ID: 920357010

View in Genome Browser
Species Human (GRCh38)
Location 1:205381208-205381230
Sequence CCTGTTCTAAATTGTTTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 291}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920357008_920357010 8 Left 920357008 1:205381177-205381199 CCTTGCTAAGTTTCAAAGGCAAA 0: 1
1: 0
2: 2
3: 25
4: 347
Right 920357010 1:205381208-205381230 CCTGTTCTAAATTGTTTTCATGG 0: 1
1: 0
2: 1
3: 20
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920357010 Original CRISPR CCTGTTCTAAATTGTTTTCA TGG Intergenic
906242158 1:44248798-44248820 TCTGTACTTAATTGTTTTCCTGG + Intronic
908641225 1:66225762-66225784 CCTGTTTTATTTTGTTTTCCTGG + Intronic
910750933 1:90629356-90629378 CATGCTCTAAAAAGTTTTCAAGG + Intergenic
915374009 1:155376362-155376384 CCTGTTCTGGATAGTTCTCATGG - Intronic
915628669 1:157135077-157135099 CCTTTTCTAAGTTTCTTTCAGGG + Intronic
915678857 1:157559809-157559831 CTTGTTCTTATTTGTTTGCATGG + Intergenic
917419677 1:174849730-174849752 TCTGTTCTAAATGGTATTCTTGG + Intronic
917945871 1:179969978-179970000 ACTTTTCTAAATTAATTTCAAGG - Intronic
918623227 1:186629149-186629171 CCTGATCTACATTTCTTTCAGGG - Intergenic
918635406 1:186768238-186768260 TCTGTTCTAAATGTTATTCAAGG - Intergenic
920357010 1:205381208-205381230 CCTGTTCTAAATTGTTTTCATGG + Intergenic
921593381 1:217028843-217028865 CCTCTTCCCAATTGTTTTCTAGG + Intronic
922392557 1:225160505-225160527 CCTGGTCCAGATGGTTTTCAAGG - Intronic
923218482 1:231871803-231871825 CCAGCTCTGAATTGTTTCCAGGG + Intronic
923472189 1:234301857-234301879 CATGTTCTTATTTCTTTTCATGG - Intronic
923772446 1:236949254-236949276 CCAGTTCTGAATTGCTTTCTGGG - Intergenic
923897401 1:238286740-238286762 CCTGTACTAATTTGATTTTAGGG + Intergenic
1063782578 10:9343250-9343272 CATGTTCTAAATTAATTTGATGG + Intergenic
1064656539 10:17561532-17561554 CTTGTTCTTAATTGTTAGCATGG + Intergenic
1067493502 10:46739165-46739187 CAGGTTCTATATTGTATTCAAGG + Intergenic
1067601158 10:47601239-47601261 CAGGTTCTATATTGTATTCAAGG - Intergenic
1068238366 10:54268953-54268975 CAGGTTCTATATTGTATTCAAGG - Intronic
1068399701 10:56512135-56512157 CCTGTTTTAATTTTTTTTCCAGG + Intergenic
1069012518 10:63389975-63389997 CGTGTTCTATTCTGTTTTCATGG - Intronic
1070558837 10:77550578-77550600 CCTGCTCCAGAATGTTTTCAGGG - Intronic
1071652702 10:87409111-87409133 CAGGTTCTATATTGTATTCAAGG - Intergenic
1072174239 10:92900967-92900989 CCTGTTCTTTGTTTTTTTCATGG + Intronic
1073159561 10:101378817-101378839 CCAGTTATAACTTGTTTCCATGG + Intronic
1073677879 10:105669784-105669806 ACTGTTCTAAATTGCTAACATGG - Intergenic
1073727259 10:106247788-106247810 CCTGTTTTAAGTTTGTTTCAGGG - Intergenic
1075242167 10:120788982-120789004 GCTGTTCTAAATGCTTTGCATGG - Intergenic
1077723465 11:4650222-4650244 CCTGTTCTATATTCTCTTCCTGG - Intronic
1078831241 11:14979435-14979457 ACTGGTCTAAAATGTTTGCAGGG + Intronic
1079613761 11:22465452-22465474 CCTGGTGTAAATTGCATTCAAGG + Intergenic
1079630597 11:22669344-22669366 CCTATGCTAAATTGTTTGGAAGG + Intronic
1081482230 11:43500277-43500299 CCTGTTCAAAATACTTTACATGG - Intergenic
1083666084 11:64275489-64275511 CCTGCTCTCATTTGTTGTCATGG - Intronic
1084055489 11:66629388-66629410 CTTGTTTTAAATTGTGTGCATGG + Intronic
1087111092 11:94468408-94468430 CTTGTTCTATATTGTTCTTAAGG + Intronic
1087721559 11:101671550-101671572 CCTGTACCAAATTGTTCTCTGGG + Intronic
1087899571 11:103625671-103625693 CCTGTCCCAAATTTTTTTTAGGG + Intergenic
1088012265 11:105017402-105017424 ATTCTTCTAAATTTTTTTCAAGG - Intronic
1088428651 11:109732500-109732522 AATGTTCAAAAGTGTTTTCAGGG - Intergenic
1089064354 11:115651152-115651174 CCTGCTCCAAATAGTTTTCCTGG + Intergenic
1090134814 11:124186162-124186184 CCTGTGCAATATTGTTTTCAGGG - Exonic
1090590123 11:128258718-128258740 CCTATTCTAGTTTGGTTTCAAGG - Intergenic
1091314786 11:134606638-134606660 CTTTTTCTAAGTTGATTTCAAGG + Intergenic
1093206867 12:16261996-16262018 CCTATTATAATTTTTTTTCATGG + Intronic
1093762654 12:22927854-22927876 GCTTTGCTAATTTGTTTTCATGG + Intergenic
1094688058 12:32739846-32739868 TCTGCTCTAAGTTGTTTGCAAGG - Intronic
1094786094 12:33849239-33849261 ACTCTTCTAAATTTTTTTCAAGG - Intergenic
1095338123 12:41053939-41053961 CCAGCTCTTAATTGTGTTCATGG + Intronic
1098701285 12:73630799-73630821 CATGTTCTGTATTTTTTTCATGG - Intergenic
1098768451 12:74520469-74520491 CATTTTGCAAATTGTTTTCATGG + Intergenic
1099067057 12:77994250-77994272 CTAGTACTAAATTGTTTTCAAGG - Intronic
1099426545 12:82530802-82530824 CCAGTTCTCAATTGTTCTCAAGG + Intergenic
1099816420 12:87654510-87654532 CCTGTTTTAAATTATTTTTCCGG + Intergenic
1101395048 12:104339532-104339554 TATCTTCTAAATTATTTTCATGG + Intronic
1105464766 13:20628417-20628439 CCTTTTCCTCATTGTTTTCAGGG + Intronic
1106897263 13:34317066-34317088 CCTGTTCTAAATGCTTTCCTTGG - Intergenic
1107475093 13:40728184-40728206 CCTGGCCTAAATTTTTTTTAAGG - Intergenic
1107556924 13:41524272-41524294 CATTTCCTAAATTGTTTTAATGG - Intergenic
1107668659 13:42719375-42719397 CCTGTTCTACATTTTCTTCCCGG - Intergenic
1107680732 13:42847415-42847437 CCTGTTCTGATTTTTTTTCCTGG - Intergenic
1107703039 13:43068252-43068274 CAGGTTCTAAATTATTTTGAGGG - Intronic
1107773016 13:43808821-43808843 TGTGTTCTAAATTCTATTCAAGG - Intergenic
1108360041 13:49660821-49660843 CCTGTTTCAAATTGGTTTTAAGG - Exonic
1108916677 13:55622578-55622600 CCACTTCTAAAATTTTTTCAAGG - Intergenic
1109933690 13:69250647-69250669 ACTGTTCTCAATTATTTTAAAGG - Intergenic
1110661770 13:78065861-78065883 CCTGTTCTCAATTAGGTTCATGG - Intergenic
1111049830 13:82867157-82867179 CTGGTTCTCAAATGTTTTCAGGG + Intergenic
1111116347 13:83782940-83782962 TCTGTTCTGAATTGTTTTCTAGG - Intergenic
1111260506 13:85733596-85733618 TCTATTCTAAAATGCTTTCAGGG + Intergenic
1111344387 13:86930847-86930869 AATCTTCTAAATTATTTTCAAGG - Intergenic
1115554777 14:34536113-34536135 CTTGTCCTCCATTGTTTTCATGG + Exonic
1115726542 14:36223376-36223398 ACTGTTGTAACTTGCTTTCAAGG - Intergenic
1116345757 14:43791361-43791383 CATGTTCTTAATTATTTTAAAGG + Intergenic
1118679878 14:68229748-68229770 CCTGTTGTGTATAGTTTTCAGGG - Intronic
1119043166 14:71293819-71293841 CATGTTTTAAATTTTTTTCCAGG + Intergenic
1119184631 14:72631212-72631234 CCTGATCTAAAAGCTTTTCAAGG + Intronic
1119432411 14:74577078-74577100 TCTATTCAAAATAGTTTTCAAGG + Intronic
1120166478 14:81207023-81207045 ACTGTTCTACACTGTTATCAAGG + Intronic
1121594910 14:95154992-95155014 ACTGTTCCAAATGGATTTCAGGG - Intronic
1123991411 15:25686253-25686275 CATGTTCTTAATTGTTTTTCTGG - Intronic
1125657450 15:41369770-41369792 CCTGGTCTAATTTGTCTTAATGG - Intronic
1125867870 15:43070517-43070539 CCTGTTCTAAATGATTTATAAGG - Intronic
1126485636 15:49177552-49177574 ACTGTCCTAAATTGTTTTTTAGG + Intronic
1126505254 15:49397093-49397115 ATTCTTCTAAATTTTTTTCAAGG - Intronic
1127602277 15:60549988-60550010 CCTCTTCTACACTTTTTTCAAGG - Intronic
1128961323 15:72008127-72008149 ACTGTTCAAAATGCTTTTCATGG + Intronic
1134355567 16:13479016-13479038 GAAGTTCTAAATTATTTTCATGG + Intergenic
1137329856 16:47482536-47482558 CCTGTTCTATATTCTTGTCTTGG - Intronic
1138112707 16:54337355-54337377 TTTGTTCTGAGTTGTTTTCATGG + Intergenic
1138662969 16:58536212-58536234 ACTGTTGTAATTTTTTTTCAGGG - Intronic
1139140818 16:64260419-64260441 CCTGTTTCAAATTGGTTTTAAGG - Intergenic
1140081284 16:71749784-71749806 CCTGGCCTAAAAAGTTTTCAAGG + Intronic
1140823774 16:78686625-78686647 CCTGTTTTAATTTGTTTTTTCGG + Intronic
1142339812 16:89514239-89514261 ATTGTTCTGAATTGATTTCAGGG + Intronic
1142736606 17:1904583-1904605 CCTGTTCTAACTCCATTTCAGGG - Intergenic
1146071069 17:29682269-29682291 CCTGTTTTATAGGGTTTTCAAGG + Intronic
1146321795 17:31852728-31852750 CCTGTTCCAAACTGCCTTCAGGG + Intronic
1147907928 17:43834898-43834920 CCATTTATCAATTGTTTTCAGGG - Intergenic
1148009444 17:44464196-44464218 CCTGTTTTAAATTTTTTTTTTGG - Intronic
1154997535 18:21655035-21655057 CATTTTCTAAATTGTGGTCAAGG + Intronic
1155056609 18:22189313-22189335 AATATTTTAAATTGTTTTCATGG + Intronic
1157229086 18:45896971-45896993 CCTTTTCTAAAATGTCTTCTAGG - Intronic
1158108367 18:53911237-53911259 TAGGTTCTAAATAGTTTTCATGG + Intergenic
1159429539 18:68333446-68333468 AATGTTCTAATTTCTTTTCATGG - Intergenic
1159534849 18:69703217-69703239 CCTGATGCAAATTTTTTTCATGG + Intronic
1160526344 18:79540568-79540590 CATTTTTTAACTTGTTTTCATGG + Intergenic
1163464406 19:17458564-17458586 CCTTTTGTAAATTTTTTTAAAGG + Intronic
1165294990 19:34919407-34919429 CCAGATCTAAAATGTTTTCATGG + Intergenic
1167978079 19:53248405-53248427 CCTGTATTAATTTGTTTTTATGG + Intronic
925511393 2:4629619-4629641 CCTTTAATAAATTGATTTCAAGG + Intergenic
925792832 2:7510257-7510279 TCTGTACCATATTGTTTTCATGG - Intergenic
926541793 2:14189762-14189784 CTTCTTCTAAAGTGTTTTAAAGG + Intergenic
927414200 2:22859868-22859890 GCTTTTTTAAAGTGTTTTCAAGG - Intergenic
928965094 2:36967802-36967824 CATTTGTTAAATTGTTTTCAGGG - Intergenic
929065727 2:37973188-37973210 CCTGTTCTAAAAAGGTTTTAAGG - Intronic
931351224 2:61490606-61490628 CCTTTTCTTAAAAGTTTTCATGG - Intronic
932137328 2:69242735-69242757 CCAGCTCTAAATTGTCGTCATGG + Intronic
932795707 2:74693683-74693705 CCTTTTCTGAAATATTTTCAAGG - Intergenic
937829957 2:126408807-126408829 CCTGTTCTTCATTGTTCTCAAGG - Intergenic
939676187 2:145074939-145074961 CTTGTTCTAAAATGTATTTATGG + Intergenic
942904468 2:181164601-181164623 CCTGTTCTGGATAGTTTCCATGG + Intergenic
943246845 2:185464651-185464673 CTTGTTCTAATTTATTATCATGG - Intergenic
944006200 2:194909905-194909927 CATGTCCTAAATTATTTTTATGG + Intergenic
944289181 2:197985781-197985803 CCTGGTCTAAGCTGTTGTCAGGG + Intronic
945380074 2:209129637-209129659 ATTCTTCTAAATTTTTTTCAAGG - Intergenic
945671443 2:212806943-212806965 ACTGATCTAAATTGTTTGCCTGG - Intergenic
947291651 2:228582855-228582877 CTTGTTTTAAATTGTTGTCCTGG + Intergenic
947338683 2:229114279-229114301 CCAGATCTATATTTTTTTCAGGG + Intronic
1170957735 20:20996809-20996831 CCAATTCTAAATTATTTTCATGG + Intergenic
1171533567 20:25867566-25867588 CCGGTTGTCAATCGTTTTCACGG - Intronic
1171568322 20:26217872-26217894 TCTATTCTAAAGTGTTTTCTAGG - Intergenic
1173713684 20:45182189-45182211 CCTGTTCTAAATTGGATGGAAGG - Intergenic
1174709327 20:52688069-52688091 CATGTTTAAAATTGTTTTCTGGG - Intergenic
1174813047 20:53663717-53663739 CATTTTCTTGATTGTTTTCATGG - Intergenic
1175016807 20:55800369-55800391 GCTGTGTTCAATTGTTTTCATGG - Intergenic
1175631556 20:60542399-60542421 TCTGTTCTAAATTATTTACTGGG - Intergenic
1175867326 20:62186294-62186316 ACTGTTCTAAGTATTTTTCAGGG - Intronic
1177014867 21:15774008-15774030 CCTTTTCTAAATTATTATCTGGG - Intronic
1178172069 21:30052371-30052393 TCTGTGCTAAATTATTTTCTTGG - Intergenic
1178773386 21:35526509-35526531 CCTTTTCTAATTTGTTTTCAAGG - Intronic
1179046555 21:37850085-37850107 GCTCTTCTAAAATGGTTTCAGGG + Intronic
1179556181 21:42178230-42178252 ACTCTTCGAAATTGATTTCAGGG + Intergenic
1182224260 22:28783582-28783604 CCTCTTCAAACCTGTTTTCATGG - Exonic
1182389763 22:29983249-29983271 CTTGTTCTACATTTTTTTGAAGG - Intronic
950324291 3:12090992-12091014 CATGTTTTAAATTGTTTTTAGGG + Intronic
951095808 3:18629261-18629283 CTTGTTATAAGTTGTGTTCAGGG + Intergenic
951106039 3:18744152-18744174 GCTGTTCTAAATTTTATTAAAGG - Intergenic
951451701 3:22847145-22847167 CCTGTGCTAAATGATTTACATGG - Intergenic
951521271 3:23612564-23612586 CCTGTTCTTGATTGTTTTAAAGG + Intergenic
951860145 3:27243026-27243048 CTTGTTTTAAAATGTTTTAAAGG + Intronic
952869197 3:37883045-37883067 CCAGTTCTACCTTGTTATCATGG + Intronic
953479417 3:43237392-43237414 CCTTTTACAAATTGTTTTCTTGG + Intergenic
953760989 3:45686967-45686989 CCTTTTCAAAATTTTTTTAACGG - Intergenic
954616175 3:51969757-51969779 CCTGTGCTAAACTGTGTTCTGGG - Intronic
955364871 3:58302389-58302411 CCTGTTCTCCATTGATTTAATGG - Intergenic
955835546 3:63050632-63050654 ACTATTTTAAATTATTTTCAAGG - Intergenic
956005261 3:64771831-64771853 CCTGGCCTAAATTATTTACATGG + Intergenic
956406544 3:68933598-68933620 GCAGTTCTAAAGTGTTCTCAAGG - Intergenic
957110529 3:75950461-75950483 TCTATTCTAAAGTGTTTTCTAGG + Intronic
957197673 3:77091053-77091075 GCTGTTCTAAATTTTTCTGAGGG - Intronic
958709780 3:97703800-97703822 CCTGAGCAAATTTGTTTTCAGGG + Intronic
958783980 3:98576729-98576751 CCATTTAGAAATTGTTTTCAAGG - Intronic
959038249 3:101389843-101389865 CATTTTGTAAATTGTTTTCTGGG - Intronic
959168208 3:102807537-102807559 CCTGTTTTTAATTGTATTCCTGG - Intergenic
959429178 3:106231515-106231537 CCTGGTACAAACTGTTTTCAAGG + Intergenic
960505005 3:118481826-118481848 CCTGTTCTAAGTTCATTACATGG + Intergenic
960590179 3:119358257-119358279 GATGTTCTACATTGTTATCAGGG + Intronic
962029237 3:131582000-131582022 CCTGTTCTAAATTTATTACAAGG - Intronic
964144949 3:153448435-153448457 CCTGTTTTGAAATGTTTTCTGGG - Intergenic
964370509 3:155995116-155995138 CCTGTGTTAGATTGTTCTCAGGG + Intergenic
964452228 3:156823287-156823309 CCTCTTCTACATGCTTTTCATGG + Intergenic
964532094 3:157679789-157679811 CCTGTGCTAACATGTTTCCATGG + Intergenic
964664572 3:159158148-159158170 TCTGTTATAAAATGTTTTAAAGG + Intronic
965192572 3:165550280-165550302 CTTGTTCCAAAATATTTTCAGGG - Intergenic
966144919 3:176800223-176800245 CCTCTTCTAGATTTTTTTTAAGG - Intergenic
968254814 3:197259152-197259174 CCCTCTCTAAATTTTTTTCATGG - Intronic
970042642 4:11813096-11813118 GCTGTTCTGAATTCTCTTCAAGG + Intergenic
970103491 4:12553902-12553924 CATGTTGGCAATTGTTTTCAAGG - Intergenic
970604328 4:17665425-17665447 CCTGTCTTATACTGTTTTCATGG - Intronic
971673903 4:29599175-29599197 GATGTTCAAAATAGTTTTCAAGG + Intergenic
972621526 4:40751655-40751677 CCCTTTCTAATTTGCTTTCAGGG + Intronic
973335712 4:48954422-48954444 CCTGTTCTTCATTGTTCTCCAGG + Intergenic
974391546 4:61276523-61276545 CCTGTACTAAATTGTTTAGTGGG + Intronic
975829711 4:78356592-78356614 CCTCTGCTGAATTGTTCTCAAGG - Intronic
975929281 4:79499181-79499203 CCTTTACCAAATTGTTTTGATGG - Intergenic
975972107 4:80051964-80051986 CATGTTGTCAATTTTTTTCAAGG + Intronic
978360655 4:107928055-107928077 ACTGTTTTAGATTTTTTTCAGGG + Intergenic
979038565 4:115756830-115756852 TCTTTTCTCAGTTGTTTTCAAGG + Intergenic
979456845 4:120935546-120935568 CCAGTTTTACATTTTTTTCATGG + Intergenic
980288765 4:130816421-130816443 CTTGTTCTAATTAGTTCTCAAGG + Intergenic
980891839 4:138823939-138823961 CCTGTTCCAAAATGCTTTCAGGG + Intergenic
982308102 4:153954792-153954814 CCTGTTCTTCAATGCTTTCATGG + Intergenic
982617556 4:157659503-157659525 CATGTTCTTATTCGTTTTCATGG - Intergenic
982853211 4:160345091-160345113 CCTTTTCTAAATGCTTTTTATGG - Intergenic
984342231 4:178471811-178471833 TCTGTTCTAAATGGTATTAAGGG - Intergenic
984959241 4:185078448-185078470 TCTTTTCTAAAATCTTTTCATGG - Intergenic
985021762 4:185698911-185698933 TCTATTTTAAATTATTTTCATGG + Intronic
985069503 4:186154295-186154317 CCTGTATTAAAGTGTTTTTAAGG + Intronic
985140778 4:186838975-186838997 CCTGTTCTAGGTGCTTTTCATGG - Intergenic
985283027 4:188305823-188305845 CCTGTTTTAAATTTTGTTAAAGG - Intergenic
985527102 5:411120-411142 ACTGTTCTAAACCATTTTCATGG + Intronic
986047023 5:4048701-4048723 CCAGTTCTAAAATGTTTTGATGG - Intergenic
986529085 5:8715691-8715713 TCTGTGCTAAATGGTCTTCAAGG + Intergenic
987659202 5:20850587-20850609 ACTGTTCTAAATTGTTAAAATGG + Intergenic
987736498 5:21850733-21850755 CCTGTTCTAAATTCTGCTTAAGG - Intronic
987776204 5:22370484-22370506 TGTGTTATAAATTATTTTCAAGG - Intronic
988043335 5:25915753-25915775 CCTGATCTATTTTGTTTTGATGG - Intergenic
988227616 5:28432621-28432643 GCTTTTGTAAATTGTTTGCAAGG - Intergenic
989222387 5:38982887-38982909 CTTTTTCAAAAATGTTTTCATGG + Intronic
989609888 5:43280770-43280792 CTGCTTCTAAATTTTTTTCAAGG + Exonic
990219927 5:53576729-53576751 CCTGTTCTAAATTTTTGACTAGG - Intronic
992151845 5:73912213-73912235 TCTATTATAAATTGTTTTCTGGG + Intronic
992698232 5:79312634-79312656 CCTTTTTAAAATTGTTTTAATGG + Intronic
993348855 5:86821309-86821331 CCTGTTCTCAATTGAAGTCATGG + Intergenic
993787050 5:92154469-92154491 CCTTTTCTGATTTTTTTTCAAGG + Intergenic
994113084 5:96030580-96030602 CCTGTACTAAATTTTTTAAAGGG - Intergenic
994371948 5:98977559-98977581 CCTGTTCTTAAGTTTTTTCAGGG - Intergenic
995246382 5:109939850-109939872 CCCCTTCTACATTTTTTTCAAGG + Intergenic
996332025 5:122340617-122340639 AATGTTCTAAGTTATTTTCATGG - Intronic
997761107 5:136448084-136448106 TCTGTTCTGATGTGTTTTCAGGG - Intergenic
998819124 5:146042395-146042417 CCTGTGCTAAATAGTTTATATGG + Intronic
998909626 5:146944767-146944789 CCTTTAATAAATTGTTTTAAAGG - Intronic
1000853837 5:166374208-166374230 CCTGCTCTAATTTGTGTTCCTGG + Intergenic
1000907592 5:166981294-166981316 GCTGTTTTAAAATATTTTCATGG + Intergenic
1001530281 5:172456313-172456335 CCTTTACTAAACTGTCTTCATGG + Intergenic
1001737756 5:174020716-174020738 CCTGTGCCAAATTCTTTTCTAGG + Intergenic
1002977061 6:2090573-2090595 CCTGTTTAAAATTGCTTTCTAGG + Intronic
1004383000 6:15148599-15148621 CCTGTTCTAAGTCGTGTTCTGGG + Intergenic
1004389475 6:15198045-15198067 CTTCTTCTGAATTGTGTTCACGG - Intergenic
1004537039 6:16513210-16513232 CCTGTTGTATATTGTTTGAAAGG - Intronic
1004752779 6:18580993-18581015 CCTGCTCTAAGTTGGGTTCAGGG - Intergenic
1005232081 6:23713726-23713748 CATGTTCTACATAGTATTCATGG + Intergenic
1006765974 6:36507418-36507440 TCTGTTCTAATTTGGTTACAAGG + Intronic
1006768310 6:36529029-36529051 CCTGGTCCTAATTGTTATCATGG - Intronic
1007298120 6:40844107-40844129 CCTTCTCAAAATTATTTTCAGGG + Intergenic
1007670614 6:43550143-43550165 CCTATTGTAAAATGTTTTGATGG - Intronic
1011343565 6:86344994-86345016 TCTGTTCTAAATTTTTTTGGTGG - Intergenic
1012056343 6:94415999-94416021 CCTGTACTAAAATATTTTCATGG + Intergenic
1012426042 6:99115630-99115652 AGTGTTTTAAATTATTTTCAAGG + Intergenic
1012464102 6:99498011-99498033 ACTATTCCAAATTGTTCTCACGG + Intronic
1012658128 6:101852064-101852086 CCTGTTCTAAATGCTTTACTTGG - Intronic
1012991079 6:105926666-105926688 CTTGCTTTAAATTGCTTTCAGGG - Intergenic
1013878473 6:114864570-114864592 CCTGTTGAAAATTGTATGCATGG - Intergenic
1014461742 6:121704166-121704188 ACTCATCTAAATTTTTTTCATGG - Intergenic
1014735083 6:125084103-125084125 TCTGTTTTTATTTGTTTTCAAGG + Exonic
1015312445 6:131780669-131780691 CCTGTCCTAAATTGTTTATTAGG + Intergenic
1017081791 6:150676703-150676725 CATGTTCAAAAATGTCTTCATGG + Intronic
1017388799 6:153915426-153915448 CATTTTCTAAAATGTTTTCCTGG + Intergenic
1018385023 6:163295317-163295339 CCTGTCCTAAAGTGATTACAAGG + Intronic
1018553380 6:165024669-165024691 CTTGTTCTACACTGGTTTCAAGG - Intergenic
1020929315 7:14373182-14373204 CATGTTCCAAATTATTTGCAGGG - Intronic
1020948773 7:14648741-14648763 ATTCTTCTAAATTTTTTTCAAGG - Intronic
1021196025 7:17675141-17675163 TCAGTTCTACATTGTTATCAAGG + Intergenic
1021896620 7:25242328-25242350 CCTCTTCTTTTTTGTTTTCAGGG + Intergenic
1022546737 7:31196607-31196629 ATTTTTCTAAATTGGTTTCATGG + Intergenic
1022736175 7:33078208-33078230 CTTGTTCTAAATTGTTAGGAAGG - Intergenic
1023441736 7:40191606-40191628 ATTTTTCTAAATTGTTTTCCTGG + Intronic
1025174386 7:56790242-56790264 CCTGTCTTAAATTATTTTCAGGG - Intergenic
1025697417 7:63786180-63786202 CCTGTCTTAAATTATTTTCAGGG + Intergenic
1026000145 7:66554685-66554707 CCTCATCTACATTGTTTTGAAGG - Intergenic
1026032346 7:66805273-66805295 CCTCATCTACATTGTTTTGAAGG + Exonic
1026149375 7:67775007-67775029 TCTGGTTTGAATTGTTTTCAAGG + Intergenic
1026948351 7:74330838-74330860 CCTTTTCTAAATTATTTCCTTGG + Intronic
1028109818 7:86926649-86926671 CATTTTCTAAATTGTTTTTATGG - Intronic
1028825170 7:95264038-95264060 CTTGTTCTGAATTCTATTCAAGG + Intronic
1029287364 7:99475004-99475026 GGTCTTCTAAACTGTTTTCAGGG + Intronic
1029332443 7:99870378-99870400 CCTGTTATGAATTGTGTTCTTGG + Intergenic
1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG + Intronic
1029860894 7:103570773-103570795 CCTGTGCTACATTTTCTTCATGG - Intronic
1029941984 7:104490114-104490136 GCAATTTTAAATTGTTTTCATGG + Intronic
1031335738 7:120529379-120529401 CCTCTTCTAGAAAGTTTTCATGG + Intronic
1032959681 7:137016937-137016959 CCTGTTCTATATTGTTTATAGGG + Exonic
1035491388 7:159281833-159281855 CCTGATCTAGGTTGTTTCCAAGG + Intergenic
1036677413 8:10846581-10846603 TATATTCTAAAATGTTTTCAGGG + Intergenic
1036792058 8:11727414-11727436 CCTTTTTTCATTTGTTTTCAGGG + Intronic
1038098186 8:24340094-24340116 GCTGTTCTATAGTGTTTTCCCGG - Intronic
1040413951 8:47181154-47181176 CCTTTTCTCTCTTGTTTTCAAGG + Intergenic
1040721884 8:50334456-50334478 CCTGTTCTGCATTGTTTGCCTGG + Intronic
1040882141 8:52217488-52217510 CCTTTTCGAAGTTTTTTTCATGG - Intronic
1042083800 8:65086677-65086699 CTTGTTCTCAATTGTGTCCATGG - Intergenic
1042746642 8:72115345-72115367 CCTGGCCTAATTTGTTTTCTTGG - Intronic
1044411673 8:91890836-91890858 TCTGTTCAAAATTGTATGCAAGG + Intergenic
1044687907 8:94845447-94845469 CAAGTTCTACCTTGTTTTCAAGG + Intronic
1047239321 8:123072318-123072340 TCCGTTCTAAATTGCTTTTAGGG - Intronic
1047421141 8:124709374-124709396 TCTGTGTTGAATTGTTTTCACGG - Intronic
1048732032 8:137453359-137453381 CCACTTCTACATTATTTTCAGGG + Intergenic
1050232695 9:3544549-3544571 CCTGTACAAAATCCTTTTCAGGG + Intergenic
1050785976 9:9402197-9402219 TCTGTACTATATTTTTTTCAAGG - Intronic
1051723482 9:20064522-20064544 CCTCATCTAAATTTTTTTCTTGG - Intergenic
1052558596 9:30052786-30052808 GCTGTTCTAAATGGCTTTCTGGG + Intergenic
1054812964 9:69449377-69449399 CCTAATCTAAATTGATTTCAGGG + Intronic
1056529015 9:87470568-87470590 CCTGTTGTCAGTTGATTTCATGG + Intergenic
1057635647 9:96763693-96763715 CCTGATAAGAATTGTTTTCATGG - Intronic
1058076947 9:100660965-100660987 GCTTTTCTAAAATGTTCTCAGGG + Intergenic
1058812263 9:108652469-108652491 ACTGTTCTAAACTGTCTTCGTGG + Intergenic
1059690733 9:116683710-116683732 TATGCTCTAAATTTTTTTCATGG - Intronic
1059692738 9:116701200-116701222 GCTGCTCAAAATTGTTTTTATGG + Exonic
1185976749 X:4729866-4729888 CCTGTATCAAATTGTTTTTACGG + Intergenic
1186152020 X:6685323-6685345 CCAATTCAAAATTGCTTTCAAGG + Intergenic
1188189952 X:27160578-27160600 CCAATCCTAAATTGTTTTCTAGG + Intergenic
1188258735 X:27996603-27996625 TTTGTTGTCAATTGTTTTCAAGG + Intergenic
1188832678 X:34919446-34919468 CCTGCTATAAATTGTTTCCTGGG + Intergenic
1195928916 X:110053746-110053768 CCTGTTCTACATATTTTTCTGGG + Intronic
1196874611 X:120146377-120146399 CCTGTCCTTAATTGCTTTTATGG + Intergenic
1197425599 X:126294205-126294227 CCTGTTTTCAATTTTTTTGAGGG - Intergenic
1198178088 X:134174666-134174688 CTTGTTCTTAATTTTTTTTAAGG + Intergenic
1199244644 X:145589166-145589188 CATGTTCTCATTTGTTTTTATGG - Intergenic
1201887421 Y:18900665-18900687 ATTATTCTAAATTGTTTGCATGG + Intergenic
1201923867 Y:19263755-19263777 TGTGTTCAAAATTTTTTTCAAGG + Intergenic