ID: 920362193

View in Genome Browser
Species Human (GRCh38)
Location 1:205426748-205426770
Sequence GAAGGATCCTGGAACCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 220}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920362193_920362202 7 Left 920362193 1:205426748-205426770 CCCTTCAGGTTCCAGGATCCTTC 0: 1
1: 0
2: 1
3: 18
4: 220
Right 920362202 1:205426778-205426800 GGGCCCTCTGAAGCTGATGATGG 0: 1
1: 0
2: 2
3: 14
4: 172
920362193_920362207 23 Left 920362193 1:205426748-205426770 CCCTTCAGGTTCCAGGATCCTTC 0: 1
1: 0
2: 1
3: 18
4: 220
Right 920362207 1:205426794-205426816 ATGATGGGTTGCCATCCTGGAGG 0: 1
1: 0
2: 2
3: 9
4: 108
920362193_920362203 8 Left 920362193 1:205426748-205426770 CCCTTCAGGTTCCAGGATCCTTC 0: 1
1: 0
2: 1
3: 18
4: 220
Right 920362203 1:205426779-205426801 GGCCCTCTGAAGCTGATGATGGG 0: 1
1: 0
2: 0
3: 7
4: 119
920362193_920362206 20 Left 920362193 1:205426748-205426770 CCCTTCAGGTTCCAGGATCCTTC 0: 1
1: 0
2: 1
3: 18
4: 220
Right 920362206 1:205426791-205426813 CTGATGATGGGTTGCCATCCTGG 0: 1
1: 0
2: 1
3: 5
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920362193 Original CRISPR GAAGGATCCTGGAACCTGAA GGG (reversed) Intronic
900930590 1:5734662-5734684 TAAGGGACCTGGAACCTTAACGG + Intergenic
900977969 1:6028900-6028922 GAATCATCCTGGAAGCTCAAAGG - Intronic
901413067 1:9098516-9098538 GCAGGATCCTGGAAACTGCACGG - Intergenic
901956564 1:12789930-12789952 GAAGGGTCCTGGAAAATGACTGG + Intergenic
901979946 1:13026074-13026096 GAAGGGTCCTGGAAAATGACTGG + Intronic
902002141 1:13202857-13202879 GAAGGGTCCTGGAAAATGACTGG - Intergenic
902021368 1:13348597-13348619 GAAGGGTCCTGGAAAATGACTGG - Intergenic
902951428 1:19885930-19885952 GTAGCATTCTGGAACCTGAGGGG + Intronic
903047884 1:20577974-20577996 GGAGGATCGTTGAACCTGAGAGG - Intergenic
903226972 1:21899342-21899364 GAAGGACCTTGGACCCAGAAAGG + Intronic
903533465 1:24050280-24050302 GAAGAATCCATGAACCTGGAAGG + Intergenic
903578744 1:24355445-24355467 GAAGGATGCTGGGACGTGCAGGG + Intronic
904019720 1:27453797-27453819 GAAGGATGCTTGAACCTGGGAGG + Intronic
905343488 1:37295418-37295440 TAAGAATCCTGGAACCTGCAGGG - Intergenic
907527904 1:55064362-55064384 GAAGAAACCTGGAACCAGAGGGG + Exonic
909121346 1:71608059-71608081 GAAGGATTCTGGTTGCTGAATGG - Intronic
909793564 1:79703868-79703890 GAAGAATCCTTGAACCTGGAAGG - Intergenic
909913099 1:81284602-81284624 TGAGGATCCTGGAACATGATTGG + Intergenic
913598125 1:120396926-120396948 GAGGGATCCTGGGGCATGAATGG + Intergenic
913718162 1:121560522-121560544 GAAGCATACTGGAAGCTGCAAGG - Intergenic
914089206 1:144482394-144482416 GAGGGATCCTGGGGCATGAATGG - Intergenic
914309407 1:146451821-146451843 GAGGGATCCTGGGGCATGAATGG + Intergenic
914512269 1:148344736-148344758 GACGGATCCTGGGGCATGAATGG - Intergenic
914592704 1:149121316-149121338 GAGGGATCCTGGGGCATGAATGG - Intergenic
914838540 1:151228590-151228612 GAAGCATCCTGGATCCTTGAGGG + Intronic
915246515 1:154559241-154559263 GTAGGAGCCGGGAACCGGAATGG + Intergenic
915458560 1:156055601-156055623 GAAGGATCCCTGGACCTGAGAGG + Intronic
917485600 1:175452141-175452163 GAGGGGTCCTGGGACCTCAAAGG - Intronic
918311540 1:183288918-183288940 GAAGGGTTCTGAAAGCTGAAGGG + Intronic
920362193 1:205426748-205426770 GAAGGATCCTGGAACCTGAAGGG - Intronic
920776876 1:208947331-208947353 GAAGAATCCTAGAACAAGAAAGG + Intergenic
921045004 1:211469884-211469906 TAAAGCTCCTGGAACCAGAAGGG - Intergenic
921765722 1:218971126-218971148 GGAGGACCCTGTAACCAGAATGG - Intergenic
922758523 1:228109742-228109764 GGAGGATCCTCGGAGCTGAAGGG + Intergenic
1062790082 10:298124-298146 GTAGGATCCTGGGACAGGAAGGG - Intronic
1063440921 10:6072245-6072267 GCAGGATCCTTGAGCCTGGAAGG + Intergenic
1066313672 10:34222445-34222467 GAAGGTTCCTAGATCTTGAAGGG - Intronic
1068122211 10:52793341-52793363 GAAGATTCCTGGAAGCAGAAAGG - Intergenic
1068279322 10:54848290-54848312 GGAGAATCCTTGAACCTGGAAGG + Intronic
1069448401 10:68495323-68495345 GGAGAATCCTTGAACCTGGAAGG + Intronic
1070821816 10:79360474-79360496 AAAGGATCCTGGGCCCTGGATGG - Intergenic
1074245000 10:111680814-111680836 GCAGCATCCTGGAAGCAGAAAGG + Intergenic
1075253320 10:120902825-120902847 GAAAGATGCTGGAGTCTGAAGGG + Intronic
1075304335 10:121354531-121354553 AAAGAATCCAGGTACCTGAATGG + Intergenic
1076444873 10:130507506-130507528 GAAGGATCCAGGAATGAGAAAGG - Intergenic
1078134689 11:8641936-8641958 GCATGATCCTGGAACCTGCTCGG - Intronic
1078730357 11:13968309-13968331 GAAGGAGCCTGGTTCCTGGATGG - Intronic
1079425849 11:20341860-20341882 AAAGGATTCAGGAAACTGAATGG - Intergenic
1080525255 11:33110128-33110150 GAAGGATCCACCAACCAGAAAGG - Intronic
1083966465 11:66046796-66046818 GGGGGAGCCTGGAACCTGATGGG + Intronic
1085295758 11:75430747-75430769 TAAGGAACCTGGATGCTGAACGG - Intergenic
1090387649 11:126365992-126366014 GAAAGATTCTGGCACCTGAGAGG - Intronic
1090390214 11:126383190-126383212 GAAAGATTCTGGCACCTGAGAGG - Intronic
1090543110 11:127730760-127730782 GGAGGTTGCTGGAACCTGAGAGG - Intergenic
1090825299 11:130380896-130380918 GGGGGCTCCTGGAACCAGAAAGG + Intergenic
1091070119 11:132555098-132555120 GAAGGATGCTGCAACCACAAGGG + Intronic
1096691850 12:53326219-53326241 GAAGAATCGTGGAACCTGGGAGG - Intergenic
1097070583 12:56351501-56351523 GAGAGATCTTGGAACCTGGATGG - Intronic
1097942915 12:65331954-65331976 CAAGCATCCTGAAACCAGAAAGG + Intronic
1100334384 12:93615918-93615940 GATGGATCCTGTAACCTCTAAGG - Intergenic
1101834947 12:108288582-108288604 GAAGGACCCAGGAACCTGCAGGG + Exonic
1101866256 12:108522194-108522216 GAGGAATGCTGGAAGCTGAATGG + Intronic
1104180212 12:126372519-126372541 AAAGGAACCTGGAACCTCAGTGG - Intergenic
1105492194 13:20899947-20899969 GTAGGATACTGGGACCAGAAAGG - Intronic
1105787800 13:23767020-23767042 GGAGGACCCTGGAACCTGGGGGG + Intronic
1105953956 13:25262108-25262130 GAAGGATCCTGTAATCTAAATGG - Intronic
1109088497 13:58008146-58008168 TATGGATCCTGAAATCTGAAAGG + Intergenic
1111707222 13:91765202-91765224 GAAGGATCCTTGGAGCTGGAAGG - Intronic
1111979048 13:94997809-94997831 GATGGATCCTGGAACAGAAAAGG - Intergenic
1113262837 13:108584634-108584656 GTTGGATCCTGGAAGCTGACAGG - Intergenic
1113311388 13:109136691-109136713 GGAAGATGCTGGAAGCTGAAGGG - Intronic
1113533611 13:111046825-111046847 GAAGAATCCTAAAACATGAATGG - Intergenic
1114175725 14:20317924-20317946 GAAGCATCCTGGGACCTGCCAGG + Exonic
1114557272 14:23569217-23569239 GGAGACTCCTGGAAGCTGAATGG - Exonic
1115954185 14:38759153-38759175 GAAGGATGATGGAACCAGGATGG + Intergenic
1119786013 14:77314932-77314954 GAGGGATCCTGGGACATAAAGGG - Intronic
1122107396 14:99468849-99468871 CAAGGAGCCTGTTACCTGAAGGG - Intronic
1123630165 15:22255652-22255674 GAAAGATCTTGGAACCTCATTGG - Intergenic
1123982113 15:25613665-25613687 GAAGGATCCTTCTCCCTGAAAGG - Intergenic
1124354434 15:28984518-28984540 GAAGGATCCTGGCACTTGAGAGG - Intronic
1124614468 15:31231490-31231512 GAAGGAACCTGGGATCTCAATGG - Intergenic
1126354560 15:47781583-47781605 GAAGGATCTTAGAAACTAAACGG + Intergenic
1126435059 15:48628546-48628568 GAAGGAGCCTGGCATTTGAAAGG - Intronic
1129541014 15:76347027-76347049 GCAGGATCCTTGCAGCTGAAAGG - Intergenic
1130226478 15:82062403-82062425 GCAGGAGTCTGGAAGCTGAAGGG + Intergenic
1131541631 15:93279759-93279781 GAAGGATCTTAGAACATGAAGGG - Intergenic
1131637084 15:94247423-94247445 GAAGGATCCTAGAACTGGCATGG - Intronic
1132596300 16:752028-752050 GAGGGACGCTGGAACCTGGAGGG - Intronic
1133626996 16:7579879-7579901 TCCGGATCCCGGAACCTGAAGGG - Exonic
1138044259 16:53704274-53704296 CAAGGATCAGGGAACCGGAAGGG + Intronic
1138237825 16:55400046-55400068 AAAGGATCCTTAAAGCTGAAAGG + Intronic
1140456947 16:75111243-75111265 GCAGGTTCCTGGGACCTGCAGGG + Intergenic
1141788939 16:86219882-86219904 GAAGGAGCCTGGAGCCTGGACGG + Intergenic
1145837467 17:27965420-27965442 GAGGGATCCTGGCCACTGAAAGG - Intergenic
1145848815 17:28070442-28070464 GGAGAATCCTTGAACCTGGAAGG - Intronic
1147177161 17:38663233-38663255 GAAGGAGCCTGGTCCCCGAATGG - Intergenic
1150096966 17:62385350-62385372 GAAGGATCCTTGAGCCTGGGCGG + Intronic
1151647826 17:75445632-75445654 TAAGGAAGCTGGAGCCTGAACGG - Intronic
1152408933 17:80112309-80112331 GAAGGACCCTGGATGCTGACAGG + Intergenic
1157116044 18:44863795-44863817 AAAGGATGCTGGCACATGAATGG - Intronic
1157494459 18:48145331-48145353 GAAGGGTCCAGGGAGCTGAAGGG - Intronic
1159141781 18:64405116-64405138 GCAGGATCTTAGAACCTGGATGG + Intergenic
1159288324 18:66382253-66382275 GTTGCAGCCTGGAACCTGAAAGG + Intergenic
1161300475 19:3540181-3540203 GAAGAATCCTAGAACCTGGGAGG - Intronic
1161993194 19:7697048-7697070 GAGCTGTCCTGGAACCTGAACGG - Exonic
1162088572 19:8262801-8262823 GAAGGATCCAGGGACCACAAAGG - Intronic
1163948695 19:20564560-20564582 GAAGAATGCTTGAACCTGAGAGG + Intronic
1164582453 19:29442864-29442886 GAATGACCCACGAACCTGAAAGG + Intergenic
1164750725 19:30652978-30653000 GGAGGATCCTGGATTCTGACGGG - Intronic
1165782311 19:38441661-38441683 GAAGGAGCCTGGGGTCTGAAAGG + Intronic
1168629212 19:57944100-57944122 GAAGGATTATGGATCCTGAGAGG - Intronic
927948629 2:27152622-27152644 CAAGGATCCTGGACCACGAAGGG + Intronic
928300603 2:30121063-30121085 GAAGGAGCCTGGAGGCTGCAAGG + Intergenic
928423931 2:31162471-31162493 TATGGATCCTGGAAGCTGATTGG + Intergenic
929539306 2:42808230-42808252 AAAGTCTCCTGGGACCTGAAAGG - Intergenic
929934748 2:46286481-46286503 GAGGGATCCTGGACCCTGGAAGG - Intergenic
931541192 2:63330958-63330980 GGAGGATCCTTGAACCTGGGAGG - Intronic
932056619 2:68449485-68449507 GGAGCATCCTGGATCCTGGATGG - Intergenic
936232921 2:110720030-110720052 GAAGTAACCTGGCACCAGAATGG + Intergenic
937448098 2:121975626-121975648 GGAGGACTCTGGAACCTGACAGG + Intergenic
937705273 2:124913326-124913348 GAAGGCTCTTGGAACATGAAAGG - Intronic
938082284 2:128376580-128376602 GAAGGACCCAGGAACGTGACTGG + Intergenic
943718897 2:191182286-191182308 GTAGGAACCTGAAACCTGCAAGG - Intergenic
943772879 2:191737664-191737686 GAAGGATCCTGGAAAGTAAGTGG + Intergenic
947564524 2:231185592-231185614 GAAGGCTCCTGGGGCCAGAATGG + Intergenic
947694179 2:232169619-232169641 GAAGGATCTTAGAGTCTGAAGGG - Intronic
948126886 2:235570710-235570732 CAAGGAAGCTGGAACCTAAATGG - Intronic
1169855183 20:10094247-10094269 GATGGATCCTGGATCCTGGTGGG + Intergenic
1172370909 20:34390538-34390560 GGAGGATCGTTGAACCTGGAAGG - Intronic
1174288686 20:49491037-49491059 GAAGGATTCTGGAGTCAGAATGG + Intergenic
1179164254 21:38923735-38923757 GAGGCATCCTGGAAACTGATGGG - Intergenic
1179246259 21:39636697-39636719 GCAGGATCCTGGGACTGGAAAGG + Intronic
1180122933 21:45765933-45765955 GAAGTCTCCTGGAGCCTGGAAGG + Intronic
1181466481 22:23113260-23113282 GAAGGATGCTGGGACCAGCAGGG - Intronic
1182672040 22:32004558-32004580 GCAGGATCCAGGACCCTGGATGG - Intergenic
1183132755 22:35855494-35855516 GGAGGATCCTTGAACCTAGAAGG - Intronic
1184483118 22:44759680-44759702 GAAGTATCCTGGAGCCTCAGGGG + Intronic
1184654357 22:45933624-45933646 GAGGGATCATGGCACCTCAAAGG + Intronic
949480178 3:4486325-4486347 GGAGAATCCTGGAACCCGGATGG - Intergenic
950882662 3:16335838-16335860 CAAGGAGCCTGGAAACTGGATGG + Intronic
950985123 3:17355255-17355277 GAAGGACCTTGGAAACTGATAGG - Intronic
951243829 3:20317284-20317306 GAAGGGTCCTAGAAGCTGACAGG - Intergenic
952407641 3:33018807-33018829 AGAGGAACCTGGACCCTGAATGG + Intronic
954456898 3:50604579-50604601 GATGGAACCTGGAACCTGTTGGG + Intergenic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
955400747 3:58589735-58589757 GAGGGATCCTGGAACAGAAAAGG - Intronic
955555040 3:60127689-60127711 GGAGGATCCTTGAGCCTGGAAGG - Intronic
956594417 3:70950078-70950100 GAAGCTTCCTGGAACATGCAAGG - Intergenic
957525532 3:81374455-81374477 GGAGGATCCTGGAAAGGGAAGGG - Intergenic
958922398 3:100121815-100121837 GAAGGATGCTGGGACCTCAGAGG + Intronic
962250479 3:133833159-133833181 GTATGTTCCTGGAACCTCAAAGG + Intronic
963546182 3:146661368-146661390 GAAGAATCCTTGAACCTGGGAGG - Intergenic
966971331 3:185048192-185048214 GAGGGATCAAGAAACCTGAAAGG + Intronic
967422782 3:189292550-189292572 GAAGGATCCTGGCATGTGATAGG + Intronic
968373096 4:12853-12875 GAAGGAGCCTGGTACCAGAGTGG - Intergenic
969030075 4:4204859-4204881 GAAGAATCCTTGAACCTGGGAGG - Intronic
969944344 4:10767698-10767720 GAAGGATGCTAGAACAAGAAGGG + Intergenic
971384812 4:26132985-26133007 GAAGGCTCATGGAACCCAAAGGG - Intergenic
975650855 4:76591319-76591341 AAAAGATCCTTGAATCTGAATGG + Intronic
975770419 4:77715200-77715222 GAAAGATTCTGAAAGCTGAATGG + Exonic
977890217 4:102301265-102301287 CAAGGGACCTGGAAGCTGAATGG - Intronic
980906238 4:138951113-138951135 GGAGGAACCAAGAACCTGAAGGG - Intergenic
981288811 4:143050249-143050271 GTAGGAGCCTGAGACCTGAAGGG - Intergenic
981766488 4:148256235-148256257 GAAGGATCTTGCCACCTCAAAGG + Intronic
983091334 4:163506242-163506264 GAAGGATCCTGGATCCCTAAGGG + Intronic
983178096 4:164615253-164615275 GAGGGATTCTGGGGCCTGAATGG - Intergenic
983694496 4:170511312-170511334 GAAGGATCTTGGACCATAAAGGG - Intergenic
983810820 4:172059475-172059497 GAAGAATCCTGTGACTTGAAAGG + Intronic
984107952 4:175574013-175574035 GAAGGACCCTGAAAACTGTATGG + Intergenic
984539232 4:181017078-181017100 GGAGAATCCTTGAACCTGACAGG - Intergenic
985462298 4:190119711-190119733 GAAGGAGCCTGGTACCAGAGTGG + Intergenic
986670820 5:10140929-10140951 CAGGGCTCCTTGAACCTGAAGGG - Intergenic
986963193 5:13240050-13240072 GCTGGTTCCTGCAACCTGAAAGG - Intergenic
987137928 5:14917162-14917184 GAAGAATCATGGAAGCAGAAAGG - Intergenic
988784747 5:34556130-34556152 GTAGGATCCTGGAACATGTATGG + Intergenic
988887588 5:35574902-35574924 GGAGGATCCTGGAGCCTGGGAGG - Intergenic
991138240 5:63208580-63208602 GAAGAATCCTAGAACCTGCAGGG + Intergenic
991250426 5:64554291-64554313 AGAGGTTCCTGGCACCTGAAAGG - Intronic
993902659 5:93595254-93595276 GAAGGGTCCTGGAACTCGGATGG + Intergenic
994719469 5:103364368-103364390 GCAGGATCCTGGAACCTACAAGG - Intergenic
996281041 5:121729232-121729254 GAAGGAGGCGGGAAACTGAATGG - Intergenic
997656564 5:135559513-135559535 GAAGGATCCTGGGCTCTGATTGG + Intergenic
998639548 5:143994327-143994349 AAAGAATCTTGGACCCTGAATGG + Intergenic
998910814 5:146958173-146958195 GATGGTGCCTGGAATCTGAAAGG - Intronic
1001242107 5:170078892-170078914 CAAGGACCCAGGAAGCTGAAGGG - Intronic
1004909256 6:20267555-20267577 GATGGATCCTGAAACCTAAGAGG + Intergenic
1005148633 6:22722058-22722080 GAAGGGCCCTGAAGCCTGAAGGG + Intergenic
1005499379 6:26416772-26416794 GAATGATACTGGGACCTCAAGGG - Intergenic
1009868221 6:69424410-69424432 AAAGGGTCCAGGACCCTGAATGG + Intergenic
1010202813 6:73298098-73298120 GAAGAATCCTTGAACCTGGGAGG + Intronic
1013749269 6:113383575-113383597 GAGGGCTCCTGCATCCTGAATGG - Intergenic
1014402716 6:121010940-121010962 GAAAGAACCCGGAACCAGAATGG - Intergenic
1015270562 6:131333812-131333834 GAAGGAAACTGGAAACTAAATGG + Intergenic
1015451189 6:133367995-133368017 GCAGTATGCTGGAACCAGAAGGG + Intronic
1017090612 6:150755509-150755531 GAAGGAACCTGGGACCTAGACGG + Intronic
1018646238 6:165951432-165951454 GAAGGATGCTGGACACGGAAAGG - Intronic
1018730544 6:166646718-166646740 CAAGGATCCTAGGAACTGAAGGG - Intronic
1019135653 6:169906080-169906102 GAGAGCTCCCGGAACCTGAATGG - Intergenic
1019891337 7:3949479-3949501 GGAGGATTCTGGCAACTGAAAGG - Intronic
1020914670 7:14177463-14177485 GAAGAATCCTTGAAACTGGAAGG + Intronic
1026205267 7:68251808-68251830 GAATGATCCAGGAACATGGAGGG - Intergenic
1026614898 7:71893146-71893168 GAAGGATCCTGCACCCTCAGGGG + Intronic
1026775401 7:73227909-73227931 GAAGGTCCCTGGAGACTGAAAGG + Intergenic
1027016258 7:74781283-74781305 GAAGGTCCCTGGAGACTGAAAGG + Intronic
1027071770 7:75164658-75164680 GAAGGTCCCTGGAGACTGAAAGG - Intergenic
1030159171 7:106489931-106489953 GAAGAATCCTGGAAAATGACAGG - Intergenic
1030911680 7:115257799-115257821 GCAGCATTCTGGAACTTGAATGG + Intergenic
1035277505 7:157756949-157756971 GACGGAGCCTGGAACATGCAGGG + Intronic
1038124827 8:24661642-24661664 GCAGTATCCTGGGGCCTGAATGG + Intergenic
1040961473 8:53038100-53038122 ATAGGATCCTGGAACATAAAAGG - Intergenic
1042291439 8:67172920-67172942 GTAGGATCCTGAAACCTGAGGGG + Intronic
1043222514 8:77685398-77685420 CATAGATCCTGGAAACTGAAAGG + Intergenic
1043404003 8:79912180-79912202 GAAGTATCATGGAACAGGAAGGG - Intergenic
1045012406 8:97969625-97969647 GAAGAATCATGGAACATGATAGG + Intronic
1046632079 8:116631244-116631266 GAAGGGTCCTGGTACCAAAATGG - Intergenic
1047743645 8:127827520-127827542 GGAGGCTCCTGGACCGTGAAGGG - Intergenic
1048032277 8:130644027-130644049 GAAGGATCCATGAACTTGAAGGG - Intergenic
1049042072 8:140119973-140119995 GTGGCATCCTGGAATCTGAATGG - Intronic
1051188101 9:14481763-14481785 GAAGGAACCTGAGACCTGTAAGG + Intergenic
1052754716 9:32528652-32528674 GAAGGATCCTTGAGCCTGGGAGG - Intergenic
1056210421 9:84360082-84360104 GAAGGAACCTTGAACCTGTAAGG + Intergenic
1056810551 9:89760571-89760593 AGGGGATCCTGGGACCTGAAAGG - Intergenic
1059748813 9:117228912-117228934 GGAGGATCCTTGAACCTGGGAGG + Intronic
1061103818 9:128513617-128513639 GGAGGATCCTTGATCCTGGAAGG + Intronic
1061124006 9:128662244-128662266 AAAAGAGCCTGAAACCTGAAGGG + Intergenic
1062133951 9:134914920-134914942 GAGAGCTCCTGGAACCAGAAGGG - Intronic
1186511748 X:10134946-10134968 GGAGGAGCCGGGAACCTGAGTGG + Intronic
1188261713 X:28031616-28031638 GAAGAGTCCTGGACCTTGAAAGG + Intergenic
1188289823 X:28373343-28373365 GAAGGATCCTGGAACCTCCATGG - Intergenic
1189911196 X:45812023-45812045 GAAGGATCCTAGCACATGAGTGG - Intergenic
1190732271 X:53234016-53234038 CAAGGATCCTCGAATCTGGAAGG + Exonic
1192144056 X:68669166-68669188 GAAAGGTCCTGGAGCCTAAAAGG + Intronic
1193475203 X:81955600-81955622 GAATCATCCTGGAACGTGAAGGG + Intergenic
1194105939 X:89767400-89767422 ATAGGATCTTGGAACCAGAAAGG - Intergenic
1195462231 X:105140442-105140464 TAATGAACCTGGAACGTGAATGG + Intronic
1195758969 X:108225816-108225838 GAAGAACACTGGAACCTTAACGG - Intronic
1196811111 X:119629607-119629629 GCAGGACCCTGGAACCTCAGGGG + Intronic
1198377301 X:136052652-136052674 GGAGGATCCTTGAACCCGAGAGG - Intergenic
1200457895 Y:3415259-3415281 ATAGGATCTTGGAACCAGAAAGG - Intergenic
1201551996 Y:15227255-15227277 GAAGGATGCTTGAACCTGGGAGG + Intergenic