ID: 920364238

View in Genome Browser
Species Human (GRCh38)
Location 1:205439716-205439738
Sequence TAAGCCTGTTCTCCCTCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920364238_920364239 8 Left 920364238 1:205439716-205439738 CCTGATGAGGGAGAACAGGCTTA 0: 1
1: 0
2: 1
3: 8
4: 146
Right 920364239 1:205439747-205439769 GCCTGAAGCATCTCTGCTGCTGG 0: 1
1: 0
2: 0
3: 13
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920364238 Original CRISPR TAAGCCTGTTCTCCCTCATC AGG (reversed) Intronic
900044953 1:498424-498446 TAAGCTTGTTTTCCCGCAACTGG + Intergenic
903281142 1:22250715-22250737 AAAGCCTGTGCTCCTTCTTCTGG + Intergenic
905539457 1:38748291-38748313 TGAGCCTTATTTCCCTCATCTGG - Intergenic
907379797 1:54077113-54077135 CCAGCCTGTTCTCCCTGATAAGG - Intronic
907478491 1:54725071-54725093 CAACCCTGTTCTGCCTCCTCTGG - Intronic
912692288 1:111813410-111813432 CAAGTCTCTTCTCCCTCAGCAGG + Intronic
913279842 1:117175185-117175207 TAAGCCTATTTTCCCCCATAAGG - Intronic
913941726 1:125115822-125115844 GAAGCCTGTTTTCCCACAACAGG + Intergenic
917169667 1:172157154-172157176 TGAGCTTGTTTTCCATCATCTGG + Intronic
920364238 1:205439716-205439738 TAAGCCTGTTCTCCCTCATCAGG - Intronic
920739648 1:208568495-208568517 GAAGCCTCTTCTGCCTCTTCAGG + Intergenic
921030097 1:211328844-211328866 TAAGCCTGCTCTAACTCATGAGG - Intronic
923402942 1:233632815-233632837 TCCTGCTGTTCTCCCTCATCAGG + Intronic
1063173532 10:3531243-3531265 TAAGCCTGTTCATTCTCATCCGG + Intergenic
1066782425 10:38967367-38967389 GAAGCCTGTTTTCCCACAACAGG + Intergenic
1066950970 10:42115700-42115722 GAAGCCTGTTTTCCCACAACAGG - Intergenic
1069134326 10:64745300-64745322 TTAGCATGTTCTCACTCATGTGG - Intergenic
1069951954 10:72025139-72025161 AAATCCTGTTCTCCCATATCTGG - Intergenic
1071150717 10:82631278-82631300 CAAGACGGCTCTCCCTCATCCGG - Intronic
1078424694 11:11239495-11239517 TAAGCCTGTTTTTGCTCATAAGG + Intergenic
1081852770 11:46285260-46285282 ACAGCCTGTTCTCCAGCATCTGG - Intronic
1083421061 11:62553539-62553561 TCAGCCTGATCTCCTTCAACTGG - Intronic
1084176540 11:67425211-67425233 TCAGCCTGTTTCCTCTCATCGGG - Exonic
1085368039 11:75971017-75971039 TCATCCTTTTCTCCCTCCTCTGG + Intronic
1086370192 11:86148716-86148738 CATGCCTGTTCTCCCTCACTAGG + Intergenic
1088346549 11:108833513-108833535 TAAGCCTCTTCTCACCCATGTGG + Intronic
1088390040 11:109304123-109304145 TCACCCTTTTCTCCCTCAGCTGG - Intergenic
1089764878 11:120756058-120756080 TAAGCTTGGTGTCCCTCATCAGG + Intronic
1091690239 12:2591252-2591274 TCTGCATGTTCTCCCTCTTCTGG - Intronic
1093803837 12:23408172-23408194 AAAGCCTTCTCTCTCTCATCAGG - Intergenic
1095221228 12:39618780-39618802 AAAGCCTGTTCTCCCAAATTTGG - Exonic
1095876849 12:47088789-47088811 TAAGCATGTTTTCTATCATCTGG - Intronic
1097446200 12:59675135-59675157 TGAGCCTGTCCTCTCTCATCAGG - Intronic
1101637897 12:106561329-106561351 GAAGCCTGCTCTCCTTCATGAGG - Intronic
1108574036 13:51776677-51776699 GGAGCCTGTTCTCCCCCAGCGGG - Intronic
1110016096 13:70406148-70406170 TAAGCCTGTTATACGTCATTTGG + Intergenic
1115892468 14:38046758-38046780 GAAGCTTGTCTTCCCTCATCTGG - Intergenic
1119409161 14:74418557-74418579 TATGCCCTTTCTCCCTAATCTGG + Intronic
1120505186 14:85346988-85347010 TAATCTTTTTCTCCCTCTTCTGG - Intergenic
1121400601 14:93673794-93673816 TCAGCCTGTTCCCCCACTTCTGG - Intronic
1122374340 14:101248323-101248345 GAGGCCTGTTTGCCCTCATCTGG - Intergenic
1123138743 14:106054996-106055018 TACAGCTGTTCTCCCTCCTCTGG - Intergenic
1126378330 15:48019164-48019186 TAACCCTGTTCTCCTGCAACTGG + Intergenic
1127290777 15:57569148-57569170 AAGGCCTTTTCTTCCTCATCTGG - Intergenic
1129418959 15:75407502-75407524 ACAGCCTTTTCTCCCTCAGCTGG - Intronic
1132716040 16:1290253-1290275 ACAGCCTGGTCTCCCTCCTCTGG + Intergenic
1136696833 16:32088287-32088309 GAAGCCTGTTTTCCCACAACAGG - Intergenic
1136797334 16:33031577-33031599 GAAGCCTGTTTTCCCACAACAGG - Intergenic
1137084730 16:36104998-36105020 GAAGCCTGTTTTCCCACAACAGG - Intergenic
1137219355 16:46431294-46431316 GAAGCCTGTTTTCCCACAACAGG - Intergenic
1139203008 16:64998477-64998499 GAAGCCCGTTCTCCCAAATCAGG - Intronic
1139613938 16:68077817-68077839 TTAGGCTGCTCTGCCTCATCTGG + Intronic
1140253177 16:73312725-73312747 TGAGCCTGTATTTCCTCATCTGG - Intergenic
1145326869 17:21839527-21839549 GAAGCCTGTTTTCCCACAACAGG + Intergenic
1145689844 17:26728705-26728727 GAAGCCTGTTTTCCCACAACAGG + Intergenic
1145693703 17:26770959-26770981 GAAGCCTGTTTTCCCACAACAGG + Intergenic
1147306443 17:39567654-39567676 CCACCTTGTTCTCCCTCATCAGG + Intergenic
1147574178 17:41589096-41589118 TAAGCCTGATCCCCCACACCCGG + Intergenic
1148463845 17:47852791-47852813 TAAGGCTCATTTCCCTCATCCGG + Intronic
1150508479 17:65723524-65723546 TTAGCCTGTATTCTCTCATCTGG - Intronic
1150675417 17:67242285-67242307 TAAGCCTGTAATCCCTACTCGGG + Intronic
1152411263 17:80124508-80124530 TATGCCTGCTCTTCCTGATCTGG + Intergenic
1203191048 17_KI270729v1_random:190107-190129 GAAGCCTGTTTTCCCACAACAGG + Intergenic
1155898156 18:31354665-31354687 TAAGCCTATTCTCGATCCTCTGG + Exonic
1157140207 18:45098136-45098158 TATGCATGTTATCCCTCCTCTGG - Intergenic
1157777362 18:50406183-50406205 GAAGCCTGTTTTTCCTCCTCTGG - Intergenic
1165252974 19:34555448-34555470 GAAGCCTGTTTTTCCTCCTCTGG + Intergenic
925116242 2:1380648-1380670 TGAGCCTGTTCTAACTCAGCTGG - Intronic
928744894 2:34400742-34400764 AAAGCATATTCTCCTTCATCTGG - Intergenic
930558842 2:52933915-52933937 TAAGCCTAGTCTCCCTTAGCTGG + Intergenic
934252000 2:90363303-90363325 GAAGCCTGTTTTCCCACAACAGG - Intergenic
934257440 2:91439653-91439675 GAAGCCTGTTTTCCCACAACAGG + Intergenic
934331070 2:92070211-92070233 GAAGCCTGTTTTCCCACAACAGG + Intergenic
935838296 2:107078903-107078925 CCAGCCTGTGCTCCCTCACCAGG - Intergenic
938232634 2:129674907-129674929 TTAGGGAGTTCTCCCTCATCAGG + Intergenic
938516482 2:132012665-132012687 GAAGCCTGTTTTCCCACAACAGG - Intergenic
939184093 2:138840382-138840404 TATGCCTTCTCTCCCTCCTCTGG + Intergenic
940051012 2:149464819-149464841 TCAGACTTTTCTCCCTAATCTGG - Intronic
940409671 2:153346873-153346895 TAAGCCTCAGTTCCCTCATCTGG - Intergenic
941012796 2:160320490-160320512 TAAGCCTGATCTCCAACATTGGG - Intronic
941427341 2:165365194-165365216 TCAGGCTGTTCTCCCTCGGCGGG - Exonic
945815454 2:214600202-214600224 TGAGCCTGTTCTGTCCCATCTGG + Intergenic
948573799 2:238936884-238936906 TCAGCCTGTTCTACCACATCGGG + Intergenic
1170923794 20:20704227-20704249 TAAGCCTGATCTCCCACCCCAGG + Intronic
1172550899 20:35798902-35798924 TAAGCCTGAGCCACCTCATCTGG + Intronic
1172957216 20:38769551-38769573 TAAGCCTGTCCTCCCTCCCGCGG - Intronic
1174490782 20:50893500-50893522 AATGCCTCTTCTCTCTCATCGGG - Exonic
1181484392 22:23221392-23221414 TCACCCTGTTCCCCTTCATCAGG + Intronic
1182304080 22:29356018-29356040 TAAGCTGGAGCTCCCTCATCTGG + Intronic
1182687589 22:32132890-32132912 TAAGCTGGAGCTCCCTCATCTGG - Intergenic
1184565179 22:45287499-45287521 TGCCCCTGCTCTCCCTCATCAGG - Intronic
1184840593 22:47050350-47050372 TAACCTCGTTCTTCCTCATCTGG + Intronic
1203325350 22_KI270738v1_random:8786-8808 GAAGCCTGTTTTCCCACAACAGG - Intergenic
950904150 3:16522358-16522380 TAATTCTCTTCTCCTTCATCTGG + Intergenic
950975683 3:17241027-17241049 TAACCATGTTCTCCCTCATCTGG + Intronic
951031559 3:17887703-17887725 TAACCCTTTTCTGCCCCATCTGG - Intronic
952034759 3:29186874-29186896 TAAGGCTGTGCTCCCTCACGAGG + Intergenic
953416218 3:42719569-42719591 TAAGCCTGTGTTCCATCATAAGG - Intronic
956050184 3:65239742-65239764 TAAGCCTGTTTTGGATCATCTGG - Intergenic
956750774 3:72342230-72342252 CAAGCCAGCTCTCCCTCCTCAGG + Intergenic
960926622 3:122800822-122800844 TTCCCCTATTCTCCCTCATCAGG - Intronic
961059345 3:123815276-123815298 TAAGCTTGTTCTTCTTGATCTGG + Intronic
966389824 3:179440276-179440298 TAAGCCTGTCCTTCCTGACCTGG - Intronic
976657280 4:87502495-87502517 TAAGCATATTCTCACTCATATGG - Intronic
978751769 4:112257245-112257267 TCGCCCTGTTCTACCTCATCTGG + Intronic
981430199 4:144648395-144648417 CAAGACAGTTCTCACTCATCTGG - Intronic
983787521 4:171752540-171752562 TAGGCCTGTGCTGCCACATCTGG + Intergenic
983946873 4:173596118-173596140 TAAGCCTGAGTTTCCTCATCAGG - Intergenic
984267608 4:177513271-177513293 TCAGCCTGTTCTACCACATGAGG - Intergenic
984923863 4:184789220-184789242 TAAACCTGTTTTCTCTCTTCAGG - Intronic
985089110 4:186345433-186345455 TAACCCTTTTCTCCCTCCTTGGG + Intergenic
989213289 5:38878936-38878958 TTAGCCTGTGCTCCCAGATCAGG + Intronic
992869439 5:80991501-80991523 TCAGCCTTTTCTCACTCAACAGG + Intronic
993853836 5:93046113-93046135 TATACCTGTTCTCTCTCATTAGG - Intergenic
997662938 5:135603480-135603502 GAGGCCTGTCCTGCCTCATCAGG - Intergenic
1002110198 5:176903849-176903871 TAAGCCTTTGCTTCCTCATCTGG + Intergenic
1002337888 5:178493095-178493117 TATTCCTGTTCTCCAGCATCAGG + Intronic
1002728891 5:181320505-181320527 TAAGCTTGTTTTCCCGCAACTGG - Intergenic
1003207056 6:4021877-4021899 TAAGTCTTTTCTTCCTCATGCGG + Intronic
1003564973 6:7215053-7215075 TCTGCCTTCTCTCCCTCATCTGG - Intronic
1005959660 6:30686307-30686329 TAACCCTGTGCTGCCACATCTGG - Exonic
1005987001 6:30881850-30881872 TCAGCCTCCTCTCCCTCTTCTGG + Intronic
1008981219 6:57486198-57486220 TTAGCCTGTTCTCCCTCTTTCGG - Intronic
1011575189 6:88789799-88789821 AAAGCCTGTTATCCATCCTCTGG - Intronic
1016897088 6:149064084-149064106 TAAGCCTGGTCTCCCTGGTGAGG + Intronic
1019826192 7:3286336-3286358 AAAGTCTGTTCTCCTGCATCTGG + Intergenic
1022522047 7:31014779-31014801 CAAGGCAGTTCTCCCTCCTCAGG - Intergenic
1024806894 7:53152124-53152146 GAAGCCTGTTTTCCCACAACAGG - Intergenic
1025319804 7:58084093-58084115 GAAGCCTGTTTTCCCACAACAGG + Intergenic
1025478112 7:60953128-60953150 GAAGCCTGTTTTCCCACAACAGG + Intergenic
1026523397 7:71134763-71134785 TTAACCTGGTTTCCCTCATCAGG + Intronic
1026940788 7:74286856-74286878 GAAGCCTGTCTTCTCTCATCTGG + Intergenic
1030169735 7:106589154-106589176 TGAGCCTGTTCACCATCATGTGG - Intergenic
1030620874 7:111789902-111789924 TAAGCCTGTTTTCCCAAAACTGG + Intronic
1031890995 7:127293511-127293533 TAGCCCTGATCTCCCTGATCAGG + Intergenic
1032181441 7:129682314-129682336 TAAGCATGTGCTACCACATCTGG - Intronic
1034700907 7:153094874-153094896 TCAGCCTGTACTCCCTCCTCTGG - Intergenic
1035318274 7:158011454-158011476 TAAACATGTGCTCCCTCTTCTGG - Intronic
1037636704 8:20706607-20706629 TAAGCCTGTTTTCTCTCACCTGG + Intergenic
1041553267 8:59123818-59123840 TAATCCAGTCCTCTCTCATCAGG + Intergenic
1044716351 8:95103268-95103290 TCAGCCATTTCTCCCTCTTCTGG - Intronic
1047269081 8:123337624-123337646 TAAGCCTGTTGACCCTGATGAGG - Exonic
1047934784 8:129766128-129766150 AAAGACTGTTCTCAATCATCTGG - Intronic
1050696788 9:8288186-8288208 CAACCCTGTTCTCCTTCACCAGG - Intergenic
1053945689 9:43308297-43308319 GAAGCCTGTTTTCCCACAACAGG + Intergenic
1055694754 9:78871780-78871802 AAAACCTGTGCTCCCTCACCAGG - Intergenic
1057407090 9:94782290-94782312 TATGCTTTTTCTCCTTCATCTGG - Intronic
1059790451 9:117636664-117636686 TACTCCTCTTGTCCCTCATCTGG + Intergenic
1060515706 9:124264362-124264384 CCAGCCTCTACTCCCTCATCCGG + Intronic
1203588824 Un_KI270747v1:36877-36899 GAAGCCTGTTTTCCCACAACAGG + Intergenic
1187389584 X:18877198-18877220 CCTGCCTGTTCTCCCTCCTCAGG - Intergenic
1190600624 X:52088886-52088908 TAACCCTGTTCTTCATCACCAGG - Intergenic
1192460905 X:71316445-71316467 AAATACTGTACTCCCTCATCAGG - Intergenic
1196522783 X:116694082-116694104 TAGGCCTCTTCTCCCTTTTCGGG + Intergenic
1196866779 X:120077784-120077806 AACGCGTGCTCTCCCTCATCCGG - Intergenic
1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG + Intergenic