ID: 920352168

View in Genome Browser
Species Human (GRCh38)
Location 1:205344302-205344324
Sequence GAGAAGCGGAGCCGCCGCCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920352161_920352168 23 Left 920352161 1:205344256-205344278 CCGCTGTCACACATGCAGATGAG 0: 1
1: 0
2: 2
3: 20
4: 223
Right 920352168 1:205344302-205344324 GAGAAGCGGAGCCGCCGCCGGGG 0: 1
1: 1
2: 1
3: 11
4: 114
920352160_920352168 30 Left 920352160 1:205344249-205344271 CCGCGCGCCGCTGTCACACATGC 0: 1
1: 0
2: 0
3: 3
4: 54
Right 920352168 1:205344302-205344324 GAGAAGCGGAGCCGCCGCCGGGG 0: 1
1: 1
2: 1
3: 11
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920352168 Original CRISPR GAGAAGCGGAGCCGCCGCCG GGG Exonic
900117050 1:1033407-1033429 GTGAATCGGAGTCGCCGCAGGGG - Intronic
901081437 1:6586300-6586322 GAGAAGGGGAGCCGCTACAGGGG + Intronic
901280019 1:8026521-8026543 GAGGAGCGGAGCTGCGGCCGCGG - Intergenic
905347937 1:37324054-37324076 GAAAAGGGGACCCGGCGCCGTGG + Intergenic
905775629 1:40665601-40665623 GCGGAGCGGAGCTGCCCCCGTGG - Exonic
908561326 1:65309557-65309579 GCGAGGCGAAGCCGCCGCCCTGG - Exonic
920074732 1:203327735-203327757 GAGAAGCGGGGACGCCTTCGAGG - Intergenic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
920352168 1:205344302-205344324 GAGAAGCGGAGCCGCCGCCGGGG + Exonic
921229165 1:213051258-213051280 GTGCAGCTGAGGCGCCGCCGTGG + Exonic
922897101 1:229108926-229108948 GAGAAGCGGAGCCGCCTGGAAGG + Intergenic
1064712413 10:18140680-18140702 GAGGAGGGGACCCGCCGCCGGGG + Exonic
1065637551 10:27746018-27746040 TAGCAGAGGAGCCGCTGCCGGGG + Exonic
1068669503 10:59709490-59709512 GAGCACCGGAGGCCCCGCCGAGG - Exonic
1070112090 10:73495957-73495979 GCCAAGCGGCGGCGCCGCCGGGG + Exonic
1071997722 10:91163507-91163529 CAGCAGCGGCGCCTCCGCCGAGG + Intronic
1076864434 10:133160113-133160135 GAGGGGCGGAGCCGGCGCCCAGG - Intergenic
1077002335 11:330535-330557 GAGAAGGGGAGTCGCTGCCCCGG - Intergenic
1077038697 11:507692-507714 GACATGCGGAGCCGCCCCAGGGG - Intergenic
1078382575 11:10857837-10857859 GAGAAGCAGAGCCGCCGCCGCGG - Intronic
1084758303 11:71252532-71252554 GAGCTCAGGAGCCGCCGCCGCGG + Intronic
1084791468 11:71477744-71477766 CAGAGGCGGAGCCGCAGCCCCGG - Intronic
1090238396 11:125165524-125165546 GAGTCGAGGAGCCGCGGCCGCGG + Intronic
1090401576 11:126452745-126452767 GAGGACCGGAGCCGCTGTCGGGG + Intronic
1091335338 11:134762206-134762228 CAGCAGCGCAGACGCCGCCGGGG + Intergenic
1097190395 12:57216790-57216812 GAGGCGCGGAGCCGGCGCTGGGG - Exonic
1097676068 12:62603467-62603489 GAGAGGCGGCGCCGGCGCCCGGG - Exonic
1100869318 12:98894547-98894569 AAGAAGTGGTGCCGCAGCCGGGG - Intronic
1101466923 12:104958361-104958383 GCGCAGCCGCGCCGCCGCCGGGG + Intronic
1102310746 12:111842561-111842583 CCGAAGCAGAGCCGGCGCCGGGG + Intronic
1103308905 12:119989265-119989287 GCGATGTGGAGCCGCCGCCTCGG + Intergenic
1103649635 12:122422628-122422650 GTGACGCGCCGCCGCCGCCGCGG + Intronic
1105890776 13:24680901-24680923 GAGAAGCGGTGCCCAGGCCGGGG - Intronic
1106057725 13:26254312-26254334 GAGCGGCGGAGCCGGCGCCCAGG + Exonic
1114621566 14:24099250-24099272 GAGAAGCAGGGCAGCTGCCGGGG + Intronic
1116846412 14:49868309-49868331 GGGAGGCGGGGCCGCCGGCGGGG + Intergenic
1118849327 14:69572403-69572425 GAGGAGCGGCGAGGCCGCCGTGG - Exonic
1122220976 14:100239065-100239087 GGGAAGCCCCGCCGCCGCCGCGG + Exonic
1123023068 14:105411315-105411337 GCGAAGGGGAGCTGGCGCCGAGG + Intronic
1130520681 15:84658471-84658493 GGGAAGCGGCTCCGCCGCCGGGG - Exonic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1132744002 16:1429200-1429222 CAGAAGCCGAGCCGACGCCCCGG - Intergenic
1141730798 16:85821601-85821623 GGGAAGCGCAGCAGCTGCCGGGG - Intergenic
1142136279 16:88453346-88453368 GAAAAGCCGAGCGGCCGCGGCGG + Exonic
1142764788 17:2058947-2058969 GAGAGGTGGAGCCGCCACTGTGG - Exonic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1143554244 17:7650934-7650956 GAGGAGCGGAGCCTCCGCCTGGG + Intronic
1147044787 17:37744403-37744425 GAGAAGCAGAGCGCCCCCCGGGG + Intronic
1151464231 17:74274276-74274298 GAGCACCGGAGCCGCGACCGTGG + Intronic
1152049075 17:77958722-77958744 GAGGTGCGGAGCTGCCACCGCGG - Intergenic
1152174926 17:78781611-78781633 GGGGAGCGGCGCCGCCGGCGAGG - Intronic
1152190203 17:78883542-78883564 CAGAAGCGCAGCCTCAGCCGGGG + Intronic
1153488799 18:5628653-5628675 CAGAAGTGAAGCCGCCGCCTGGG - Intronic
1155209187 18:23586395-23586417 GGGAAGTAGAGCCGCCTCCGGGG - Exonic
1158305400 18:56099907-56099929 GAGAAGCGGAGCAGTCGGCAGGG - Intergenic
1160076325 18:75680916-75680938 GAGAAGCAGAGCGGCCTCCTTGG + Intergenic
1161069507 19:2253171-2253193 GAGAAGGGGCGCCGCGGCAGCGG - Intronic
1162609511 19:11738541-11738563 GAGACGCGGAGCTGCGGGCGCGG + Intronic
1162914240 19:13865630-13865652 GAGACGCAGAGATGCCGCCGGGG - Intronic
1163189252 19:15664282-15664304 GACAAGTGGAGCTGCCACCGTGG + Intergenic
1164834724 19:31349760-31349782 GGGACGCGCAGCCGCCGCCGCGG + Intergenic
1165157228 19:33796057-33796079 GAGGAGAGCAGCCGCCGCCGCGG - Intronic
1165402809 19:35612765-35612787 GGGAGGCGGTGTCGCCGCCGCGG + Exonic
1167633501 19:50639848-50639870 GAGGAGCCGAGCCGGCACCGCGG - Intronic
1168110244 19:54188311-54188333 GAGATGGGGAGCAGCCGCTGTGG - Exonic
932566732 2:72915754-72915776 GAAAAGTGGAAGCGCCGCCGAGG - Intergenic
932702696 2:74002375-74002397 GCGGAGCGGAGCAGACGCCGGGG - Intronic
937208668 2:120253135-120253157 GCGGAGCGGGGCCGCTGCCGGGG - Intronic
940301008 2:152176209-152176231 TAGAAACGGAGCTGCCGGCGCGG + Intergenic
944221723 2:197310403-197310425 GCGGAGGGGAGCTGCCGCCGCGG + Intronic
948206968 2:236167626-236167648 GCGACGCGGAGAAGCCGCCGGGG + Exonic
949018229 2:241725484-241725506 GAGGAGGGCAGCCGCCGCCACGG - Exonic
1169068897 20:2709730-2709752 GAGGAGCGGAGCAGCCCCCCCGG + Intronic
1175517252 20:59577472-59577494 GCGGAGCGGAGCCGGGGCCGCGG - Intergenic
1179840852 21:44072342-44072364 CAGCAGCGGAGCCGCGGCAGAGG - Intronic
1179965402 21:44801915-44801937 GAGAATCGTAGCCGCGGTCGCGG - Exonic
1182578981 22:31292399-31292421 GGGAGGCAGAGCCGCCGCCAAGG - Exonic
1184680778 22:46071302-46071324 GAGCAGCGGATTCGCCGCCCGGG - Intronic
950725047 3:14911830-14911852 GAGAAGAGGAGCCACAGCCACGG + Intronic
952383491 3:32821869-32821891 GAGAAGAGCAGCCGCCGGCCAGG - Intronic
954223082 3:49166295-49166317 GAGCAGCGGAGGCGGCGCAGAGG - Exonic
956468569 3:69542338-69542360 GAGGAAGGCAGCCGCCGCCGGGG - Intronic
961340291 3:126213011-126213033 GAGAAGCAGAGCCGGCGGTGGGG - Intergenic
961688307 3:128650608-128650630 GGGACGTGGAGCCGCCGCCCAGG + Exonic
961787220 3:129354406-129354428 GAAAAGTGGTGCAGCCGCCGTGG + Intergenic
961828469 3:129611255-129611277 AAGAAGCAGTGGCGCCGCCGTGG - Intergenic
963746465 3:149129573-149129595 AAGTAGCGGAGCCGCGGGCGGGG + Exonic
964570738 3:158105639-158105661 GGGAAGGGGAACCGCTGCCGGGG + Intronic
969379193 4:6783035-6783057 GGGAGGCCGAGCCGCCGCCGAGG + Intronic
971244127 4:24913057-24913079 GAGGAGGGGCGCGGCCGCCGGGG + Intronic
972671029 4:41214273-41214295 GAGCAGAGGAGAAGCCGCCGGGG + Intronic
976177948 4:82373534-82373556 GGGAAGCGGAGCCGGGACCGGGG - Exonic
978072626 4:104491565-104491587 CAGCAGCGCCGCCGCCGCCGCGG - Exonic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
979547168 4:121951565-121951587 GAGCCGCAGCGCCGCCGCCGGGG - Exonic
990347449 5:54884129-54884151 GGGACGCGGGGCCGCCGCGGCGG - Intergenic
997990803 5:138543133-138543155 CCGCCGCGGAGCCGCCGCCGGGG - Exonic
1001906541 5:175478411-175478433 CAGAAGCGGAGTCGCGGGCGCGG + Exonic
1002897899 6:1389880-1389902 GGGAAGCGGAGGCGCCGGAGCGG - Exonic
1004216799 6:13711299-13711321 GAGGAGCAGGGCGGCCGCCGCGG + Exonic
1006589201 6:35141652-35141674 GAGAAGCGGAGGAGCCGCCAGGG + Intronic
1007781435 6:44257078-44257100 GAGGGGCGGATCCGCCCCCGGGG - Intronic
1008932467 6:56954927-56954949 GAGGAGCAGCGCCGCCGCCGCGG + Intergenic
1013507562 6:110815205-110815227 GAGAAGTGGAGCGGCGGTCGCGG - Exonic
1013792718 6:113855234-113855256 AAGAGGCGGAGCCGGCGCTGGGG - Intergenic
1019711503 7:2520118-2520140 GAGATGCGGGCCCGCCGCCCGGG + Exonic
1035429306 7:158806046-158806068 TAGCAGCAGAGCCGGCGCCGGGG + Intronic
1036663914 8:10726444-10726466 GAGAAGAGAAGCGGCAGCCGGGG - Exonic
1037450744 8:19013852-19013874 GAGAGGCGGGGCCGACGCCTCGG + Intronic
1038266260 8:26041771-26041793 GAGAAGGGGAGCGGCGGCCTTGG + Intronic
1045489176 8:102656034-102656056 GAGAGGCGGTGCCGCGGCCGGGG + Intergenic
1047961659 8:130016076-130016098 GCGCAGCGGGGCCGCCGCCCGGG - Intronic
1049211066 8:141386651-141386673 AAGAGGCAGAGCCGCAGCCGGGG - Intergenic
1049405306 8:142449669-142449691 GAGGAGCGGAGCGGCGGCGGCGG + Exonic
1049686868 8:143942569-143942591 TGGAAGCAGAGGCGCCGCCGCGG - Intronic
1057311505 9:93946057-93946079 TGGAAGCGGAGCTGCCGCGGGGG + Intergenic
1059208444 9:112487362-112487384 GCGGACCGGAGCCGCCACCGGGG - Intronic
1061501973 9:131009213-131009235 CAGAAGCGCAGCCGCCGCCATGG - Exonic
1061721770 9:132556420-132556442 GACAAGCTGAGCCGCCGGGGAGG - Intronic
1062305905 9:135907126-135907148 GAGCGGCCGCGCCGCCGCCGAGG - Exonic
1062335052 9:136061318-136061340 GGGAAACGGAGCTGCCGCCATGG - Intronic
1062472383 9:136712298-136712320 GGGAGGCGGAGCCGGGGCCGGGG - Intergenic
1191701195 X:64044366-64044388 GGGAAGCGGAGCCGCGATCGGGG + Intergenic
1192265981 X:69538453-69538475 GGGAGGCGGAGGCGCAGCCGCGG + Intergenic
1194977573 X:100409636-100409658 GAGAGGCGGGGCCGCCGCCGTGG + Exonic
1196444283 X:115737319-115737341 GACCAGCGGAGCCTCCGCCAGGG - Intergenic
1202372159 Y:24205854-24205876 TAGAAGGGGAGCAGCCGCCCAGG - Intergenic
1202498626 Y:25464262-25464284 TAGAAGGGGAGCAGCCGCCCAGG + Intergenic