ID: 920367762

View in Genome Browser
Species Human (GRCh38)
Location 1:205457050-205457072
Sequence CGCCGCCGCCGGAGGCCGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 1, 2: 6, 3: 44, 4: 320}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920367757_920367762 5 Left 920367757 1:205457022-205457044 CCCGGCGGGCGGGAGACAAAAGC 0: 1
1: 0
2: 0
3: 12
4: 83
Right 920367762 1:205457050-205457072 CGCCGCCGCCGGAGGCCGCGCGG 0: 1
1: 1
2: 6
3: 44
4: 320
920367756_920367762 13 Left 920367756 1:205457014-205457036 CCTCGCAGCCCGGCGGGCGGGAG 0: 1
1: 0
2: 4
3: 35
4: 216
Right 920367762 1:205457050-205457072 CGCCGCCGCCGGAGGCCGCGCGG 0: 1
1: 1
2: 6
3: 44
4: 320
920367758_920367762 4 Left 920367758 1:205457023-205457045 CCGGCGGGCGGGAGACAAAAGCT 0: 1
1: 0
2: 1
3: 3
4: 59
Right 920367762 1:205457050-205457072 CGCCGCCGCCGGAGGCCGCGCGG 0: 1
1: 1
2: 6
3: 44
4: 320
920367751_920367762 19 Left 920367751 1:205457008-205457030 CCCGCACCTCGCAGCCCGGCGGG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 920367762 1:205457050-205457072 CGCCGCCGCCGGAGGCCGCGCGG 0: 1
1: 1
2: 6
3: 44
4: 320
920367753_920367762 18 Left 920367753 1:205457009-205457031 CCGCACCTCGCAGCCCGGCGGGC 0: 1
1: 0
2: 0
3: 8
4: 211
Right 920367762 1:205457050-205457072 CGCCGCCGCCGGAGGCCGCGCGG 0: 1
1: 1
2: 6
3: 44
4: 320
920367748_920367762 27 Left 920367748 1:205457000-205457022 CCTAAGCGCCCGCACCTCGCAGC 0: 1
1: 0
2: 0
3: 2
4: 86
Right 920367762 1:205457050-205457072 CGCCGCCGCCGGAGGCCGCGCGG 0: 1
1: 1
2: 6
3: 44
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920367762 Original CRISPR CGCCGCCGCCGGAGGCCGCG CGG Intergenic
900269171 1:1778415-1778437 CGCCGGCGCCGGGGTCCGGGCGG - Intronic
900562388 1:3313718-3313740 CGCCGGGGCAGGAGGCGGCGAGG - Intronic
901005784 1:6170937-6170959 CGCCACCGCAGGAGACCGCCTGG + Intronic
901496839 1:9627216-9627238 CGCCCAACCCGGAGGCCGCGAGG + Intergenic
901703963 1:11059901-11059923 CGGCGGGGCCGGAGGCGGCGGGG + Exonic
901709045 1:11099661-11099683 CGCGGCCGCCGGAAGCCGACTGG - Intronic
902916830 1:19644538-19644560 CGCGGCCGCCGGACGCGCCGGGG - Intronic
903829119 1:26164413-26164435 CGCCGCCGCCGCCGCCTGCGAGG + Intergenic
903950588 1:26993941-26993963 CGCCGCTGCCGGACGCAGCTGGG + Exonic
904181371 1:28668907-28668929 CGCCCTCGCCGGCCGCCGCGCGG - Intronic
904181401 1:28668997-28669019 CGCCGCCGCCGGGGAGCGAGCGG + Intronic
904641946 1:31937935-31937957 CGCCGGCGCCGGGGGCCTCGGGG - Intronic
904724854 1:32539588-32539610 CGGCGCCGGCGGAGGGCGGGCGG + Intronic
905182657 1:36176494-36176516 CGCCCCCGCCGGTGAGCGCGGGG + Exonic
905449004 1:38045433-38045455 CGCCGCCGGCGGGGGCGGTGGGG + Exonic
907010636 1:50959900-50959922 CGCCGCCGCCGGGCGCCGAGGGG + Exonic
910237010 1:85047441-85047463 CGCCGGCGCGGGAGGCAGGGTGG + Intronic
915359455 1:155277479-155277501 CGCCTCCGCTAGAGCCCGCGGGG + Intronic
915463191 1:156081738-156081760 CGCCGCGGGCGGCGGCGGCGGGG + Exonic
916666925 1:166975341-166975363 CGCCGCCGCCCGCTGCCGCGGGG - Intronic
918215789 1:182391365-182391387 CGCCGCCCCTGGAGGCCGTTGGG - Intronic
919748663 1:201023590-201023612 CGCCGCCGCCCGATGGCGCGAGG - Exonic
920367762 1:205457050-205457072 CGCCGCCGCCGGAGGCCGCGCGG + Intergenic
921029722 1:211326813-211326835 CGCCGCCGCCGGCCGCAGCCAGG + Intronic
922558258 1:226549142-226549164 CCCCGCCGCGGGAGGGCGTGGGG + Intronic
923126687 1:231039995-231040017 CGCCGCCGCCCGGGCCCCCGCGG + Exonic
923191773 1:231626894-231626916 CGCCGCCGCCGGCGGCGGCTGGG - Exonic
923783012 1:237042464-237042486 CGCCGCCGCCGAGCTCCGCGGGG + Exonic
1063664094 10:8051499-8051521 CGCCGCCGCCGCAGGGCCCGGGG - Intergenic
1064544501 10:16437107-16437129 GCCCGACGGCGGAGGCCGCGCGG + Intronic
1065020209 10:21496547-21496569 CGGCGCCGCCGCAGGTCGCTAGG + Intronic
1065343018 10:24723776-24723798 GGCCGCCGCAGGAGGGCGTGGGG + Intergenic
1066672839 10:37858013-37858035 CCTCGCCTCCGGAGGCGGCGAGG - Intronic
1069474565 10:68721384-68721406 CGTCGCCGCCCGGGGCCGCCGGG - Intronic
1070768619 10:79070061-79070083 CACCGCCGCCGGAGACGGAGAGG - Intronic
1071332186 10:84571343-84571365 CGCAGCTGCCGGAGGGTGCGCGG + Intergenic
1071695352 10:87863787-87863809 TGCCGCCGCCGCAGGCCGGCCGG - Exonic
1071695442 10:87864145-87864167 CGCCGCCGCCGCACCCCCCGTGG + Exonic
1072294176 10:93993818-93993840 CGCCACCGCGGGCGGCCGGGCGG - Intergenic
1072654307 10:97319671-97319693 CGCCGCAGCCAGGGGCCCCGGGG - Exonic
1072656579 10:97334333-97334355 CGCCGCAGCCAGGGGCCCCGGGG + Exonic
1072710745 10:97714296-97714318 CGCCGCAGACGGCGGCCGCCAGG - Exonic
1072915540 10:99535511-99535533 CGCCGCCGCCGCCGCCCGCCGGG - Exonic
1074815148 10:117137194-117137216 CCCCGGCGGCGGAGGCTGCGAGG - Intronic
1076680377 10:132168591-132168613 CGTGGCCGCCGCGGGCCGCGTGG + Exonic
1076895367 10:133308845-133308867 CGCCGCCGTCGGGGGCTGCGCGG - Exonic
1076981861 11:208942-208964 AGCGGCCGCCTGAGGCCGGGGGG + Intronic
1077085379 11:747452-747474 CGCCGCCGCCGCAGACCCCTCGG + Exonic
1077102278 11:827556-827578 CACCCCAGCCGGAAGCCGCGCGG - Intronic
1081773881 11:45665143-45665165 CGCCCGCCCCGGAGCCCGCGGGG + Intronic
1081831509 11:46119972-46119994 CCCCGCCGCCGGCGGCCGCGGGG - Intronic
1083039123 11:59669070-59669092 CGCCGCCGCCGGGCGCCGAGCGG - Intergenic
1083171090 11:60924492-60924514 CGCCGCCGCCGCCCGCCCCGCGG - Exonic
1083258057 11:61508747-61508769 TGCCTCCGCCGGAGGCCGACTGG - Intergenic
1083457108 11:62786686-62786708 CGCTGCCGCCAGGGGGCGCGGGG + Exonic
1083610108 11:64000462-64000484 GGCCGCGGCCGGAGGCCACGGGG - Intronic
1083933349 11:65857836-65857858 CCCCGCGGCCGGTGTCCGCGCGG + Intronic
1083941868 11:65900256-65900278 CGCTGCGGCCGGGGGCTGCGCGG + Exonic
1084646887 11:70463994-70464016 CGCCGCCCCGGGAGGCCCCAAGG - Intergenic
1085477927 11:76799355-76799377 CGCCGACCCGGGAGTCCGCGCGG + Intergenic
1088256498 11:107908395-107908417 CGCCGCCGCCGCAGACGCCGCGG + Intronic
1092159847 12:6310383-6310405 CGCCGCCGGGGGAGGCGGCGAGG - Intergenic
1095954168 12:47797034-47797056 GGCCGCCGCCGGAGGCTGGGGGG + Exonic
1096077642 12:48815146-48815168 AGCCGCCGCCGGAGGATGGGCGG + Intronic
1096254972 12:50057454-50057476 CGCCGCCGAAAGCGGCCGCGAGG + Intergenic
1096647686 12:53047458-53047480 CGGGGCCGCCGGAGGTCGAGAGG + Intronic
1097929626 12:65169829-65169851 CGCCGCCGCCGCTGGTCCCGCGG - Exonic
1102026014 12:109714646-109714668 CGCCCCGGACGGGGGCCGCGCGG - Exonic
1102136866 12:110582941-110582963 CGCCGCCGCCGCCGGCCCTGGGG + Exonic
1102853871 12:116277246-116277268 CGCCGCCGGGGGAGGGCGCGAGG + Exonic
1103325331 12:120116568-120116590 CGCAGCGGCCGGAGGCGGCGCGG - Intronic
1103410872 12:120710612-120710634 CGACGCCGTCGTCGGCCGCGTGG - Exonic
1103509923 12:121467259-121467281 CGCCGCCGCCGCCGCCCGCCCGG + Intronic
1103595355 12:122021818-122021840 CGCCGCCGCCGCCGGCAGTGCGG - Exonic
1103749856 12:123151133-123151155 CGGCGCCTCCTCAGGCCGCGCGG + Intergenic
1103764667 12:123271659-123271681 CGCCGCCGCCGCCGCCCTCGCGG - Exonic
1104761325 12:131299016-131299038 CGCCGGGGCCGAGGGCCGCGTGG + Intergenic
1104818450 12:131661776-131661798 CGCCGGGGCCGAGGGCCGCGTGG - Intergenic
1105240973 13:18609532-18609554 CGCCCGCGCCTGTGGCCGCGCGG - Intergenic
1105378072 13:19863219-19863241 CGCCAGCGGCGGAGGTCGCGGGG - Intronic
1105411820 13:20177387-20177409 CGCCCCTGCGGGAGGCGGCGCGG - Intergenic
1106956403 13:34942889-34942911 GGCCGCTGGCGGAGGCGGCGGGG + Exonic
1107951340 13:45465005-45465027 CGCTGCTGCTGAAGGCCGCGAGG + Exonic
1108727794 13:53201121-53201143 CGCCGCCGCCGCTGCCCTCGGGG + Intergenic
1110318509 13:74135307-74135329 CGCCGCCCCCGGGCCCCGCGGGG - Intergenic
1110436462 13:75482103-75482125 CGCTGGAGCCGGCGGCCGCGGGG - Exonic
1111672760 13:91348985-91349007 CGGCGCCGCCGGTCGCCGCGCGG + Intergenic
1112216319 13:97434314-97434336 CGCCGCCGCCGGCGCCCAGGGGG + Exonic
1112652703 13:101416284-101416306 CACCGCCGCCGGTGCCCGGGAGG - Intronic
1113378127 13:109782937-109782959 CGCCACCGCCGCCGGCCCCGGGG - Exonic
1113803200 13:113096918-113096940 CGCGGCCCCCGGACGCCCCGAGG + Exonic
1115851296 14:37592309-37592331 CGTCGCCGCCGCCGCCCGCGCGG + Exonic
1116817893 14:49599875-49599897 CGCCGCCGCTCCACGCCGCGGGG - Intronic
1118849484 14:69573097-69573119 CGGCGGCGGCGGCGGCCGCGGGG + Exonic
1119524016 14:75307932-75307954 TGCAGCCGCAGGAGGCAGCGTGG + Intergenic
1120167902 14:81220357-81220379 CGGCGGCGGCGGCGGCCGCGCGG + Intronic
1121137166 14:91509765-91509787 TGCCGCCGCTGGGCGCCGCGGGG + Exonic
1121342860 14:93115605-93115627 TGCCGCCGCCTGAGGGCGTGTGG - Intronic
1121377791 14:93430409-93430431 CGCCGGGGCCGGAGGGCGCGAGG - Intronic
1121546968 14:94769814-94769836 CCGCGCCGCCGGGGGCCACGGGG + Exonic
1122143323 14:99675115-99675137 CGCCCGCGCTGTAGGCCGCGGGG - Exonic
1122389498 14:101370513-101370535 CACTGCCGCCTGGGGCCGCGTGG + Intergenic
1122445019 14:101761787-101761809 CGGCGGCGGCGGCGGCCGCGGGG + Exonic
1122904584 14:104795835-104795857 CGCCCTCGCCGCCGGCCGCGCGG - Intergenic
1123490383 15:20775607-20775629 CGCCCGCGCCTGTGGCCGCGCGG + Intergenic
1123546884 15:21344694-21344716 CGCCCGCGCCTGTGGCCGCGCGG + Intergenic
1124469271 15:29968790-29968812 CGGCGGCGGCGGAGGCGGCGGGG - Intronic
1126034924 15:44537036-44537058 CGCCGCCGCCTGAGGGGGCGTGG + Exonic
1126436995 15:48646245-48646267 AGCAGACGCCGGAGGCCGGGAGG + Intergenic
1128139056 15:65286276-65286298 CGCCGCGGGCGTAGGACGCGGGG + Exonic
1128877604 15:71215064-71215086 CGCCGCCGCCGTCGTCCTCGGGG - Exonic
1129199871 15:73992325-73992347 CGCCGCCGCGGGTGGCCGCGCGG - Exonic
1129348280 15:74938166-74938188 CCCCGCCGCCGCCGGCCGCGCGG - Exonic
1129986460 15:79923496-79923518 CGCGGGCGGCGGAGGCAGCGGGG - Exonic
1131094550 15:89647277-89647299 CGCCGCCACCAGAGGGCGCCAGG + Intronic
1131692829 15:94845129-94845151 CGCCTCGCCAGGAGGCCGCGAGG - Intergenic
1132235961 15:100221904-100221926 CACCTCTGCCGGAGGCCGCCTGG + Intronic
1132398161 15:101489317-101489339 CGCGCGCGCCGGAGGCCGCCGGG + Intronic
1202955215 15_KI270727v1_random:71910-71932 CGCCCGCGCCTGTGGCCGCGCGG + Intergenic
1132587488 16:711886-711908 CGCCGCCACCAGAGGGCGCCTGG + Intronic
1132616183 16:842148-842170 CGCTGCCGCAGGAGGCTGAGGGG + Intergenic
1132893244 16:2214813-2214835 CGCCGCGGCGGGCGGCTGCGAGG - Intergenic
1133156588 16:3880512-3880534 CGCCGCCGCCGGGCTCCGGGAGG + Exonic
1133156745 16:3881023-3881045 CGCCGCTCCCGGAGCCCGCTGGG - Intergenic
1133219824 16:4315420-4315442 CCCCGCCGCCCGGGGCCGCAGGG + Exonic
1134849864 16:17470873-17470895 CGCGGCCGCCGGCTGCCGCTCGG + Exonic
1136498776 16:30659481-30659503 CGCCGCATCCGGAGGCGGCGGGG - Exonic
1137261121 16:46830956-46830978 CGCCGCCGCCGGCGGGCCCCAGG + Intronic
1138179320 16:54931408-54931430 CGGCGGCGGCGGCGGCCGCGGGG - Exonic
1139678252 16:68539797-68539819 CGCGGCGGTCGGAGGCCTCGGGG - Exonic
1139974794 16:70800979-70801001 CGCCGGCGCCGGGGGCAGAGCGG - Exonic
1140927579 16:79599191-79599213 CGGCGGCGGCGGAGGCGGCGGGG - Exonic
1141582722 16:85011321-85011343 CGCCGCCGCCGCAGGCCGGGAGG - Exonic
1141608608 16:85169325-85169347 CGCCGCCGCCGGGGGGTGCTCGG + Intergenic
1141959025 16:87392362-87392384 CGCCGCCCCCGGGAGCCGCCGGG + Exonic
1142374866 16:89701637-89701659 CGCGGCGGCCGGAGACCGCTGGG - Exonic
1142378958 16:89721227-89721249 AGGCGCCGGCGGAGGCCACGCGG - Intronic
1142552947 17:752145-752167 CGGCGACGCCGGCGGCTGCGCGG + Exonic
1143166414 17:4899325-4899347 CGCCGCCGCCCGAGGCCCCCCGG - Exonic
1144909905 17:18672501-18672523 CGCCGCAGCCGGGGGCGGCTGGG - Intronic
1145750176 17:27349601-27349623 CGCCCCCGCCCCAGGCCGCGAGG + Intergenic
1145925655 17:28644952-28644974 CGCCGCCGCCGCCGCCGGCGCGG + Intronic
1146183037 17:30709330-30709352 CGCCGCCGTCGGAGGGGGCTGGG + Intergenic
1146356940 17:32142492-32142514 CGCCGCCGCCACAGCCCGCTGGG + Exonic
1146403668 17:32519457-32519479 CGCCGCCGCCAGAGCCCACCCGG - Intronic
1146958123 17:36948996-36949018 CGACTCCGCCAGAGACCGCGCGG - Exonic
1147315391 17:39617888-39617910 GGCCGCCCCGGGAGGGCGCGCGG - Intergenic
1147986120 17:44308656-44308678 CGCCGCCGGGGGAGGGAGCGAGG + Exonic
1148262241 17:46193556-46193578 CGCCGCCCCCGCGGGCCGCCAGG + Intronic
1148576983 17:48719281-48719303 CGCCGACTGCGGAGGCTGCGAGG - Intergenic
1148945754 17:51260490-51260512 CGCCGCCGCCGAAGCCCCGGGGG - Intergenic
1149430620 17:56593734-56593756 CGCCGCCGCTGGAGTCCGCCGGG + Exonic
1151575885 17:74952393-74952415 AGCAGCCCCCGGAGGCTGCGGGG + Intronic
1151589705 17:75035100-75035122 AGCTGCAGCCGGAGACCGCGTGG + Intronic
1152357707 17:79814823-79814845 CGCCGCCGCCGGGCTCCCCGAGG - Intergenic
1152744882 17:82034029-82034051 GGCCCCCGCCGGAGGCCGGGAGG + Exonic
1152759049 17:82098746-82098768 CGCCGCCGTCGCTGCCCGCGCGG + Intergenic
1154447993 18:14450376-14450398 CGCCCGCGCCCGTGGCCGCGCGG + Intergenic
1156008512 18:32470683-32470705 CGCCGCCGCCCGCAGCCGCGCGG - Intergenic
1156088810 18:33440756-33440778 CGCCGCCGCCGCCGCCCCCGCGG - Intronic
1158976515 18:62715793-62715815 CGCCGCCGCCAGAGCCGCCGCGG - Exonic
1159511212 18:69400698-69400720 CTCCGCCGCCGGGCGCCCCGAGG - Intergenic
1159798106 18:72867785-72867807 CGGCGGCGCCGGCGGCGGCGGGG + Exonic
1160025445 18:75211826-75211848 AGCCGCCGCCGGAGTTCGCGGGG - Intronic
1160887051 19:1354974-1354996 CGCCGCCGCCGCTCCCCGCGGGG - Intronic
1160910009 19:1469943-1469965 GGCCGCCGGCGGGGGCCCCGGGG - Exonic
1160966474 19:1749008-1749030 AGCCCCCGCCGGAGGGTGCGCGG - Intergenic
1161029514 19:2051185-2051207 CGCCGCCGCCGCCGCCAGCGCGG + Exonic
1161156137 19:2732712-2732734 CCCTGCCGCCGGAGCCCGCCGGG - Exonic
1161412484 19:4124101-4124123 CGCCGCAGCCCGAGTCCGAGAGG + Exonic
1162070357 19:8149130-8149152 GGGCGCCCCCGGAGCCCGCGGGG + Intronic
1162311987 19:9913401-9913423 TGCCGCCGCCGCAGCCCCCGGGG - Intronic
1162733732 19:12734354-12734376 GGCCGCCGCCGCTGGCCCCGGGG - Exonic
1162751763 19:12833861-12833883 CGCCGCCGCCGCGGTCCCCGCGG + Intronic
1163026834 19:14517762-14517784 CTCGGCCGCCGGGGTCCGCGGGG - Intronic
1163103250 19:15109802-15109824 CGGCGCCGCCTGAGCCTGCGAGG + Exonic
1163441330 19:17323920-17323942 CGCCCCCGCCGGACCCCGCCGGG + Intronic
1163606973 19:18280974-18280996 CGCCGCCGCCGGGGGGCCCTCGG - Exonic
1165080116 19:33302105-33302127 CGCCGCCGCCGCCGCCCGTGGGG + Exonic
1165199815 19:34134542-34134564 CGCCTGCGCCCGAGGGCGCGGGG + Intergenic
1165243049 19:34482250-34482272 CGCCGCCGTCGGACCCCGCCAGG - Exonic
1167313960 19:48753149-48753171 GGCTGCCGCCGGAGCGCGCGAGG + Intronic
1167495114 19:49813043-49813065 GGACCCCGCTGGAGGCCGCGAGG + Exonic
1168538520 19:57191699-57191721 CGCCGCCCCTGGAGACCGCGGGG - Exonic
925984958 2:9207551-9207573 CGCCGCCGCCCGCCGCCGCCCGG + Intronic
928022453 2:27715495-27715517 AGGCGCGGCCGGAGGGCGCGGGG + Intronic
930075552 2:47403085-47403107 CGCCGTGGCCGGACGCCGCTCGG + Exonic
930634287 2:53787282-53787304 GGCCGCCGCCGGACGCCTCCAGG - Exonic
931671606 2:64653474-64653496 CGCCGCCGCGGGAGGGAGCCGGG - Intronic
932073515 2:68643618-68643640 CCCCGCCTCCGGTGGCCGTGAGG - Exonic
932112548 2:69013774-69013796 CTCCGCCGCCGCCTGCCGCGCGG - Intronic
934993244 2:98936059-98936081 CGACGCAGCAGGTGGCCGCGCGG + Exonic
935622817 2:105144075-105144097 CGCAGCTGCCGGGGGCCGGGAGG - Intergenic
935731064 2:106065460-106065482 CGCCGGCGGCGGGGGCCGCGTGG - Intronic
935918709 2:107986544-107986566 TGGCGCCGGCGGAGGGCGCGCGG - Exonic
936017799 2:108972786-108972808 CGCCCCTGCCGGAGGCCCCCCGG - Intronic
941095892 2:161239015-161239037 GGCCGGCGCTGGGGGCCGCGCGG - Intergenic
942046519 2:172102301-172102323 CGCCGCCGCCGCCGCCCGCCGGG + Exonic
942241107 2:173964673-173964695 CGCCGCCGCCGGGGGGCGGGTGG - Intronic
942453542 2:176123016-176123038 CGCCGCTGCCGGGGGCTGGGAGG - Exonic
944273143 2:197805131-197805153 CGGCGCCGCCCGACGCGGCGGGG + Exonic
944515735 2:200510033-200510055 CGCGGCCGCCGGACGCCGCGGGG + Exonic
944675846 2:202033872-202033894 CGCCGCCGCCGCCGCCCGCCGGG - Intergenic
944743682 2:202635412-202635434 CGCCGCCGCCGCCGCCTGCGGGG - Exonic
946250145 2:218406576-218406598 TGCCGGCGCCTGGGGCCGCGCGG - Intergenic
946354873 2:219178319-219178341 AGCCGCCGCCCGAGCCCGCGAGG - Exonic
946767346 2:223052899-223052921 CGCTGCCGCCGCCGGCCGCACGG - Exonic
948824651 2:240568408-240568430 CGCCCCCGGCGGCGGCCGAGCGG + Intronic
948874630 2:240820086-240820108 CGCGGGCGCGGGAGGCCGGGCGG + Intronic
1168795831 20:609763-609785 GGCCGCCGTCGGCGGCGGCGGGG + Exonic
1169220600 20:3820261-3820283 TGCCGACCCCGGCGGCCGCGAGG - Intergenic
1169438056 20:5610951-5610973 CGACGCCGCGGCAGGCCGCCTGG - Exonic
1172146658 20:32762442-32762464 CTCCGCGGCCGCAGCCCGCGTGG + Exonic
1172474528 20:35226884-35226906 CGCCGCCGCCGCCGCCCGCGCGG - Exonic
1173454158 20:43189991-43190013 CGCCGCCGCCGCCGCCCGCCCGG + Intergenic
1173681615 20:44886014-44886036 CCTCGCCGCCGGCGGCCGCGCGG - Intronic
1175847025 20:62064841-62064863 CCCGGCCGCCGGGGGCCCCGCGG - Exonic
1175944336 20:62551684-62551706 CAGCGCCGCGGGAGGCCACGCGG - Intronic
1175962024 20:62642205-62642227 CGACGCCGCCCCAGGCCACGCGG - Exonic
1176029997 20:63007195-63007217 CGCCGCCTCCGGCCGCCCCGGGG + Intergenic
1176194565 20:63831284-63831306 CGCGGGCGGCGGGGGCCGCGGGG - Intergenic
1176242978 20:64083610-64083632 CGCCGCAGCTGAAGCCCGCGCGG - Exonic
1176550059 21:8217092-8217114 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1176568986 21:8400127-8400149 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1176576900 21:8444362-8444384 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1178498898 21:33109848-33109870 CGGGGCCGGCGGAGGCTGCGGGG - Intergenic
1178914675 21:36699670-36699692 CCCCGCCGCCGCAGCCCGAGCGG + Exonic
1179480229 21:41672262-41672284 GGCCACTGCCAGAGGCCGCGCGG + Intergenic
1179561595 21:42219239-42219261 CGCCGCCGCCGCCGCCCCCGGGG + Exonic
1180615008 22:17121050-17121072 CGCCGCCCCCGGCAGCCGCCCGG - Exonic
1180650008 22:17369674-17369696 CGCCCCCGCCGAGGACCGCGCGG + Exonic
1180960842 22:19761567-19761589 CGCAGCCCCAGGACGCCGCGCGG + Intronic
1182237011 22:28883833-28883855 CGGCTGCACCGGAGGCCGCGGGG - Exonic
1183683765 22:39350200-39350222 CGCCGCCGCCGGGGGCCCGTTGG - Intronic
1183744731 22:39685923-39685945 CGCCGCCGCCTGAGCCTGCGCGG + Exonic
1183856188 22:40636589-40636611 CGCCGCCAGCGGAGGGCGTGTGG + Exonic
1184620320 22:45671873-45671895 CGCCGCCGCCGGAGAGCTCTAGG - Exonic
1184787704 22:46679900-46679922 CCCCGCCGCCGGCAGCCGTGGGG - Intergenic
1185055238 22:48575792-48575814 CGCCGCCGCCGGGGTCCGCGCGG - Intronic
1185254934 22:49826997-49827019 CCCGGCCGCCGCAGGCCGCGCGG + Intronic
1185317624 22:50185854-50185876 CGAGGGCGCCGGCGGCCGCGTGG - Intergenic
1203254949 22_KI270733v1_random:133418-133440 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1203263005 22_KI270733v1_random:178497-178519 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
950043112 3:9932951-9932973 AGCGGCCGCCAGGGGCCGCGCGG + Exonic
950590474 3:13933052-13933074 CGGCGCCGCCGGAAGTCGCGTGG - Intergenic
951710065 3:25577881-25577903 CGCCTCCCCAGGATGCCGCGTGG - Intronic
953031206 3:39180991-39181013 CCCCGCCCCCGGAGCCCGCAGGG - Intergenic
953705341 3:45226242-45226264 CCCCGGCGCCGGGGGCGGCGGGG - Exonic
954779069 3:53046016-53046038 CGCCTCCGCCGGAGCGCGGGTGG - Exonic
955368736 3:58332951-58332973 CGCCGCCGCCTAGGGACGCGAGG - Exonic
955818796 3:62874852-62874874 CGCCGGCGCCGGAGCCGGGGTGG - Exonic
956678117 3:71753979-71754001 CGCCGCTCCCGCAGGCCGCCCGG - Intronic
959530736 3:107431544-107431566 CGCCGCCGCCGGGGCTCGGGCGG + Intergenic
961222592 3:125212386-125212408 GGCGGCCTGCGGAGGCCGCGGGG - Intronic
961545296 3:127629139-127629161 CGCCGCCGCCGCCGCCCGCGCGG + Intergenic
962520744 3:136195850-136195872 GGCCGCCGCCGGCGGGCGGGAGG + Intronic
963117031 3:141738703-141738725 GGCCGCCGCCTGGGGCTGCGGGG + Intronic
964570789 3:158105835-158105857 CGCCGCCTCCGCCGGCCGCCCGG + Exonic
966362832 3:179148533-179148555 CGCCGCCGCCGCCGCCCGCGGGG + Exonic
966787761 3:183636140-183636162 CGCCGCCGGGGGAGGCGGCTGGG + Intronic
966866185 3:184260252-184260274 CGCCGCCCCCCGAGGCCGCGCGG - Intronic
967858255 3:194134272-194134294 CGCCGCCGCCGGGTGCCACGTGG - Intergenic
969114092 4:4860442-4860464 CGCAGGCGCCGGAGGCCACCAGG - Intronic
969239166 4:5888107-5888129 CGGCGACGCAGGAGGCCTCGGGG + Intronic
969239710 4:5890344-5890366 TGCCGCTGCCGGAGGCTGAGCGG - Intronic
969379216 4:6783085-6783107 GGCCGCCGCCGGGGGCTCCGGGG + Intronic
969484563 4:7464952-7464974 CGCTGCAGCCTGAGGCCACGTGG + Intronic
972396518 4:38663730-38663752 CGCCGCCGCCCGAGCCCGGGGGG - Intergenic
975166713 4:71186586-71186608 AGCCCCCGGCGGAGGCGGCGCGG + Intergenic
975779056 4:77819919-77819941 CGCCGGCGGCCGCGGCCGCGGGG - Intergenic
975986174 4:80202899-80202921 CGCCGGGGCCGCAGGCGGCGCGG + Exonic
978361127 4:107931875-107931897 CTCCGCCGCCGGAGGAAGGGAGG - Exonic
983538023 4:168878334-168878356 GGCCGCCGGCGGCGGCTGCGAGG - Intronic
983904362 4:173168974-173168996 CGCTGCCGCCGGAGGGGGCCGGG - Intronic
984801818 4:183723023-183723045 CGCGGCCGGCGGGGGCCGCCAGG + Intergenic
985073655 4:186191801-186191823 CGCCCCGGCTGGCGGCCGCGGGG - Exonic
986315310 5:6583074-6583096 CGGCGCCGCCCTAGGCCGGGAGG - Intergenic
986733070 5:10649419-10649441 CGCCGCCCCCTGAAGCGGCGCGG + Exonic
994083211 5:95731173-95731195 CGCCGCCACCGGAGCTCCCGGGG + Exonic
997635019 5:135398692-135398714 CGAGGCCGCAGGAGGCCCCGCGG - Intronic
998339394 5:141403585-141403607 CGCCGCCATCCGAGGCCGTGAGG - Exonic
998342588 5:141431392-141431414 CGCCCCCGTCGGAGGCCGTAAGG - Exonic
998957641 5:147453734-147453756 AGCCGCCGCGGGAGCCCGGGAGG - Intronic
1002029331 5:176416419-176416441 CGCGGCCGCCGGACGCAGCGCGG - Exonic
1002058069 5:176610053-176610075 CGCCGCCGCCGCCGCCCGAGCGG + Exonic
1003314998 6:5004022-5004044 CCCCGCCAGCGGAGGCCGGGAGG - Exonic
1003942712 6:11044474-11044496 CGCCGCGCCAGGAGGGCGCGCGG + Intergenic
1005942536 6:30571507-30571529 AGCAGCCGCCGGAGCCCGAGTGG + Exonic
1006137144 6:31902038-31902060 CGCCGCCGCCGCCGCGCGCGCGG - Intronic
1006472654 6:34237327-34237349 CGCCGCCGCCGCGGGCCCCGGGG - Intronic
1007656743 6:43455328-43455350 CGCCGCCGCCGAACCCAGCGCGG - Intronic
1013273409 6:108561612-108561634 CGCCGCAGCCGGGGGCGGCTGGG + Exonic
1014230102 6:118893979-118894001 CGCCGCCGGCGGCCTCCGCGCGG + Intronic
1014632390 6:123803408-123803430 CACCGCCGCCTGCGGCCGCCTGG + Intergenic
1017671962 6:156777685-156777707 CGCCGCCGCTGCTGCCCGCGCGG - Intergenic
1019471994 7:1226011-1226033 CGGCGCCGCTGCAGCCCGCGTGG + Intergenic
1019475729 7:1243143-1243165 GGCCGTGGCCGGGGGCCGCGGGG - Intergenic
1019531111 7:1503972-1503994 CGCAGCCGCCGGGAGCCGCGAGG - Exonic
1019989564 7:4682274-4682296 CGCCGCCGCCGGAGGCCGCTCGG + Intergenic
1020099861 7:5388758-5388780 CGCCGGCGGGGGTGGCCGCGGGG + Exonic
1021890330 7:25180462-25180484 CGCCGCCGCTAGAGGGCGCCTGG - Intergenic
1023638566 7:42237048-42237070 CGTAGCCGCCCGCGGCCGCGCGG - Intronic
1025929411 7:65982197-65982219 CGCCGCAGACGGTGGCCGAGCGG - Exonic
1026360875 7:69599749-69599771 CGGCGCGGCCGGCGGCGGCGGGG + Exonic
1026732643 7:72925117-72925139 CGCAGCCGCCGGAGACATCGCGG - Intronic
1027111421 7:75442702-75442724 CGCAGCCGCCGGAGACATCGCGG + Intronic
1027283650 7:76627235-76627257 CGCAGCCGCCGGAGACATCGCGG + Exonic
1031043569 7:116862980-116863002 CGGCCCCGGCGGAGGCCCCGCGG - Intronic
1031966465 7:128031321-128031343 GGCCGCCGCCGGAGGGAGTGCGG + Intronic
1032306232 7:130734191-130734213 CGCTGCCGCCGCCGCCCGCGCGG + Intergenic
1033390729 7:140924846-140924868 CGCCGCGGGCGGAGGGCGCCTGG + Intergenic
1034128916 7:148698589-148698611 CGCCGCTGCCGGCGGCCCCGGGG - Intronic
1034522628 7:151632327-151632349 CGCCGCCGCCGCAGGTGGCGCGG + Intronic
1034578927 7:152025927-152025949 CGCCGCCGCCGCAGCTCTCGAGG - Intronic
1035022684 7:155808604-155808626 GGCCGCCAGCCGAGGCCGCGCGG - Intronic
1036723693 8:11200968-11200990 CGCCGCCGCCGCAGGTGGAGCGG - Exonic
1039554743 8:38467915-38467937 CTCCGGCGCCGGGGGCCGCTCGG + Intronic
1039949043 8:42153403-42153425 CGGCGGCGACGGAGGCCGCGGGG - Intronic
1040501378 8:48008338-48008360 CTCCGCCCCCGGCGGGCGCGGGG - Intergenic
1042532869 8:69833008-69833030 CGCCGCCGCCGCTGGGCCCGCGG + Exonic
1043388251 8:79768307-79768329 CGCCGCCGCCGCCGCCAGCGCGG - Intergenic
1043502892 8:80874110-80874132 TGCCTCCGCCGGTGGCCGCAGGG + Intronic
1044719757 8:95134008-95134030 CGCCGCCGCCCGCGGCCGTCGGG + Exonic
1049645514 8:143733999-143734021 CAGCGCCGCCGGAGACCGTGAGG + Intergenic
1049668387 8:143858949-143858971 CGCCGCCGCCGCCCGCCGCCAGG - Exonic
1049669633 8:143863752-143863774 CGCCGCCGCCGCCCGCCGCCAGG - Exonic
1049670043 8:143865345-143865367 CGCCGCCGCCGCCCGCCGCCAGG - Exonic
1049761369 8:144333223-144333245 GGGCGGCGCCGGAGGCCCCGCGG - Exonic
1049835554 8:144733454-144733476 GGCCGCTGCCGGAGGCCTCATGG - Intronic
1049996822 9:1042687-1042709 CGCAGCGGGAGGAGGCCGCGCGG - Intergenic
1050744152 9:8857774-8857796 CGCCGCCGCCGAAGCCCCCCTGG + Intronic
1051665073 9:19461347-19461369 CGCCGCCCCCAGGAGCCGCGGGG - Intergenic
1052888823 9:33676950-33676972 CGCCGCCGCCGCACCCCCCGTGG - Intergenic
1052903825 9:33817299-33817321 CGCAGGGGCCGGAGGGCGCGCGG - Intergenic
1053010305 9:34629060-34629082 CGCGGCCGCCGCAAGCAGCGCGG - Intergenic
1053114611 9:35490123-35490145 CGCCGCCGCCGCCGCCGGCGCGG + Intronic
1053153468 9:35757214-35757236 CCCCGCCGCCGGAGGGAGAGGGG + Exonic
1054407652 9:64774845-64774867 CGCCGCCGCCGCAGCCGCCGCGG - Intergenic
1055289858 9:74771090-74771112 CGCAGCCGCCTGAGGCCACATGG - Intronic
1055611782 9:78031594-78031616 CGCCGCCGCCGCCGCCTGCGAGG + Intergenic
1056475341 9:86947029-86947051 CGCCACCACCGGGGGCCGAGCGG - Exonic
1057192598 9:93095979-93096001 AGCCGACGCCGGAGGGGGCGGGG + Intergenic
1057466367 9:95317726-95317748 CGACGCCGCGGGAGCGCGCGGGG - Intergenic
1057533484 9:95875728-95875750 CGCCGCCGCCGGAGGAGGACAGG - Exonic
1057619154 9:96619576-96619598 GGCGGCCGCGGGAGGCAGCGGGG - Exonic
1060952328 9:127612206-127612228 CCCCGCCGCCGGCGCGCGCGGGG - Intergenic
1060952400 9:127612495-127612517 CGCTGCCGGCAGGGGCCGCGCGG - Intronic
1061348068 9:130042812-130042834 CGCCTCCTCCCCAGGCCGCGAGG + Intronic
1061348091 9:130042879-130042901 CGCCCCCTCCCCAGGCCGCGGGG + Intronic
1061559679 9:131394352-131394374 GGCCGCCGCCGGGGGCCCGGGGG + Intronic
1061559737 9:131394514-131394536 CGCCCGAGCCTGAGGCCGCGCGG - Intronic
1062043302 9:134414009-134414031 CGCTGGCGCCGGAGGCCGGGCGG - Intronic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062332241 9:136049889-136049911 CGCCGCCACCGCAGCCCCCGCGG + Exonic
1062372192 9:136245708-136245730 CGCCCCCGCCGCGGGCCGCACGG - Exonic
1062491673 9:136807974-136807996 CGGTCGCGCCGGAGGCCGCGGGG + Exonic
1062684441 9:137803027-137803049 CACCGCCCCCGGAGACTGCGTGG + Intronic
1203778541 EBV:87859-87881 CCCCGCGGCAGGAGGCCCCGCGG - Intergenic
1203778547 EBV:87874-87896 CCCCGCGGCAGGAGGCCCCGCGG - Intergenic
1203778553 EBV:87889-87911 CCCCGCGGCAGGAGGCCCCGCGG - Intergenic
1203778559 EBV:87904-87926 CCCCGCGGCAGGAGGCCCCGCGG - Intergenic
1203778565 EBV:87919-87941 CCCCGCGGCAGGAGGCCCCGCGG - Intergenic
1203471351 Un_GL000220v1:116564-116586 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1203479172 Un_GL000220v1:160536-160558 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1185778834 X:2828923-2828945 AGCCGGCGCTGGAGGCCCCGAGG - Exonic
1187225850 X:17375147-17375169 CCCGGGCGCAGGAGGCCGCGCGG - Intergenic
1187518158 X:19990960-19990982 CGCCGCCGCCGCCGGCCCCTCGG + Intergenic
1189002061 X:36957880-36957902 CGCTGCCGCCCGAGGACGCCAGG - Intergenic
1189446430 X:41085408-41085430 CGCCGCCGCCACTGGCCGAGCGG + Intergenic
1195954799 X:110317834-110317856 CGCCGCCGCCGCAGCCCTGGGGG + Exonic
1197774462 X:130110525-130110547 CGGCGGCCCCGGCGGCCGCGGGG - Intronic
1198767126 X:140091427-140091449 CGGCGGCGCCGGCGGCTGCGGGG + Intergenic