ID: 920357062

View in Genome Browser
Species Human (GRCh38)
Location 1:205381610-205381632
Sequence CAAGCGAGGCCTCCTGCTTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920357062 Original CRISPR CAAGCGAGGCCTCCTGCTTC AGG (reversed) Exonic
901193598 1:7427087-7427109 CAAGCGAGGCCTCCAGCAGGTGG + Intronic
902152487 1:14454978-14455000 GAATGGAGGCTTCCTGCTTCTGG - Intergenic
902313917 1:15603388-15603410 CAAGCGGGCCCTGCTGCTTTTGG - Intergenic
902758771 1:18567144-18567166 CAGGCAAGGCCTCCTGTCTCTGG - Intergenic
904919447 1:33995494-33995516 CCAGTCTGGCCTCCTGCTTCTGG + Intronic
908128447 1:61052066-61052088 AAAGCGAGCCCTCCCGCTCCCGG + Intronic
918078504 1:181188678-181188700 AAAGCGAGACCACCTGCTTCAGG - Intergenic
918159326 1:181882738-181882760 TCAGCGAGGCCTGCTGCCTCTGG + Intergenic
920357062 1:205381610-205381632 CAAGCGAGGCCTCCTGCTTCAGG - Exonic
1062886315 10:1019182-1019204 CAGGCTAGTCCGCCTGCTTCAGG + Exonic
1066003225 10:31124102-31124124 CAAGCCAGGCCTTCTGTTCCAGG - Intergenic
1066529957 10:36326692-36326714 CAAGAGAGGGCTGCTGCTTGAGG + Intergenic
1067015228 10:42753316-42753338 CCAGCGCGGCCTCCTCCTCCAGG + Intergenic
1071015097 10:80987638-80987660 CAAGCGTGGCCCACTGCTCCTGG + Intergenic
1071131408 10:82397902-82397924 CAAGGAAGACCTCCTGCTGCTGG + Intronic
1072728439 10:97828987-97829009 CAGGCGAAGCCTCCTCCTCCTGG + Intergenic
1072737291 10:97887774-97887796 CAGGCCAGGACTCCTGCTCCAGG - Intronic
1073563007 10:104512839-104512861 CAGGCCCGGCCTCCAGCTTCAGG + Intergenic
1073875447 10:107916395-107916417 CAAGCCAGGTCCCCTGCTGCTGG + Intergenic
1077060134 11:614297-614319 CAAGGGGGACCTCCTGCTCCAGG - Exonic
1084186691 11:67476374-67476396 CGAGCGACGCCCCCTGCTCCAGG + Intergenic
1084493250 11:69489541-69489563 CAAGCCAAGCCTCCGGCTCCAGG - Intergenic
1085561387 11:77474935-77474957 CAAGCAAGGCAACCTGATTCCGG - Intergenic
1088099054 11:106134061-106134083 CAAGCGACCCCTCATGCTTATGG + Intergenic
1089101161 11:115963766-115963788 AAGTAGAGGCCTCCTGCTTCAGG + Intergenic
1090939058 11:131371892-131371914 CAAGAGAGGGCTCCTCCTCCCGG - Intronic
1095693426 12:45117053-45117075 CAAGCTCTGCCTCCTGGTTCAGG - Intergenic
1099208541 12:79756915-79756937 CAAGAGAGGTTTCCTGCCTCTGG - Intergenic
1103735170 12:123056568-123056590 CAGGAGTGGCCTCCTGCTGCCGG + Intronic
1104344542 12:127983706-127983728 CAAGCGCCGCCCCCTGCTCCAGG + Intergenic
1106247611 13:27962648-27962670 CCAGCTGGGCCTCCTGCCTCCGG - Exonic
1107560039 13:41550402-41550424 CCTGCAAGGCCTCCTGCTTCAGG - Intergenic
1112842734 13:103600260-103600282 CAAGCGCCGCCCCCTGCTCCAGG + Intergenic
1114443169 14:22767192-22767214 CACGCGAGGACTTCTGCTCCCGG + Intronic
1115029374 14:28775528-28775550 AAAGCGAGGACTCCAGTTTCTGG - Intronic
1118593929 14:67421497-67421519 CAGGCCAGGGCTCCTCCTTCTGG + Intergenic
1119615212 14:76094444-76094466 CAAGCCAGGCCTCCTTGCTCCGG - Intergenic
1120229719 14:81829504-81829526 CGAGCGCAGCCCCCTGCTTCGGG - Intergenic
1121250833 14:92498226-92498248 CAAGGGAGGCTTCATGCTTGAGG - Exonic
1121798442 14:96754480-96754502 CCAGCCAGGCCTCCTCCATCTGG - Intergenic
1122365706 14:101193772-101193794 CAAGTCATGACTCCTGCTTCTGG + Intergenic
1125520594 15:40345939-40345961 CCAGCCAGGACTCGTGCTTCTGG + Intergenic
1126261634 15:46699905-46699927 CAAGCGATTTCTCCTGCCTCAGG - Intergenic
1126765533 15:52007600-52007622 CAAGCAAATCCTCCTGCCTCAGG - Intronic
1129226036 15:74170993-74171015 CAAGCTTGGCCTCCTAGTTCTGG + Intergenic
1131461959 15:92623738-92623760 CAGGCCAGGCCTCCTCCCTCCGG - Intronic
1132049646 15:98596443-98596465 CAAGGGAGACCACCTGCTTGTGG - Intergenic
1132406263 15:101543257-101543279 CAAGTGAGGCCTCCTGTGCCAGG - Intergenic
1135591313 16:23706838-23706860 CAAACCAGGCATCCTGCTTCCGG + Exonic
1135637147 16:24087820-24087842 CAAGCGAGGCCTCTGCATTCTGG - Intronic
1136234340 16:28904870-28904892 AGAGCGAGGCCTCATGGTTCAGG + Exonic
1142318973 16:89368798-89368820 CAAGCGATCCCGCCTGCCTCTGG - Intronic
1144479458 17:15616954-15616976 CAAGCCAGGCCTTCTGCTGCTGG + Intronic
1144742301 17:17590901-17590923 CAAGCCAGGCCCCCAGCTTCTGG + Intronic
1144863134 17:18318218-18318240 GAAGCCAGGCTTCCTGATTCTGG - Intronic
1144918843 17:18746781-18746803 CAAGCCAGGCCTTCCGCTGCTGG - Intronic
1145035683 17:19539006-19539028 CAAGTGATCCTTCCTGCTTCAGG + Intronic
1145772289 17:27502175-27502197 CAAGCCAGGTCTGCTGATTCTGG + Intronic
1145936341 17:28717089-28717111 CCAGCTAGGCCTGGTGCTTCTGG - Intronic
1147453355 17:40519694-40519716 CAAGGAAAGGCTCCTGCTTCAGG - Intergenic
1151428841 17:74049163-74049185 CAAAAGAGGCCTCCTGGTTCTGG + Intergenic
1153877286 18:9385301-9385323 CAGGCAAGGCCTCCTCATTCAGG + Intronic
1161074958 19:2281029-2281051 CCGTCGAGGCCTCCTGCTCCAGG + Intronic
1161083199 19:2321676-2321698 CAGGCTAGGCGTCCTGCTGCTGG + Exonic
1162016829 19:7850747-7850769 CAGCCCAGGCCTCCTGCTTGTGG - Intronic
1163693254 19:18749182-18749204 GAAGCAAGACCTCCTGCCTCAGG + Intronic
1164772915 19:30825921-30825943 CCAGCAAGGCCTCCTGCTATTGG + Intergenic
1166397306 19:42450997-42451019 CAAGGGAATCCTCCTGCCTCAGG - Intergenic
925475054 2:4204128-4204150 CAAGCGTGGCCTCCTATTTGAGG - Intergenic
928212843 2:29336454-29336476 CAAATGTGGCCTGCTGCTTCAGG - Intronic
932347760 2:71006897-71006919 CAAGAGAGGCCCCCTGCAGCTGG + Intergenic
933457767 2:82538576-82538598 TATTCTAGGCCTCCTGCTTCAGG - Intergenic
934966432 2:98727998-98728020 CAAATGAGGCCTCCTGCACCTGG + Intronic
935225441 2:101048169-101048191 CAAGCCAGGCTTGTTGCTTCGGG + Intronic
936011835 2:108930061-108930083 CAGGGGAGGCCTCCTGCTTGTGG - Intronic
936489834 2:112960599-112960621 CAGACAAGGCCTCCTGCCTCTGG - Intergenic
940839207 2:158559576-158559598 CAATTGCGGCTTCCTGCTTCTGG + Intronic
944965978 2:204934109-204934131 GAAGCCAGGTCTCCTGATTCTGG + Intronic
948591709 2:239054603-239054625 AAAGCAAGGCCTTCTGCTGCAGG + Intronic
948893348 2:240917379-240917401 CCAGCCAGGCCTCCTGCACCTGG - Intergenic
1173021241 20:39269511-39269533 CAAGCCAGGGTTCCTGCATCTGG - Intergenic
1173815829 20:45987493-45987515 CCAGCCCGGCCTCCTGGTTCAGG - Intergenic
1180581659 22:16844674-16844696 CAGGAGAGGCCTCCTGTTTACGG + Intergenic
1180656273 22:17423565-17423587 CCAGAGTGGTCTCCTGCTTCTGG + Intronic
1181609669 22:24004115-24004137 CACTGGAGGCCTCCAGCTTCTGG - Intergenic
1182354565 22:29716743-29716765 CAAGCCAGGGCTCCTGCTGGGGG - Intergenic
1184051360 22:42007915-42007937 CAAGCTAGCAATCCTGCTTCTGG - Intronic
1185003151 22:48258547-48258569 CAAGCGGGGCCACCTGCTGCTGG + Intergenic
949414706 3:3801092-3801114 CAAGCGAGGTCCCCTTCTCCTGG - Intronic
954553982 3:51504116-51504138 CAAGCTCCGCCTCCTGGTTCAGG + Intergenic
955078999 3:55640449-55640471 CAAGTTAGGACTCCTGCTTCAGG + Intronic
961557777 3:127708393-127708415 CATCCGAGCCCTCCTGCCTCGGG - Intronic
969030253 4:4206323-4206345 AAAGTGAGGCCTCTTGGTTCAGG + Intronic
969724469 4:8911155-8911177 CATCCCAGGCCTCCTGCTGCGGG + Intergenic
970803577 4:20004337-20004359 CAAGCGCCGCCTCCTGCTCCAGG + Intergenic
978532482 4:109729561-109729583 CCAGCGAGGGCTCGTGCTTTCGG - Intronic
981007447 4:139890291-139890313 CAGGCGAGGCCTTCTTCTTCTGG - Exonic
986024618 5:3838885-3838907 CAACCGAGGCCCCCTGGTTGTGG + Intergenic
987524519 5:19030412-19030434 CTAGCGAGGGCTCCACCTTCGGG - Intergenic
989765080 5:45073411-45073433 CAAGTGGGACCTCCTGCTCCAGG + Intergenic
990869516 5:60415738-60415760 CAAGCGCTGCCCCCTGCTCCAGG + Intronic
992990409 5:82278057-82278079 CGAGCGGGGCCTCGTCCTTCGGG - Intronic
996973864 5:129407355-129407377 CATGCTAGCCCTACTGCTTCAGG + Intergenic
997260114 5:132459382-132459404 CAAGGGAGGCCTCCTGTCTGTGG + Intronic
998676159 5:144410228-144410250 TAATCAAGGCCTCCTGCTTCAGG - Intronic
1006013031 6:31058084-31058106 AAACCCAAGCCTCCTGCTTCTGG + Intergenic
1006436646 6:34029198-34029220 CAGGCTAGGCCTCCTGGGTCTGG + Intronic
1007112501 6:39320984-39321006 GAAGTGAGGCCTCCAGCTTCAGG - Intronic
1012189294 6:96260983-96261005 CAAGCGCCGCCCCCTGCTCCAGG - Intergenic
1013030207 6:106325533-106325555 CAAGCTATGGCTCCTCCTTCCGG + Exonic
1015341586 6:132107122-132107144 CAAGCCTAGCGTCCTGCTTCAGG + Intergenic
1018269472 6:162061019-162061041 CAAGGGAGGACTCAAGCTTCTGG - Intronic
1019310210 7:356838-356860 CCAGGGAGGCCTCCCTCTTCAGG + Intergenic
1020678530 7:11208246-11208268 CAAGCCAGGTTTGCTGCTTCTGG + Intergenic
1023988379 7:45111772-45111794 GAAGCCACGCCTCCAGCTTCCGG + Intronic
1029611838 7:101630718-101630740 CAAGCAAGGGCTCTTGCCTCCGG + Intergenic
1034113562 7:148562361-148562383 CAGCCTAGGGCTCCTGCTTCTGG - Intergenic
1035384175 7:158459349-158459371 CAAGCGGGGCCTCTGGATTCTGG - Intronic
1038425271 8:27460614-27460636 CAAGTGAGGCCTCCTCCTGATGG + Exonic
1042732724 8:71955019-71955041 CAAGCTAGCACTCCTGGTTCTGG + Intronic
1044072665 8:87781848-87781870 CAAGTGAGGCCATCTGGTTCTGG - Intergenic
1044837178 8:96307350-96307372 CAAGTGAGGCCCGCTGCTTATGG - Intronic
1048969687 8:139638575-139638597 CCAGCGAAGCTCCCTGCTTCTGG - Intronic
1049360025 8:142208039-142208061 CACAGGAGGCCACCTGCTTCAGG - Intergenic
1050148397 9:2593964-2593986 CAAGGGAGGTCTCCTTCTTGGGG + Intergenic
1055401184 9:75925749-75925771 CAATCGTGGCCTCCTCCTTATGG + Intronic
1057435022 9:95032191-95032213 CAGCGGAGGCCACCTGCTTCTGG + Intronic
1059391496 9:114002234-114002256 GAAGGGAGGCCTCCTGATGCGGG + Intronic
1061545394 9:131301485-131301507 CAAGCAAGGCCTCCTGGTGGTGG - Intronic
1197607983 X:128606947-128606969 CAAGCGCTGCCCCCTGCTCCAGG + Intergenic
1199320830 X:146436647-146436669 CAAACAAGACCTCCTGATTCTGG - Intergenic
1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG + Intronic
1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG + Intergenic
1200263943 X:154635543-154635565 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1200266148 X:154647235-154647257 AACGCGTGGCCTCCCGCTTCTGG - Intergenic