ID: 920373088

View in Genome Browser
Species Human (GRCh38)
Location 1:205492013-205492035
Sequence CAGGTTTCCCTGAAAGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920373088_920373096 9 Left 920373088 1:205492013-205492035 CCATCCCCTTTCAGGGAAACCTG No data
Right 920373096 1:205492045-205492067 TGCAGGCTGCCCCTTCCTGCAGG No data
920373088_920373093 -8 Left 920373088 1:205492013-205492035 CCATCCCCTTTCAGGGAAACCTG No data
Right 920373093 1:205492028-205492050 GAAACCTGCAGGCATCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920373088 Original CRISPR CAGGTTTCCCTGAAAGGGGA TGG (reversed) Intergenic
No off target data available for this crispr