ID: 920352170

View in Genome Browser
Species Human (GRCh38)
Location 1:205344308-205344330
Sequence CGGAGCCGCCGCCGGGGAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 411}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920352161_920352170 29 Left 920352161 1:205344256-205344278 CCGCTGTCACACATGCAGATGAG 0: 1
1: 0
2: 2
3: 20
4: 223
Right 920352170 1:205344308-205344330 CGGAGCCGCCGCCGGGGAGGAGG 0: 1
1: 0
2: 3
3: 43
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920352170 Original CRISPR CGGAGCCGCCGCCGGGGAGG AGG Exonic
900335482 1:2160949-2160971 AGGCGCCGCCGTCGGGGTGGAGG + Intronic
900600645 1:3501387-3501409 TGGAGCCACGGCCGAGGAGGTGG + Intronic
900966332 1:5961282-5961304 CGGAGCTTCAGCCGGGGAAGAGG + Intronic
901068631 1:6506429-6506451 CGGAGCCCCCACCGAGGAGACGG + Intronic
901139588 1:7019831-7019853 CGGAGCAGGTGCCGGGGAGCTGG - Intronic
901157877 1:7152674-7152696 CAGAGGCGCCTCCTGGGAGGTGG - Intronic
901483179 1:9539857-9539879 CGGCGCCGGCGCTCGGGAGGAGG + Intronic
901597908 1:10399454-10399476 CAGAGCCTCGGCCGGGCAGGCGG - Intronic
902163638 1:14552359-14552381 GGGAGCCGCCTGCAGGGAGGAGG + Intergenic
902823161 1:18955885-18955907 GCGAGCCGCCGCCGGGGGGCAGG + Exonic
903829123 1:26164416-26164438 CGCCGCCGCCGCCTGCGAGGGGG + Intergenic
903897766 1:26620351-26620373 CGCAGCTGCCGCCGGGGCCGTGG - Intergenic
904043953 1:27599399-27599421 CAGAGCCCCCCCAGGGGAGGGGG - Intronic
904251827 1:29230700-29230722 CGGCGCCGAAGCCGGGGAAGGGG - Intronic
904500120 1:30908526-30908548 CGGGGCCGGCGCCGGGGCCGGGG - Exonic
904690798 1:32292110-32292132 CGGAGCCGCGGGCGGGAGGGCGG + Exonic
905106424 1:35565922-35565944 TGGAGCAGCCCCCAGGGAGGGGG + Exonic
905548686 1:38818882-38818904 CGGACCCGCGGCCAGGGAGGAGG - Intergenic
905775627 1:40665595-40665617 CGGAGCTGCCCCCGTGGTGGCGG - Exonic
910237341 1:85048756-85048778 CGGAGCTGCCGCCGGCGCCGGGG + Intronic
912818720 1:112850164-112850186 GGGAGCCGGCGCTGGGGAGCCGG + Intergenic
912915642 1:113812060-113812082 CTGCGACGCCGCCGGTGAGGGGG + Exonic
914702745 1:150149707-150149729 CCGAGCCGCCGCCGGAGCGAGGG + Intronic
915213340 1:154325584-154325606 CGGGGCCGCAGCTGGGGGGGCGG + Intronic
917974412 1:180229947-180229969 CGGAGGCGGAGGCGGGGAGGGGG + Intergenic
919403259 1:197146471-197146493 CGGAGCCGCCTCGTGGGAGCGGG - Exonic
919854453 1:201695836-201695858 CGGAGCTCCTGCCGGGGTGGTGG - Intronic
920352170 1:205344308-205344330 CGGAGCCGCCGCCGGGGAGGAGG + Exonic
921155066 1:212432953-212432975 CGCAGCCGCCGCCGCGGCGCGGG - Exonic
922725340 1:227920401-227920423 GGGAGCTGCAGCCGGGGAGGTGG + Exonic
922753522 1:228082117-228082139 CGGAGCAGACGCCGGGGAGCTGG - Intergenic
922950971 1:229558426-229558448 AGGAGCGGCTGCCGGGGCGGGGG - Exonic
923429142 1:233904612-233904634 CGGAGCGCACGCCCGGGAGGCGG + Intergenic
923684015 1:236142077-236142099 CGGTGCCGGGACCGGGGAGGAGG + Intergenic
923783022 1:237042490-237042512 GGGAGCCGGCCCCGGCGAGGAGG + Exonic
924527427 1:244864392-244864414 CGCAGCCGCCGCCCGGGCCGAGG - Exonic
924560713 1:245155041-245155063 CGCGGCCGCTGCCGGGAAGGTGG - Exonic
1063351796 10:5363357-5363379 TGGAGCAGCCGTCTGGGAGGAGG + Intergenic
1064202949 10:13299904-13299926 CGGCGCCGCCGCCTGAGTGGTGG - Intronic
1066370412 10:34814844-34814866 CGGGGGCGCGGGCGGGGAGGGGG - Intronic
1066429273 10:35336660-35336682 CGCCGCAGCCGCCGGGGAAGCGG + Intronic
1069769518 10:70888467-70888489 CGGGGCAGCCGCGGGCGAGGTGG - Intronic
1070312584 10:75284360-75284382 GGGAGCAGCAGGCGGGGAGGGGG + Intergenic
1070800780 10:79243342-79243364 CGCCGCCGCCGCCGCCGAGGAGG - Intronic
1072970135 10:100010043-100010065 CGGGGCGGGCGCCGGAGAGGTGG - Intergenic
1073268996 10:102245696-102245718 CGGAGACGCCTCCGGGGTGCGGG + Exonic
1073812353 10:107164658-107164680 CGGAGGCGGCGCCGGGCAGGTGG + Intergenic
1074869315 10:117564644-117564666 GGGAGCACGCGCCGGGGAGGAGG + Intergenic
1075031948 10:119029758-119029780 CCGCGCCGGCGGCGGGGAGGCGG + Exonic
1075406260 10:122197834-122197856 GGGACCCTCCGCCTGGGAGGCGG - Intronic
1076286869 10:129307926-129307948 TGGAGCCACAGCCGGGGTGGTGG - Intergenic
1076661483 10:132058530-132058552 GGGAGCGGCCTCCGGGGAGGAGG - Intergenic
1076916007 10:133423453-133423475 CGGGGCGGCAGCCGGGGCGGCGG - Exonic
1077073358 11:688129-688151 AGGTGGCGCTGCCGGGGAGGTGG - Intronic
1077124428 11:926120-926142 CGGGGCCGCCGGCGGAGACGGGG + Intronic
1077181887 11:1220524-1220546 TGGAGCCGCGGGCAGGGAGGGGG + Intergenic
1077250069 11:1557023-1557045 CGGGGCCGCCGGCGGGGCCGTGG + Exonic
1077253783 11:1571873-1571895 CGGAGGCGCCGGCGGGGCGGGGG - Intronic
1077253923 11:1572292-1572314 CGGGGCCGCCGGCGGGGATGAGG + Intergenic
1077457374 11:2689058-2689080 CGGATGTGCCACCGGGGAGGAGG - Intronic
1077495480 11:2884842-2884864 CGGGGCCGGGGCCGGGGCGGGGG + Exonic
1077495522 11:2884926-2884948 CGGAGCCGGAGCCGGGGCCGGGG + Exonic
1077495526 11:2884932-2884954 CGGAGCCGGGGCCGGGGCCGGGG + Exonic
1077495548 11:2884998-2885020 CGGAGCCGGAGCCGGGGCCGGGG + Exonic
1078210416 11:9265403-9265425 CGCAGGCGCCGTCTGGGAGGGGG + Intergenic
1079035187 11:17014414-17014436 CGGAGCCGCCGCGGGGTGGGGGG + Intronic
1079128837 11:17735922-17735944 GGGAGTTGGCGCCGGGGAGGGGG - Exonic
1080551377 11:33376319-33376341 AGGAGCCGGCCCGGGGGAGGGGG + Intergenic
1080628428 11:34051889-34051911 CCGAGCCGCTGCAGGGGAAGAGG + Intronic
1082843956 11:57712185-57712207 CGGAGACAGCGCCGGGGCGGAGG - Exonic
1083389499 11:62337593-62337615 CGGAGCAGCCGCCCGAGACGCGG + Intronic
1083618079 11:64036137-64036159 CTGCGCAGCGGCCGGGGAGGCGG - Intronic
1083766457 11:64843748-64843770 TGGCGCCGGGGCCGGGGAGGGGG - Intronic
1084070069 11:66728168-66728190 CGGAGCCGCGGCCGGGCGGGCGG + Intronic
1084284072 11:68120701-68120723 GGGAGCCGGGGCCGGGGCGGAGG - Intronic
1084295691 11:68212669-68212691 CAGGGGCGCCGTCGGGGAGGAGG + Intronic
1084304407 11:68272113-68272135 CCGAGCCGGCCCCGGGGAGGCGG - Intergenic
1084372039 11:68751008-68751030 GGGAGGGGCGGCCGGGGAGGGGG + Intronic
1084758015 11:71251550-71251572 CTGCCCGGCCGCCGGGGAGGAGG + Intronic
1089128428 11:116193569-116193591 CGGAGCCGGAGCCGGGAATGGGG - Intergenic
1089243137 11:117098447-117098469 GGGAGCCGGCTCGGGGGAGGGGG + Intergenic
1089500667 11:118929583-118929605 TGGAGCCGCGGAGGGGGAGGAGG - Intronic
1090616769 11:128522270-128522292 GGCAGCCGCCGGCGGAGAGGAGG - Intronic
1092199010 12:6568404-6568426 CGGAGCCGGCGGCGGCGAGTAGG + Intronic
1094155401 12:27332981-27333003 CAGAGCCGCCGCCTGGGCCGGGG + Intronic
1094536197 12:31324597-31324619 CGGGGCCGCCGCCTGGGCGTAGG - Intronic
1096231313 12:49898335-49898357 GGGAGCCCCAGCCGGGGTGGAGG - Intronic
1097190391 12:57216784-57216806 CGGAGCCGGCGCTGGGGGCGGGG - Exonic
1097223103 12:57461793-57461815 CGGAGCCGACTCCTGGGAGTTGG + Intronic
1097264414 12:57737508-57737530 CGCCGCCGCCGCCGGGGGAGGGG - Exonic
1097267543 12:57755032-57755054 CGGGGCGGGCGCCGGGGAGCGGG - Intronic
1097997354 12:65903526-65903548 CTGAGACATCGCCGGGGAGGTGG + Intronic
1098275644 12:68808672-68808694 GGCAGTCGCCGCCAGGGAGGAGG + Intronic
1100404708 12:94263198-94263220 CGGGGCCGGGGGCGGGGAGGCGG - Intronic
1101144807 12:101830898-101830920 CGGACCTGCGGCCGGCGAGGCGG + Exonic
1101150294 12:101877455-101877477 CGGAGCCGCCGGAGGGGACGCGG - Exonic
1101441588 12:104708319-104708341 CACAGCCGCCCCCGGGAAGGAGG - Intronic
1102003568 12:109573839-109573861 AGGGGCGGCGGCCGGGGAGGCGG + Exonic
1103209268 12:119154658-119154680 TGGAGCTGGGGCCGGGGAGGTGG + Intronic
1103209277 12:119154678-119154700 TGGAGCTGGGGCCGGGGAGGCGG + Intronic
1103359109 12:120343009-120343031 CCGAGTCGCTGCAGGGGAGGGGG + Exonic
1103433026 12:120904104-120904126 CGGAGCCGCCGCCGCCGCCGCGG - Exonic
1103819610 12:123687044-123687066 CTGAGCAGCCGCCTGGGATGGGG + Intronic
1104049495 12:125186285-125186307 CGGGGCCGCGGCCGGGGGAGGGG - Intergenic
1104568229 12:129903750-129903772 CGCAGGCGGCGCCGGGGTGGCGG + Intergenic
1104623932 12:130337913-130337935 CGAGGCCGGCGCCCGGGAGGCGG + Exonic
1104757813 12:131279755-131279777 CAGAGCAGCCTCCGTGGAGGGGG - Intergenic
1104775251 12:131387060-131387082 CAGAGCAGCCGCCCTGGAGGGGG + Intergenic
1104862365 12:131930180-131930202 AGGTGCGGCCGCCGGGGAAGCGG + Intronic
1104932602 12:132347714-132347736 AGGAGCCGGGGCCAGGGAGGCGG + Intergenic
1105512447 13:21061650-21061672 CGGAGCGGCCGCGGAGGAGCAGG - Intergenic
1105764667 13:23547211-23547233 CGGAGGCACCGCAGGGCAGGCGG + Intergenic
1106036932 13:26051805-26051827 CCGCGCTGCAGCCGGGGAGGCGG - Intergenic
1108396585 13:49996791-49996813 GCGAGGCGCGGCCGGGGAGGCGG + Intronic
1111951708 13:94713238-94713260 CCGAGCCGGCGCAGGGGCGGAGG + Intergenic
1113317427 13:109197104-109197126 CGGAGCCGCTGAAGGAGAGGGGG - Intronic
1113379206 13:109786995-109787017 TTGAGCTTCCGCCGGGGAGGGGG + Intergenic
1113643685 13:111976610-111976632 CGGAGCCGGCGAGGCGGAGGTGG + Intergenic
1113789913 13:113022765-113022787 CTCAGCCGCCGCCGCGGTGGGGG - Intronic
1114259284 14:21025548-21025570 CGGGACCGCCGCTGAGGAGGCGG + Intronic
1114668942 14:24398838-24398860 GGGAGCCGGCGGGGGGGAGGAGG - Exonic
1115028144 14:28766478-28766500 CGGAGCCGGCGGGGTGGAGGGGG + Intergenic
1115028485 14:28767720-28767742 GGGCGCCGGCGCCGGGGGGGAGG + Exonic
1115235833 14:31207803-31207825 CGGGGTCGCCGCCGGGGGAGTGG - Intronic
1115320826 14:32077388-32077410 CGGGGCCGCTGCCGTTGAGGAGG + Exonic
1117253601 14:53956870-53956892 GGGAGGGGCCGCCGGGGAAGAGG - Intronic
1117286653 14:54291922-54291944 CAGAGCTGCTGCCTGGGAGGAGG - Intergenic
1117315250 14:54566468-54566490 CGTGGCCGCCGCCGGCGGGGAGG - Intergenic
1118137409 14:63045210-63045232 AGGATCCGCGGCGGGGGAGGGGG + Exonic
1119254526 14:73184670-73184692 CGGAGCGGCTGGCGGGGCGGGGG + Intronic
1119403222 14:74378476-74378498 CGGAGTCGCGGCCGTGGACGCGG - Intergenic
1119835756 14:77747715-77747737 CGGGGCGGCTGCCGGGGCGGGGG - Intronic
1120791540 14:88588247-88588269 CAGAGCCGACTCAGGGGAGGAGG - Intronic
1121107262 14:91289199-91289221 CTGAGAGGCCGCCGGCGAGGCGG + Exonic
1121253194 14:92514306-92514328 CGGGGCAGACGCCAGGGAGGGGG - Intronic
1121422528 14:93825260-93825282 CGCAGCCGCTCCCGGGGGGGTGG + Intergenic
1122658472 14:103278998-103279020 CGGAGCCGGGGCGGAGGAGGCGG - Intergenic
1123068011 14:105627890-105627912 CAGAGCCGCCGCAGGTGAGCAGG - Intergenic
1123068050 14:105628045-105628067 CAGAGCAGCCACAGGGGAGGAGG - Intergenic
1123068387 14:105629343-105629365 CGGAGCCAGCACGGGGGAGGTGG - Intergenic
1123072398 14:105648148-105648170 CGGAGCCAGCACGGGGGAGGTGG - Intergenic
1123092407 14:105747667-105747689 CGGAGCCAGCACGGGGGAGGTGG - Intergenic
1123097984 14:105775368-105775390 CGGAGCCAGCACAGGGGAGGTGG - Intergenic
1202899769 14_GL000194v1_random:28350-28372 CGGCGCAGGCGCCGGGGGGGGGG - Intergenic
1123710072 15:22980447-22980469 CGGGGCCGCGGCCGGGAGGGAGG - Intronic
1123735593 15:23180046-23180068 AGGAGCTGCTGCCGGGGCGGGGG + Intergenic
1124286309 15:28403029-28403051 AGGAGCTGCTGCCGGGGCGGGGG + Intergenic
1124296394 15:28508607-28508629 AGGAGCTGCTGCCGGGGCGGGGG - Intergenic
1124375855 15:29128260-29128282 CAGAGCCGGGGCGGGGGAGGTGG - Intronic
1124453875 15:29822557-29822579 CGGGGCCGCGGCGGGGGAGGGGG + Intronic
1125541191 15:40471042-40471064 CGGCGCCGCAGCCCGGGAGCCGG + Exonic
1125606382 15:40941976-40941998 CGGAGCCGCGGGCGGGCAGGCGG + Intergenic
1125677856 15:41512067-41512089 CGGCGCCGGCGCCGGGGGCGAGG - Intronic
1126823650 15:52528891-52528913 CGCAGCCGCCGGCAGGGAGCAGG + Exonic
1128139078 15:65286390-65286412 CTGGGCGGCCGCCAGGGAGGCGG - Exonic
1128153544 15:65377856-65377878 CGGGGCCGGCGCCGGGGCCGGGG + Exonic
1128547720 15:68579136-68579158 CCGAGCCGCCGGCGGGGCGCGGG + Exonic
1128550603 15:68595874-68595896 CGGAGCGGGCGTCTGGGAGGAGG + Intronic
1129644697 15:77419725-77419747 CGGGGCCGCCGCCGAGGGAGGGG + Intronic
1129764067 15:78149803-78149825 CAGGGCCGCAGCCGGGGAAGCGG - Intronic
1131171975 15:90185109-90185131 GGGAGCCGCTGCCCGGGAGGTGG + Intronic
1132585789 16:705344-705366 CCCAGCGGCCGCGGGGGAGGTGG + Intronic
1132653145 16:1030625-1030647 CGCAGCGGCCGCCAGGGAGCGGG - Intergenic
1132785736 16:1656230-1656252 CGAAAGCGCCCCCGGGGAGGGGG + Exonic
1132934583 16:2474222-2474244 GGGAGCTGCCGGCGGGGACGGGG - Intergenic
1133924522 16:10182354-10182376 AGCAGCCGGCGCTGGGGAGGTGG - Intronic
1136230454 16:28882754-28882776 CTGAGACTCCGCTGGGGAGGGGG - Intronic
1136499728 16:30664381-30664403 GGGGGCCGCAGCCCGGGAGGGGG - Exonic
1138619171 16:58197947-58197969 TGGAGCGGCCGGCGGGGCGGCGG + Intergenic
1138672884 16:58629719-58629741 CGGAGCCGCCTGAGGTGAGGCGG - Exonic
1139459427 16:67110033-67110055 TGCCGCTGCCGCCGGGGAGGAGG + Exonic
1141531428 16:84649013-84649035 CGGAGACCCCGCCGGCGAGCCGG + Intronic
1141840130 16:86568577-86568599 CGGGGCCGCCGCGGCGCAGGCGG + Exonic
1142513164 17:410555-410577 CGGAGGCGCCGCCTGTGATGGGG - Exonic
1142638227 17:1270709-1270731 CGGAGGAGCCGGCGGGCAGGAGG + Exonic
1142983627 17:3685461-3685483 CAGTGCGGCCGCCGGGGAGAGGG + Intronic
1143590665 17:7884683-7884705 GGACGCCGCCGCCGAGGAGGAGG + Intronic
1144339730 17:14301589-14301611 CGCCCCCGCCGCCGGTGAGGAGG + Exonic
1144527243 17:16000176-16000198 CGGGGCCGCTGCCGAGGACGGGG + Exonic
1144724804 17:17496487-17496509 GGGAGCCGGTGCGGGGGAGGCGG - Intergenic
1145750734 17:27353665-27353687 CGGACCCCACGGCGGGGAGGAGG - Intergenic
1146332333 17:31937413-31937435 CGCTGCCGCCGCGGAGGAGGAGG - Exonic
1146332335 17:31937416-31937438 CGCCGCTGCCGCCGCGGAGGAGG - Exonic
1147253110 17:39165458-39165480 CGGAGCCAGCGGCGGGGATGGGG - Intronic
1147971294 17:44220067-44220089 TGCTGCCGCCGCCGGGGAAGGGG + Intronic
1148108741 17:45132749-45132771 GGGAGCCGGCACCGGGGACGAGG + Intronic
1148183111 17:45620684-45620706 CGGGGCCGCGGCCGGGGGCGCGG + Intergenic
1148265740 17:46225007-46225029 CGGGGCCGCGGCCGGGGGCGCGG - Intronic
1148370971 17:47099940-47099962 CGGGGCCGCGGCCGGGGGCGCGG - Intergenic
1148437165 17:47693964-47693986 CGGAGCAGCCGGGGAGGAGGAGG + Intergenic
1148648131 17:49230758-49230780 CGGAGCCGCGGCCGGCGCTGCGG + Exonic
1148664079 17:49361855-49361877 CGGGGGCGCCGCCGCGGCGGTGG + Intronic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1148826461 17:50397620-50397642 CGTCGCCGCCGCCGGAGGGGTGG + Intergenic
1148878625 17:50707865-50707887 GGGAGGCGCGGCCCGGGAGGAGG - Exonic
1149431336 17:56596965-56596987 CGGAGGCAGCGCCGGGGAGGGGG - Intergenic
1150003657 17:61456655-61456677 CGCCGCCGCCGCCGCGGAGCAGG + Exonic
1151529426 17:74695134-74695156 CAGGGCCCCTGCCGGGGAGGTGG + Exonic
1151802079 17:76384618-76384640 CGCAGCCGGCGCCGCGGAGCGGG - Intronic
1152049235 17:77959235-77959257 CGGAGCCGCCGCCGCCGCCGGGG + Intergenic
1152214420 17:79024269-79024291 CGGAGACCGCGCCGGGGAGACGG + Exonic
1152222207 17:79075054-79075076 AGGAGCCGCGGCCGCGGCGGCGG + Exonic
1152362488 17:79839129-79839151 CGGAGCGGCCCGCGAGGAGGCGG - Intronic
1152663178 17:81552362-81552384 CGGAGCCGCCGCCGCGCGGCCGG - Exonic
1152677260 17:81648067-81648089 CGCAGCCACCGCCGGAGCGGCGG - Exonic
1152749400 17:82055709-82055731 AGGAGCCGGGGGCGGGGAGGGGG - Intronic
1152755517 17:82085461-82085483 AGGTGCGGCCGCCGGGCAGGGGG - Exonic
1152924552 17:83081051-83081073 CGGAGCCTCCCCGGGGGAAGGGG + Intronic
1158137624 18:54224300-54224322 CGGGGCCGTGGCCGGGGACGGGG - Exonic
1158954472 18:62524793-62524815 CGGAGCCCCGGCCAGGCAGGCGG - Intronic
1159102347 18:63970619-63970641 AGGAGCCGCCGCTGCGGAGGAGG + Intronic
1159798082 18:72867708-72867730 CGGGGCCGGGGCCGGGGAGAGGG + Exonic
1160024932 18:75209230-75209252 CTGCGCCGGCGCCGGGGAGGCGG - Exonic
1160028742 18:75240655-75240677 GGGCGCCCCCGCTGGGGAGGAGG - Intronic
1160138517 18:76296617-76296639 CACAGCCGCCGCCAGAGAGGGGG + Intergenic
1160163208 18:76491268-76491290 CGGGGCCGGGGCCGGGGAGGGGG - Intronic
1160454844 18:78992956-78992978 CGGCGCTGGCGCCGGGGCGGGGG - Exonic
1160499181 18:79394118-79394140 AGGAGCCGGGGCCGGGGCGGGGG - Intergenic
1160592533 18:79952145-79952167 CGGGGCCGTCGCCGGGGGGCCGG + Intergenic
1160659634 19:291866-291888 CGGAGCCCCGGGCGGGGACGTGG + Intergenic
1160698600 19:496153-496175 GGGACCCGCCGTCGGGGTGGGGG + Intronic
1160724854 19:613566-613588 CGGGGCCGGGGCCGGGGATGGGG + Intronic
1160769038 19:822114-822136 GGGAGGCGGCGCCAGGGAGGCGG - Intergenic
1160930759 19:1568452-1568474 CGGGGCCGGCGCCGGGCACGTGG + Intergenic
1161031893 19:2061441-2061463 CGCGGCCGCCGCCGGGGAGGGGG - Intergenic
1161153378 19:2720903-2720925 AGGAGCCCACCCCGGGGAGGGGG + Intronic
1161301498 19:3545015-3545037 CGGAGCCGCTGTCGGGGGTGAGG - Intronic
1161313138 19:3606218-3606240 GGGGGCTGCAGCCGGGGAGGGGG - Intronic
1161505082 19:4639512-4639534 CGGAGCCGGGGCCGGGGCCGGGG - Intronic
1161628768 19:5340886-5340908 CGCCGCCGCCGCCGGGTCGGGGG + Intergenic
1161703248 19:5805944-5805966 CGCCGCCGCCGCCGGGGACACGG + Intergenic
1162022420 19:7873948-7873970 TGGAGCCGAGGCGGGGGAGGCGG - Intronic
1162033250 19:7926178-7926200 CGGGGCCGCCGCGGGGGGCGGGG + Intergenic
1162144442 19:8605250-8605272 CGGCGCTGCCTCCGGGGAGGAGG + Exonic
1162310962 19:9906998-9907020 CTGAGTGGCAGCCGGGGAGGGGG + Intronic
1162697106 19:12484832-12484854 CAGGGGCGCCGCCGGGAAGGCGG - Intronic
1162698383 19:12495363-12495385 TGGAGACGCCGCCGGAGCGGTGG + Intronic
1162992476 19:14312486-14312508 AGGAGCCGCAGCCGGGGTGGGGG + Intergenic
1163459015 19:17425143-17425165 CGGAGCTGCAGCCCTGGAGGAGG + Exonic
1163579857 19:18131898-18131920 CGCAGTCGCCGCCTGGGAGAAGG - Exonic
1164693208 19:30226045-30226067 CGGGACCGCGGGCGGGGAGGCGG - Intergenic
1165129435 19:33622620-33622642 CGGTGCTGCCCGCGGGGAGGCGG + Intronic
1165233153 19:34400087-34400109 CAGTGCCGGCTCCGGGGAGGAGG - Exonic
1165408239 19:35643389-35643411 CGGAGCCGGCGGCGGGGATGGGG - Exonic
1166304257 19:41928598-41928620 CGGCGGCGGCGCGGGGGAGGGGG + Intronic
1166780630 19:45340828-45340850 CGGAGCCGCCCGCGGTCAGGTGG + Exonic
1166984142 19:46649575-46649597 AGGCGCCGCCGCCGGGGGGCGGG - Exonic
1167237172 19:48322060-48322082 AGCAGCCGCCGCCGCGGAGGGGG - Intronic
1167272072 19:48511445-48511467 CGAGGCCGCCGCGGGGGTGGGGG + Intronic
1167464321 19:49642219-49642241 CGGAGCCGCAGCCCGAGCGGCGG + Exonic
1167611762 19:50511159-50511181 CAGAGCCGCCGCCCAGGAAGGGG - Exonic
1167843417 19:52140106-52140128 CGGAGCCGCGGCGGAGGATGGGG + Intergenic
1168257299 19:55173844-55173866 CGGAGCCTGCGGCGAGGAGGAGG + Intronic
1168272639 19:55258489-55258511 CGGAGCCGCCGGCGGCGGGGCGG - Exonic
1168356571 19:55703915-55703937 CGGAGCCGCAGGCGGGGTTGTGG + Intronic
1168401682 19:56088984-56089006 GGCGGCCGCGGCCGGGGAGGCGG + Exonic
1168685638 19:58347616-58347638 CGGAGCTGAGGCCTGGGAGGGGG + Exonic
925746594 2:7048973-7048995 CTGAGCCCCCGGTGGGGAGGAGG - Intronic
926035106 2:9630461-9630483 CGGGGCCGGGGCCGGGGCGGAGG + Exonic
926101640 2:10122233-10122255 CCGGGCCGCCGCCGGGCAGGGGG - Intergenic
927156835 2:20225405-20225427 CGGAGGCGCAGCCCGGGAGAGGG + Exonic
927208686 2:20625639-20625661 CAGAGTCGGAGCCGGGGAGGTGG - Intronic
927809474 2:26173437-26173459 CGGGGCCCACGCCGGGGAGCTGG - Intronic
929486694 2:42361221-42361243 CGGGACCACAGCCGGGGAGGCGG - Exonic
929857544 2:45650031-45650053 CGGCTCCGCTGCCGGGGAGCTGG - Intergenic
930727891 2:54699159-54699181 CGGAGCGGCCGGCCGGGCGGGGG - Intergenic
931107008 2:59067204-59067226 CGTAGCCCACGGCGGGGAGGAGG - Intergenic
932702692 2:74002369-74002391 CGGAGCAGACGCCGGGGGGGTGG - Intronic
933666854 2:84971271-84971293 CGGCGGCGGCGGCGGGGAGGCGG - Exonic
937045148 2:118847179-118847201 CGGCGCGGCGGCCGGGGCGGCGG - Exonic
938451441 2:131425007-131425029 GGGAACCGCCGCGGGGGCGGCGG + Intergenic
940301010 2:152176215-152176237 CGGAGCTGCCGGCGCGGAGGTGG + Intergenic
941508388 2:166375985-166376007 CGCAGCTGCCCTCGGGGAGGCGG - Exonic
941929975 2:170929445-170929467 CGGGGCCGGCCGCGGGGAGGCGG + Intronic
942241109 2:173964676-173964698 CGCCGCCGCCGCCGGGGGGCGGG - Intronic
942277878 2:174336000-174336022 GGGAGCAGCCGCAGGGGACGAGG + Intronic
943333805 2:186590149-186590171 CGGAGCGACCGCCAGGGACGAGG - Exonic
946185534 2:217978673-217978695 CGGGGGCGCCGGCGGGGCGGGGG - Intronic
946310697 2:218881011-218881033 CGGAGCCGCAGCCAGGGGCGAGG - Exonic
946339193 2:219057410-219057432 GTGAGCCGCCGCCGGGGGGCTGG - Intronic
946362835 2:219229409-219229431 GGGCGCCGCCGGCGGGGCGGGGG - Intronic
946691588 2:222312374-222312396 CGGAGAGGCTGCAGGGGAGGAGG + Intergenic
948046840 2:234951901-234951923 CGGAGCTGAGGCCGCGGAGGGGG - Intergenic
948207302 2:236168853-236168875 CGGAGCCACCCCCGGGGCGAAGG + Intergenic
948697309 2:239738203-239738225 CGGGGCCGGGGCCGGGGATGGGG - Intergenic
948768047 2:240233499-240233521 GAGAGCTGCAGCCGGGGAGGAGG - Intergenic
948805769 2:240453002-240453024 TGGAGCCGCCGCTGCGAAGGGGG + Intronic
948953792 2:241272306-241272328 CGGCGCCCCCGCCGGAGCGGGGG + Intronic
1168804489 20:664361-664383 CGGCGCCGCCGGCGGGTACGCGG + Exonic
1169093178 20:2873645-2873667 CGGAGCCGCGGGCCGGGCGGCGG + Intronic
1169758843 20:9069171-9069193 TGGAGCTGCTGCCGGGGATGCGG - Intronic
1170150081 20:13220138-13220160 CTGGGCCGGCGCTGGGGAGGAGG + Intergenic
1171247181 20:23621052-23621074 CGGAGCTGCAGCCTGGCAGGGGG - Intergenic
1171908294 20:30919642-30919664 CGGAGCCGCTACCGGGGGGAGGG - Intergenic
1172083252 20:32358753-32358775 TGCCGCCGCCGCCGGGGAGAAGG + Exonic
1172698076 20:36835845-36835867 CGGCGGCGGCGGCGGGGAGGCGG - Intronic
1172702883 20:36863559-36863581 CGGAGCCGCAGCCGGAGCCGGGG - Exonic
1173657422 20:44709972-44709994 CCAAGCCGACGCTGGGGAGGTGG - Intergenic
1173792091 20:45834248-45834270 CGGCGACGGCCCCGGGGAGGCGG + Exonic
1174607038 20:51768459-51768481 CCGCGCCGCCCCGGGGGAGGAGG + Exonic
1176005576 20:62860951-62860973 CGGGGCCGGGGCCGGGGCGGAGG - Intronic
1177792493 21:25735581-25735603 GAGTGCGGCCGCCGGGGAGGAGG + Intronic
1178513833 21:33229902-33229924 CCGCGCCGCCGCCGGCGCGGGGG - Intronic
1178992449 21:37367036-37367058 CGCTGCCGCCGCCGGCGAGCAGG + Intronic
1179213747 21:39349143-39349165 CGGCCCGGCCGGCGGGGAGGGGG - Exonic
1180082442 21:45493096-45493118 TGGAGCAGCCGTCGGGGATGGGG + Intronic
1181068695 22:20319587-20319609 CGGAGGCGCCGACCCGGAGGAGG + Intronic
1181586898 22:23857580-23857602 GGGAGTCGCCGCCGCGGGGGGGG - Intronic
1182294923 22:29307019-29307041 CGGAGACGGCGGCGAGGAGGAGG + Exonic
1183410234 22:37650650-37650672 CGGAGCCGGAGCCGGGGTGGTGG - Exonic
1183444503 22:37844214-37844236 GGCAGCCGCCGCCGGGGACGCGG - Exonic
1183601801 22:38844168-38844190 TGGGGGCGCCGCCGGGGATGCGG + Intergenic
1184089301 22:42283905-42283927 CTGAGCCGAGGCGGGGGAGGAGG + Intronic
1184153154 22:42649823-42649845 CGGAGGCGCCGCCGGCGAGGAGG - Intergenic
1184533737 22:45072502-45072524 GGGAGCTGCGGCGGGGGAGGAGG - Intergenic
1184568948 22:45310170-45310192 CGGAGGCGCCGCAGGTGAGGGGG + Exonic
1184759492 22:46536750-46536772 CCGCGCAGCCGCCGGGGACGGGG + Exonic
1184820378 22:46905530-46905552 TGCAGCCGGCCCCGGGGAGGAGG + Intronic
1185255156 22:49827638-49827660 CGGAGCCGCCGCGGCCGAGAGGG - Intergenic
1185343000 22:50299910-50299932 CGGTGCCGGCGCCGGGGGAGGGG - Intronic
1185388583 22:50547499-50547521 GGGAGCTGCGGGCGGGGAGGCGG - Intergenic
950664510 3:14487138-14487160 GGGAGCCCCCGCTGGGGAGATGG - Exonic
950729800 3:14947689-14947711 CGGGGGCGCCGCCGGGGTCGCGG - Intronic
951954792 3:28241940-28241962 CGAAGCAGCCGCCGGGTATGAGG - Intronic
953518822 3:43622082-43622104 CGGGGCCGCGGCGGGAGAGGCGG + Intronic
953748719 3:45594085-45594107 CCGAGCCCGCGCCGGGGCGGAGG - Intronic
954389252 3:50260302-50260324 CGGGGTCGGCGCCGCGGAGGCGG + Intergenic
954778995 3:53045741-53045763 CGGCGGCGGCGCCGGGGCGGGGG - Intronic
956432413 3:69200478-69200500 CGGAGCTGCCGTCTGGGAGGGGG - Intronic
956978987 3:74614670-74614692 CGGAGCCGGAGCCGGAGTGGCGG - Intergenic
958894805 3:99817800-99817822 GGGAGCGGCTGCCGGAGAGGCGG + Intergenic
961742445 3:129041051-129041073 CAGAGCTGGCCCCGGGGAGGTGG + Intergenic
965494590 3:169382328-169382350 CGGAGCAGCACCTGGGGAGGTGG + Intronic
966868529 3:184275962-184275984 CGGAGCCCCGCCCGGGGTGGGGG - Intronic
966868585 3:184276087-184276109 CGGGGCCGCGGCCCGGGAGCGGG + Intronic
967272170 3:187740964-187740986 GGGTACCGCCGCCCGGGAGGTGG + Intronic
968048083 3:195635284-195635306 CGGGGCAGCTGCGGGGGAGGCGG - Intergenic
968092995 3:195909644-195909666 CGGAGGCGAGGGCGGGGAGGCGG - Intronic
968099319 3:195954336-195954358 CGGGGCAGCTGCGGGGGAGGCGG + Intergenic
968306528 3:197654637-197654659 CGGGGCAGCTGCGGGGGAGGCGG + Intergenic
968434169 4:576362-576384 CGGGGCCGCGGGCGGGGTGGGGG - Intergenic
968642493 4:1721587-1721609 CGCCGCCGCCGCCAGGAAGGAGG - Exonic
968674760 4:1871486-1871508 CGGAGCGGCAGGCTGGGAGGGGG - Intronic
968879822 4:3293109-3293131 CGGGGCCGGGGCCGGGGCGGGGG + Intronic
968879950 4:3293435-3293457 CGGGGGCGGCGCCGGGCAGGGGG + Intronic
968899721 4:3425625-3425647 TGGAGCCGGTGCAGGGGAGGGGG + Intronic
969417070 4:7067869-7067891 CGGGGCCGAGGCCGGGAAGGAGG + Intronic
969638787 4:8384624-8384646 CAGAGCCCCAGCTGGGGAGGGGG - Intronic
970332829 4:15003033-15003055 TCGTGCCGCCGCCGGGGTGGTGG - Exonic
972686837 4:41360545-41360567 CCGCTCCGCCCCCGGGGAGGGGG - Intronic
975633041 4:76421113-76421135 CGGCGCCGCAGCCGAGGAGGAGG - Intronic
977257655 4:94758278-94758300 CGGTGGCGGCGGCGGGGAGGGGG + Intronic
977693880 4:99946619-99946641 GGAAGCCGCCGCCGCGGAGGAGG + Exonic
984206543 4:176793053-176793075 AGGTGGGGCCGCCGGGGAGGAGG - Intergenic
985504615 5:271850-271872 CGGGGCCGCCGCGGCGGAGGCGG - Intronic
985763557 5:1764555-1764577 AGGAGCCGCAGCCGGAGAGCTGG + Intergenic
991054388 5:62306160-62306182 GGGAGCCGACGCTGGGGAGGCGG - Intronic
991371743 5:65926172-65926194 CGGAGCCGGAGCCGAGGAGTCGG - Intergenic
992716311 5:79514229-79514251 CGGAGCCGCGGCCGGGGGCTGGG + Intergenic
993457284 5:88141402-88141424 CCGAGCAGCTGCCGGGGAAGAGG - Intergenic
995764596 5:115602053-115602075 GGGGGCCGCCGCCGGGGGCGCGG - Intronic
998166797 5:139848734-139848756 CCGGGCCGGCGCGGGGGAGGGGG + Intronic
1001704701 5:173733466-173733488 TGGAGCCCCCTCCGTGGAGGTGG + Intergenic
1002100558 5:176855602-176855624 CGAAGACGCCGCCGGTGTGGAGG + Intronic
1002176571 5:177404302-177404324 CGGAGGCGCCGCCTGGGTTGGGG + Exonic
1002645131 5:180649201-180649223 CGGAGCCACCGACGGAGACGCGG + Intronic
1002789159 6:424972-424994 GGGAGCCGTGGCCAGGGAGGAGG + Intergenic
1004347430 6:14861707-14861729 CAGAGCAGCCACTGGGGAGGTGG + Intergenic
1006089752 6:31621186-31621208 CGGGGCGGCAGCCGGGGAGGGGG - Intronic
1007413848 6:41680618-41680640 TGGAGTGGCAGCCGGGGAGGGGG - Intergenic
1007927676 6:45663346-45663368 CGGGGCGGCCTCCGGGGAGGAGG - Intronic
1008649024 6:53544803-53544825 AGGGGCCGCCGCCGGGGAGCCGG - Exonic
1009437627 6:63636077-63636099 CGCTGCCGCCGCCGAAGAGGAGG - Exonic
1011044693 6:83068058-83068080 CGGAGGCGGGGCCGGGGAGCCGG + Intronic
1012062873 6:94511080-94511102 CGGAGCCTCCACCTGGGAGTGGG - Intergenic
1012479402 6:99650354-99650376 CGGGGCGGCCGCCGGGCAGAGGG + Intergenic
1013507596 6:110815345-110815367 CGCCGCCGCCGTCGCGGAGGAGG - Intronic
1015129499 6:129793585-129793607 AGGAGCAGCTGCCAGGGAGGAGG + Intergenic
1015625856 6:135180950-135180972 CGGTGCGGCAGCCAGGGAGGAGG + Intergenic
1016433156 6:144008471-144008493 AGGAGGCCCCGCCGGGGAGCTGG + Intronic
1017672068 6:156778042-156778064 CGCTGCCGCCGCGGAGGAGGAGG - Exonic
1017672070 6:156778045-156778067 CGCCGCTGCCGCCGCGGAGGAGG - Exonic
1017738122 6:157381640-157381662 CCGAGGCGCGGCCGGGGAGCCGG + Exonic
1018400489 6:163415135-163415157 CGCCGCCGCCGCCGGAGAGGAGG - Exonic
1018727762 6:166627036-166627058 CGGAGCAGCCGCAGGGCCGGGGG + Intronic
1018755967 6:166850000-166850022 CGGGGCCTCCGCCAGGGACGTGG + Intronic
1019625634 7:2014417-2014439 CAGAGCCTGCGGCGGGGAGGTGG - Intronic
1019664707 7:2246016-2246038 GGGGGCCGCAGCTGGGGAGGAGG + Intronic
1021120225 7:16789804-16789826 CGGAGCCGCTGGCCGGGCGGGGG + Intergenic
1023965818 7:44962623-44962645 CGGAGCCCCTGCGGGTGAGGCGG + Intergenic
1026840588 7:73668235-73668257 CGGAGCCACCCCCGGGGGAGGGG + Intronic
1026949590 7:74338481-74338503 AGCAGCTGCGGCCGGGGAGGAGG - Exonic
1029054906 7:97732100-97732122 GGTAGCTGCCGCCGGGAAGGAGG - Exonic
1029123114 7:98281508-98281530 CAGAGGCGCCGCCGGCGGGGCGG + Intronic
1030334235 7:108307197-108307219 CGAAGCAGCAGCCGGGGAGAAGG + Intronic
1031043572 7:116862983-116863005 CGGGGCCTCCGCCGGGGCCGGGG + Intronic
1032083172 7:128870002-128870024 GGGAGCCGCCGCCGGGCCGGGGG + Intronic
1032174353 7:129611692-129611714 CGCCGCCGCCGCCGAGGAGGGGG - Exonic
1032174357 7:129611695-129611717 CGCCGCCGCCGCCGCCGAGGAGG - Exonic
1032230622 7:130070668-130070690 AGGAACCGCCGGAGGGGAGGAGG + Exonic
1033361252 7:140640503-140640525 CGGAGCCGCCGCCCGCGGGGAGG - Exonic
1034649226 7:152676195-152676217 CCAGGCCGCGGCCGGGGAGGCGG + Intergenic
1035171118 7:157017996-157018018 CGGAGCCGCAGCCCGGGAGGAGG + Intergenic
1037899001 8:22676656-22676678 CGGAACAGCCGCGTGGGAGGAGG + Intergenic
1038540385 8:28385960-28385982 CGGCGCGGCAGCCGGGGACGGGG - Intronic
1038542494 8:28401844-28401866 CGGAGCCGCGGCCCCGGAGCCGG - Intronic
1038566285 8:28622584-28622606 GGGAGCCGCCGAGGGGGCGGTGG + Intronic
1039595600 8:38787654-38787676 CGGGGCCGCCGGCGAGGACGAGG + Exonic
1040039146 8:42897917-42897939 CCGCGGCGCGGCCGGGGAGGGGG + Intronic
1040080347 8:43277288-43277310 CGGCGCCGCCACCTGGGAGCCGG + Intergenic
1042040198 8:64581351-64581373 CGCTGGCGCCGCCGTGGAGGTGG - Exonic
1044343159 8:91070685-91070707 CCGCGCCGCCGCCGGGGTGCAGG + Intronic
1044591606 8:93917787-93917809 AGGAGGCGGCGGCGGGGAGGCGG - Intronic
1045277736 8:100722324-100722346 AGGCGCCGCGGCCGGGGAAGCGG + Exonic
1046094353 8:109539881-109539903 CGGAGCCTCCGCCGGGCGGGCGG + Intronic
1047393721 8:124475031-124475053 CGGGGCCGCGGCCGGGGGCGGGG - Exonic
1049419579 8:142510843-142510865 CGGAGCCGCCGCTCGGGGGCCGG + Intronic
1049465460 8:142749362-142749384 AGGAGCCGGCGCTGGGTAGGAGG + Intergenic
1049574380 8:143383663-143383685 CGGAGCCGGAGCCGGAGCGGAGG + Exonic
1049689573 8:143952791-143952813 CGGAGCCGGCTTGGGGGAGGCGG - Intronic
1049694088 8:143975236-143975258 CGGAGCCGGCGCAGCGGGGGTGG - Intronic
1049788489 8:144462537-144462559 CGGGGCGGCCGCCGGGCAGGCGG - Intronic
1050472542 9:6008034-6008056 GCGCGCCGCCGCCGGGGGGGAGG - Intergenic
1051206327 9:14693143-14693165 CGGAGCGGGGGCCGGGGATGGGG + Intronic
1051876757 9:21802168-21802190 CGGGGCGGCCGCCGCGGCGGGGG - Intergenic
1053055192 9:34989762-34989784 CGGAGCCGGAGCCGGGGGAGGGG + Exonic
1053466476 9:38312198-38312220 CGGAGCCGTGACCTGGGAGGCGG - Intergenic
1055611711 9:78031375-78031397 GGGAACCGCCGCGGGGGCGGCGG + Exonic
1056746760 9:89310437-89310459 CGGAGCCGGCGCGGTGGCGGCGG - Intergenic
1057259553 9:93576333-93576355 CGCTCCCGCCGCCGGGAAGGCGG - Intergenic
1057311508 9:93946063-93946085 CGGAGCTGCCGCGGGGGCTGGGG + Intergenic
1057995788 9:99821001-99821023 CTGACCCGGTGCCGGGGAGGAGG + Intergenic
1058439084 9:104991216-104991238 CGGGGCCGGCGCTGGGGCGGGGG - Intergenic
1059234493 9:112750683-112750705 CGCCGCGGCCGCCCGGGAGGGGG - Intergenic
1060103940 9:120862070-120862092 GGGAGGCGCCGCAGGGGCGGGGG + Intronic
1061003795 9:127917049-127917071 CGGGGCCGGGGCCGGCGAGGAGG + Intergenic
1061873944 9:133534761-133534783 GGGAGGCGGCGCGGGGGAGGAGG + Intronic
1062027603 9:134347679-134347701 AGGAGCAGCCGGTGGGGAGGTGG + Intronic
1062324958 9:136008366-136008388 TGGAGCTGCCGCCTGGCAGGTGG - Exonic
1062381198 9:136287587-136287609 GGGTGCCGCAGCCGAGGAGGTGG - Intronic
1062462116 9:136666365-136666387 CGGGGCTGCTGCCGGGCAGGTGG + Intronic
1062521154 9:136958562-136958584 CAGAGGCACCGCCAGGGAGGAGG - Intergenic
1062537625 9:137027882-137027904 CGCTGCGGCCTCCGGGGAGGTGG - Exonic
1203772867 EBV:58235-58257 CGGAGACGACGGCGGGGAGTTGG + Intergenic
1187900947 X:24025867-24025889 CGGCGCCGCCGTCGGGGCTGAGG + Intronic
1189272965 X:39764683-39764705 CTGAGCCGCCCTGGGGGAGGGGG - Intergenic
1189310318 X:40013705-40013727 CGGAGCGGGAGCGGGGGAGGGGG - Intergenic
1190385629 X:49879954-49879976 CGGGGCCGGGGCCGGGGCGGGGG - Exonic
1192467337 X:71366596-71366618 CGCAGCTAACGCCGGGGAGGAGG + Intronic
1192657111 X:73003453-73003475 CGAAGCCGCCGCCGCAGCGGAGG + Intergenic
1192665009 X:73079548-73079570 CGAAGCCGCCGCCGCAGCGGAGG - Intergenic
1196389353 X:115191746-115191768 CGGAGCCACCGCTACGGAGGAGG + Exonic
1196389404 X:115191992-115192014 CGGAGCCACCGCTATGGAGGAGG + Exonic
1196389460 X:115192256-115192278 CGGAGCCACCGCTACGGAGGAGG + Exonic
1200068789 X:153517837-153517859 CGGAGCCGAGGCCGCGGCGGCGG + Intronic
1200291706 X:154881584-154881606 CGGAGCGGGGGCGGGGGAGGGGG + Intronic
1200338544 X:155377323-155377345 CGGAGCGGGGGCGGGGGAGGGGG + Intergenic
1200347925 X:155463369-155463391 CGGAGCGGGGGCGGGGGAGGGGG - Intergenic