712510-1712532 TCCATCTGGCTCCCGAGCCGAGG - Exonic
969491957 4:7504581-7504603 TCCATCTGGCTCTGGACCCCAGG + Intronic
970669385 4:18378407-18378429 GCCATCTGGCTCCCAAGTCCTGG - Intergenic
974401423 4:61412699-61412721 TCCATTTGGCTCTAGAGCCCAGG + Intronic
974449977 4:62041892-62041914 GTCATCTGGCTCCTGAGTGCAGG - Intronic
975666609 4:76740301-76740323 TCCAGATGGCTCCCGAGGTCAGG - Exonic
975696681 4:77020970-77020992 GCCATCTGGGTCCTGAGCCCAGG + Intronic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
984854769 4:184185439-184185461 ACCATGTGGCTCTAGAGCGCTGG - Intronic
984973364 4:185209751-185209773 TCCCCCTGCCTCCGGAGCGCCGG + Intronic
985253007 4:188042153-188042175 TCCTTCTGGCTCCCCATCGTGGG + Intergenic
985403531 4:189615153-189615175 TCCACCTGCCTCCCCAGTGCAGG - Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
990475830 5:56160869-56160891 GCCATCTGGCTGCAGAGCCCGGG - Intronic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
995531880 5:113099672-113099694 GCAATCTGGCTCCAGAGCCCTGG + Intronic
995626884 5:114089388-114089410 TCAATCTGGCTCACCAGCACTGG + Intergenic
1004292910 6:14384652-14384674 TCTCTCTGGCTACCGAGCCCAGG - Intergenic
1006438451 6:34039187-34039209 TCCTTCTGCCTCCCCAGGGCTGG + Intronic
1014020060 6:116576547-116576569 TCTATCTGGCTCCCCAGGTCCGG + Intronic
1016730526 6:147423017-147423039 TCCATCTGGCTGCAGACAGCAGG + Intergenic
1016935228 6:149444974-149444996 TTCAGCTGGCTTCTGAGCGCTGG + Intergenic
1021936821 7:25639279-25639301 ACCATCTGGCTCCAGAGTCCAGG - Intergenic
1033455113 7:141496104-141496126 TCCATCTGGCCCCAGAGCTTAGG - Intergenic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1035690127 8:1554563-1554585 CCCATCTGCCTCCTGAGCCCGGG + Intronic
1036562248 8:9906901-9906923 TCCATCTGGCCCGGGCGCGCTGG - Intergenic
1039385492 8:37131903-37131925 TCCATCTGGCTCTCCTGTGCAGG - Intergenic
1044388899 8:91625349-91625371 TCAATCTGGCTCCAAAGCTCAGG + Intergenic
1045468395 8:102489676-102489698 TCCACCTGCCTCCCGGGCCCAGG - Intergenic
1056710973 9:88991601-88991623 CCCATCTGGCATTCGAGCGCAGG + Exonic
1056922392 9:90802071-90802093 AGCTTCTGGATCCCGAGCGCGGG - Intronic
1057555400 9:96083794-96083816 GCCATCTGGCTCCCCATCACGGG + Intergenic
1058149004 9:101443519-101443541 TCCATCTGGCACCCCAGTGGGGG - Intergenic
1060931845 9:127494162-127494184 CCCATCCGGCTCCTGGGCGCTGG + Intronic
1061414329 9:130438230-130438252 TCCATCTGACTCCAGAGTCCTGG + Intergenic
1061889333 9:133609358-133609380 TCCAGCCTGGTCCCGAGCGCAGG + Intergenic
1062521915 9:136961490-136961512 TCCTGCTGGCTCCTGAGCCCAGG + Intergenic
1062561263 9:137143120-137143142 GCCCTCTGGCTCCTCAGCGCTGG - Intronic
1203654120 Un_KI270752v1:7333-7355 TGCCTCTGCCTCCCGAGTGCTGG + Intergenic
1203655527 Un_KI270752v1:20652-20674 TGCCTCTGCCTCCCGAGTGCTGG + Intergenic
1188881779 X:35499307-35499329 TCCCGCTGGCTCGCAAGCGCCGG - Intergenic
1189996860 X:46647225-46647247 TCCTTGTGGCTCCCGGGCTCAGG + Intronic