ID: 920352893

View in Genome Browser
Species Human (GRCh38)
Location 1:205349426-205349448
Sequence CCTGCCTACTTAGGTAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 71}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920352890_920352893 14 Left 920352890 1:205349389-205349411 CCATTAACGAATGCATCTGTTCA 0: 1
1: 0
2: 0
3: 7
4: 102
Right 920352893 1:205349426-205349448 CCTGCCTACTTAGGTAAAACTGG 0: 1
1: 0
2: 1
3: 6
4: 71
920352889_920352893 27 Left 920352889 1:205349376-205349398 CCTTAGTGGGTATCCATTAACGA 0: 1
1: 0
2: 0
3: 4
4: 30
Right 920352893 1:205349426-205349448 CCTGCCTACTTAGGTAAAACTGG 0: 1
1: 0
2: 1
3: 6
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920352893 Original CRISPR CCTGCCTACTTAGGTAAAAC TGG Intronic
903083319 1:20831364-20831386 CCTGCCTTCTAAGGTACTACAGG - Intronic
904516961 1:31063798-31063820 CTTGCCTCTTTAGGTAAAGCAGG - Intronic
909648995 1:77952479-77952501 CCTGCCTAGTTTGGCAAAAGGGG + Intronic
910040655 1:82847955-82847977 CCTGCCTACTGATTTCAAACAGG - Intergenic
911599282 1:99830747-99830769 CCTGCCTACTTATGTCAGCCTGG + Intergenic
918269027 1:182878003-182878025 TCTGCCTACATAGGAAAAAGTGG - Exonic
918415285 1:184299716-184299738 CCTGTCTACATACGTAAAACAGG + Intergenic
918898214 1:190376425-190376447 TCTGCCTACTTATTTATAACTGG + Intronic
920352893 1:205349426-205349448 CCTGCCTACTTAGGTAAAACTGG + Intronic
924149999 1:241120205-241120227 CCTGCCTACCTGGTTAAAATGGG + Intronic
1064198867 10:13267807-13267829 CCTGTCTGATTAGGTAATACAGG + Intergenic
1067901216 10:50243723-50243745 CCTGCCTTCTAAGGTACTACAGG + Intronic
1069951946 10:72025088-72025110 CCTGCCTAGTGAGGAACAACAGG - Intergenic
1071312535 10:84356744-84356766 CCTGTTTACGTAAGTAAAACAGG - Intronic
1078610549 11:12815538-12815560 CCTTCCCTCTTAGTTAAAACTGG + Intronic
1078914991 11:15770648-15770670 CCTGTCTACGTAGGTAACCCTGG - Intergenic
1079376793 11:19900202-19900224 CCTGCCTACTTAGCCTCAACAGG - Intronic
1079531289 11:21457145-21457167 CCTGCTTGCTCAGGTAGAACTGG - Intronic
1081521036 11:43881146-43881168 CCTGTTTACTGAGGAAAAACTGG + Exonic
1083833231 11:65246889-65246911 CATGCCTACTCTGGGAAAACAGG + Intergenic
1100188088 12:92159305-92159327 CCTGCCTCCTTAAGTACATCAGG - Intergenic
1104228840 12:126863777-126863799 ACTGCCTGCTTTGGTAAAAGTGG - Intergenic
1104801783 12:131559467-131559489 CCTGCCTATTTAGGAAAGAGAGG - Intergenic
1105782704 13:23718063-23718085 CCTACCAACTGAGGTAAAGCTGG - Intergenic
1106700679 13:32225024-32225046 GCTGTCTTCTTAGGTAAGACTGG + Exonic
1116605413 14:46987005-46987027 CATGCCTACCTACATAAAACTGG - Intronic
1120952666 14:90056954-90056976 CCTGCCTACTGAGGTGGAGCTGG + Intergenic
1126916069 15:53467621-53467643 TCTGCCTCCTCAGTTAAAACAGG - Intergenic
1129649070 15:77467286-77467308 ACTGCCTCCTGAGGAAAAACAGG + Exonic
1133124535 16:3637478-3637500 TTTGCCTCCTTAGGTGAAACAGG + Intronic
1141352407 16:83310232-83310254 CCTGTCAAATTAGGTAAAAGTGG + Intronic
1153580485 18:6568470-6568492 TCTTCCTTCTTAGGTAAAAGGGG - Intronic
1154082478 18:11271965-11271987 CCTTCCTACTTACGTCAACCTGG + Intergenic
1155576657 18:27255157-27255179 CATACCCACTTAGTTAAAACTGG + Intergenic
930476501 2:51888807-51888829 CTTGCCTTCTTGGGTCAAACTGG - Intergenic
931465915 2:62486722-62486744 TCTGCCTACTTTGGTAACAGTGG + Intergenic
932534293 2:72576007-72576029 CTGGCCTACTAAGGCAAAACTGG - Intronic
933477442 2:82809122-82809144 CCTGTCTACGTAGATAAACCTGG + Intergenic
937928658 2:127187944-127187966 CCTGCCTCCCAGGGTAAAACTGG + Intronic
937928789 2:127188707-127188729 CCTGCCTCCCAGGGTAAAACTGG + Intronic
939507973 2:143072473-143072495 CCTGCATTCTTAGGTATACCAGG + Intergenic
947489116 2:230578774-230578796 CATGTCCACTTAGGTAAAACTGG + Intergenic
1173111607 20:40196217-40196239 CCTGCCTACTAAGGGAAACAAGG - Intergenic
1175254808 20:57634784-57634806 TCTCCCTGCTTAGGTAAGACAGG - Intergenic
1184574543 22:45352134-45352156 CCTGCCTACTCAGGTGACTCAGG + Intronic
951990639 3:28672506-28672528 TCTGCCTCCTTAGGCAAAACAGG + Intergenic
952690397 3:36198290-36198312 CCTGCCTACTTGGGAAATCCAGG - Intergenic
952907787 3:38154171-38154193 TCTGCTTACTCAGGAAAAACAGG - Intergenic
960117207 3:113907896-113907918 CGTGCCTATTTAGCTAAACCAGG - Intronic
960941991 3:122940890-122940912 GCTGCCTGCTTAGGTAACACAGG + Intronic
962922693 3:139965272-139965294 CCTCCCTACTTTGGTATACCAGG + Intronic
964186051 3:153944317-153944339 CCTGTATATTTAGGTAGAACTGG - Intergenic
967615000 3:191554474-191554496 CCTGTCTACTTAAGGAAATCTGG + Intergenic
970955028 4:21800942-21800964 CCTGCCTTCTTTAGTCAAACTGG + Intronic
971605378 4:28651611-28651633 CCTGCCCAGTGAGGAAAAACGGG + Intergenic
972044389 4:34646483-34646505 TCTGCCTAAATCGGTAAAACTGG + Intergenic
973280931 4:48360398-48360420 CCTGCCAACTTGGGAAAACCTGG + Intronic
975967661 4:79994219-79994241 CCTGGCTACATAGGTTAAAATGG - Intronic
977302626 4:95285031-95285053 CCTGCCTGCTTAGCTAACACAGG - Intronic
978179700 4:105777671-105777693 CTTGCCTAGGTAGGCAAAACTGG - Intronic
983574429 4:169245594-169245616 CTTGCCTACTTGGAGAAAACCGG + Intronic
984137704 4:175961846-175961868 CTTCCCTGCTTAGGTGAAACAGG - Intronic
994968879 5:106709779-106709801 TCTGCCTAATAATGTAAAACAGG + Intergenic
999000300 5:147913829-147913851 CATGCCTGGTAAGGTAAAACAGG - Intergenic
1014701814 6:124698539-124698561 CCTGCCTACTTATGCAAAACTGG - Intronic
1021122844 7:16816335-16816357 CCTGCTGAAGTAGGTAAAACGGG - Intronic
1031074361 7:117198725-117198747 CCTGCCTCCTCAGGTGGAACAGG + Intronic
1032090644 7:128910023-128910045 CCTGCCTACTTAAGCAGAACTGG - Intronic
1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG + Intronic
1044110461 8:88266597-88266619 CCCTCCTACTTTGGTAAAATGGG + Intronic
1044960026 8:97521593-97521615 CCTGCCTTCTTATTTAAAATAGG + Intergenic
1046528415 8:115412216-115412238 TATGCCTACTTAGGAAAAAAAGG - Exonic
1051370271 9:16353396-16353418 CATGCCTAGTTAGGGAAAGCAGG + Intergenic
1054839686 9:69723222-69723244 CCTGCCTGCTTGGGTAAACATGG - Intronic
1055746210 9:79448175-79448197 CCTGCTTACATAAGTGAAACAGG + Intergenic
1059319873 9:113461307-113461329 CCTGCCTTCTTGGGGAAAGCAGG + Intronic
1061082740 9:128382026-128382048 CCTCCCTACTTGGGTAACTCTGG - Intronic
1192837908 X:74821636-74821658 TCTTGCTACTTAGGTAAAAGAGG - Intronic
1198018155 X:132632526-132632548 CCTGACCACTGAGGGAAAACTGG - Intronic