ID: 920374872

View in Genome Browser
Species Human (GRCh38)
Location 1:205502865-205502887
Sequence TTACCCCTCCTGGAAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 123}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920374865_920374872 12 Left 920374865 1:205502830-205502852 CCATATTCTGTCACCCCTGCACT 0: 1
1: 0
2: 0
3: 24
4: 213
Right 920374872 1:205502865-205502887 TTACCCCTCCTGGAAAAAACAGG 0: 1
1: 0
2: 2
3: 10
4: 123
920374869_920374872 -2 Left 920374869 1:205502844-205502866 CCCTGCACTCTGCACAAGGGATT 0: 1
1: 0
2: 1
3: 12
4: 160
Right 920374872 1:205502865-205502887 TTACCCCTCCTGGAAAAAACAGG 0: 1
1: 0
2: 2
3: 10
4: 123
920374864_920374872 30 Left 920374864 1:205502812-205502834 CCTCATGGAACTGTGGGTCCATA 0: 1
1: 9
2: 435
3: 1322
4: 3964
Right 920374872 1:205502865-205502887 TTACCCCTCCTGGAAAAAACAGG 0: 1
1: 0
2: 2
3: 10
4: 123
920374870_920374872 -3 Left 920374870 1:205502845-205502867 CCTGCACTCTGCACAAGGGATTA 0: 1
1: 0
2: 0
3: 5
4: 92
Right 920374872 1:205502865-205502887 TTACCCCTCCTGGAAAAAACAGG 0: 1
1: 0
2: 2
3: 10
4: 123
920374868_920374872 -1 Left 920374868 1:205502843-205502865 CCCCTGCACTCTGCACAAGGGAT 0: 1
1: 0
2: 2
3: 23
4: 214
Right 920374872 1:205502865-205502887 TTACCCCTCCTGGAAAAAACAGG 0: 1
1: 0
2: 2
3: 10
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920374872 Original CRISPR TTACCCCTCCTGGAAAAAAC AGG Intergenic
902724921 1:18328997-18329019 TTCTCCCTGCTGGAAGAAACAGG - Intronic
905130239 1:35749569-35749591 TTGCCCCTCCTGTAAAAACTAGG - Intronic
905205376 1:36340287-36340309 TTTCCCCATCTGGAAAAAATGGG - Exonic
908323838 1:63004156-63004178 TTACCACTGCTGGGAAAACCAGG + Intergenic
919570924 1:199246244-199246266 TTACTCCACCTGGAGAAAAATGG + Intergenic
920374872 1:205502865-205502887 TTACCCCTCCTGGAAAAAACAGG + Intergenic
920532972 1:206717926-206717948 TTACCTCCCCTGCAAAAAAAAGG - Intronic
920706131 1:208251943-208251965 TTTCCCCACCTGTAAAAAGCAGG + Intergenic
1063571848 10:7222608-7222630 TTTCCCCACCTGTAAAAATCAGG - Intronic
1063672040 10:8106747-8106769 TTGCCCTTCCAGAAAAAAACTGG - Intergenic
1073854284 10:107656840-107656862 TGACCCTTCTTGGAAAAAAATGG - Intergenic
1075581190 10:123619869-123619891 TTATCCCTTCTGGAAAAAAAAGG + Intergenic
1077611944 11:3648768-3648790 TTACCCCTCCTCCAGAAAAGCGG - Intronic
1077827756 11:5829535-5829557 CTGCCTCTCCTGGAAAAGACAGG + Intronic
1078227746 11:9408178-9408200 TTAACTCTCCTGTAGAAAACAGG + Intronic
1080914924 11:36647644-36647666 TTATCCCTCCAGGAAAATATGGG + Intronic
1084096366 11:66914117-66914139 TTCTCCCTACTGGATAAAACAGG + Intronic
1089158908 11:116423140-116423162 TGACCCCTCCTGGCAACAGCTGG + Intergenic
1091994461 12:4982325-4982347 TTAAGCCTCCTGGGAAAAATTGG + Intergenic
1092293500 12:7180056-7180078 TTACCCCTCCTCCAAACAAGAGG + Intergenic
1092965279 12:13635313-13635335 TTTCCCTTCCTGTAGAAAACAGG - Intronic
1094662634 12:32485287-32485309 TAACCATTCCTGGAAAAAAATGG + Intronic
1096052361 12:48622305-48622327 TGGCTCTTCCTGGAAAAAACTGG - Intergenic
1096241524 12:49962442-49962464 TTACCCCACCTGGAAAAAAGGGG + Intronic
1097078715 12:56413652-56413674 TTCCCACTCCTGGCAAAAACTGG + Intergenic
1097083271 12:56448950-56448972 TGAGACCTCCTGAAAAAAACCGG - Intronic
1098717689 12:73852274-73852296 TTAACCCTACTATAAAAAACGGG - Intergenic
1103401976 12:120649369-120649391 TGCCCCCTGCTGGAAAAAGCTGG + Intronic
1104110261 12:125698009-125698031 TTTCCCCTCCTGTAAAATAAAGG - Intergenic
1104812721 12:131628404-131628426 TTGTCCTTCCTGGGAAAAACAGG + Intergenic
1107710383 13:43145241-43145263 TTTCCCCTTCTTAAAAAAACTGG - Intergenic
1110982383 13:81917300-81917322 TTGGCCATCCTGAAAAAAACGGG - Intergenic
1111998627 13:95189810-95189832 TTACCCATCCTGGGAAAATAGGG + Intronic
1112139608 13:96623903-96623925 TTTCCTATCATGGAAAAAACAGG - Intronic
1112302614 13:98243757-98243779 TTAACCCTGCTGGAAAAAAAGGG - Intronic
1112818822 13:103306758-103306780 TTACCCCCAGTGGAAACAACAGG - Intergenic
1121279058 14:92686911-92686933 TTTCCCCTCCTGGAAGAAATGGG + Intronic
1125046824 15:35251270-35251292 TTACCCCTCCTGCAACTAACTGG + Intronic
1125897780 15:43316995-43317017 TTACCCCTTCTGGAAACCACAGG - Intergenic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1131482298 15:92792583-92792605 TTACCTCTCCAGAAAAAGACAGG + Intronic
1137586253 16:49665460-49665482 AGAGCCCTCCTGGAAAAAGCAGG + Intronic
1140487570 16:75305834-75305856 CTCCACCTCCTGGAAAAAACAGG - Intronic
1141268470 16:82518233-82518255 TTATATCTCCTGGAGAAAACTGG - Intergenic
1143925854 17:10369631-10369653 TTAGTCCTCCTGGAAAAACAAGG + Intronic
1145193314 17:20866838-20866860 CAACCCCTCCTGGCAAAAGCTGG + Intronic
1149976120 17:61267943-61267965 TCACCCCTCCCCGAGAAAACTGG + Intronic
1151354735 17:73551577-73551599 TAACCCCTCCTGGACCAAGCAGG + Intronic
1153758021 18:8302810-8302832 TTATCCATCCTGGATAATACTGG - Intronic
1155626702 18:27843284-27843306 TTGACCCTCCTGGACAAATCTGG + Intergenic
1156111984 18:33739276-33739298 TTTCCCCTCCTGGAGAAGGCAGG - Exonic
1160033289 18:75280824-75280846 TCACCACTCCTGGAAGAATCTGG - Intronic
1167143802 19:47670562-47670584 TTGCCCCTCCAGGAATGAACAGG - Intronic
1167474764 19:49693424-49693446 TTTCCCCTCGTGGAAAACATGGG + Intronic
925156988 2:1656599-1656621 TGTCCCCTCCTGAATAAAACTGG + Intronic
926524123 2:13955171-13955193 TTACCCATCCTGCAAAGAATTGG + Intergenic
927154398 2:20213271-20213293 TTTCCCCCCCTGGCAAAACCCGG + Intronic
927217530 2:20676500-20676522 GTGGCCCTCCTGAAAAAAACAGG - Intergenic
931040602 2:58294505-58294527 TTACCCTTACTGTAAGAAACAGG - Intergenic
931246468 2:60496581-60496603 TTACCCCTTCTGGAAGAGCCTGG + Intronic
933695048 2:85211512-85211534 TTGCCCCTCCTGGAAGGCACAGG - Intronic
935391210 2:102554543-102554565 TTACCAAATCTGGAAAAAACTGG - Intergenic
937331815 2:121035575-121035597 TTGCCCCTCAGGGAAAATACAGG + Intergenic
938019411 2:127893692-127893714 ATAGCCCTCCTGGGAAATACCGG - Intergenic
938759357 2:134410046-134410068 TTAACTCTGCTGGAGAAAACTGG - Intronic
939986764 2:148836594-148836616 TTACCCTACCTGGCAAAACCAGG + Intergenic
945049343 2:205808367-205808389 CTACCCCTCAGGGAGAAAACAGG - Intergenic
945621717 2:212147795-212147817 TTAACCCTCCGTGAAGAAACTGG + Intronic
946767549 2:223054116-223054138 TTACCCCTTCTAGAAAGATCAGG - Exonic
1169654432 20:7907410-7907432 TTAACCCTGCTGGAAAATTCTGG - Intronic
1170322249 20:15112920-15112942 TTATCCAGCCTGGAAAAAAAAGG - Intronic
1171118150 20:22544817-22544839 TTATAGCTCCTGCAAAAAACTGG - Intergenic
1172624834 20:36340982-36341004 ATGCTCCTCCTGGAACAAACTGG + Intronic
1172856141 20:38004072-38004094 TTACCTCATCTGGAAAAAAAGGG + Intronic
1173256967 20:41400587-41400609 TTACCTCTTCTGGAAACCACAGG - Intergenic
1175036797 20:56006864-56006886 TTACCCCTACAGGAAATAAAAGG - Intergenic
1175730310 20:61349814-61349836 TTTCCCCTCCTGGAAAACTTAGG - Intronic
1176984891 21:15424343-15424365 ATACCCCTCCTGGAACCATCTGG - Intergenic
1179070330 21:38064910-38064932 TTACACCACCTAGAAAAAAATGG + Intronic
949713592 3:6900986-6901008 TAACCCCTCATTTAAAAAACTGG + Intronic
952915844 3:38240747-38240769 TTACTCCTACTGGCAAAATCTGG + Intronic
955873171 3:63461365-63461387 TTACGTTTCCTGGAAAGAACTGG - Intronic
958473401 3:94550150-94550172 TTACCATTCCTGAAAAAAAAAGG + Intergenic
958500350 3:94898588-94898610 ATTCCACTGCTGGAAAAAACAGG + Intergenic
959620796 3:108396876-108396898 TTCCCCCTACTGAAAAATACTGG - Intronic
959657676 3:108828327-108828349 TTACCCCTCCTCCAGAAAAAGGG + Intronic
962241444 3:133754275-133754297 TTACCCCTCCAGGCAAACAGGGG - Intronic
962481491 3:135802023-135802045 TTATCCCTCCTGGAAAAAAGAGG + Intergenic
963433498 3:145239894-145239916 GTACTCCTCCTGAAAAAAAAAGG - Intergenic
965191743 3:165539156-165539178 TTACCCTTCCTGGAACAAGATGG - Intergenic
966742578 3:183248110-183248132 TAAACCCTCTTGGGAAAAACAGG - Intronic
966851432 3:184167423-184167445 TTTCCCCTTCTGTAAAAAATGGG - Intronic
968474007 4:794706-794728 TTCTCCCTCCTGGAAAGGACTGG + Intronic
969986192 4:11213454-11213476 GTATCCCTCCTGGATAAGACTGG + Intergenic
971632640 4:29013728-29013750 TTTCCACTCTTGGAAAAAAAAGG + Intergenic
975192014 4:71475503-71475525 TTACACAGCCTGGGAAAAACTGG - Intronic
977194702 4:94044702-94044724 TTACTGTACCTGGAAAAAACAGG + Intergenic
980835901 4:138192236-138192258 TTGCCCCTCCTAGATAAAAGAGG - Intronic
984698336 4:182800920-182800942 TTTCCCTTCGGGGAAAAAACTGG + Exonic
987511366 5:18844596-18844618 TAACCTCACCTGGCAAAAACAGG - Intergenic
987796201 5:22630345-22630367 TTACCCCACTTGAACAAAACTGG + Intronic
992752776 5:79876115-79876137 TTACCACTCTTGGGAAAAAGTGG - Intergenic
992763684 5:79974659-79974681 TCCCCCCTCATGGAGAAAACTGG + Intergenic
993206380 5:84885602-84885624 TTCACCTTTCTGGAAAAAACAGG + Intergenic
995023201 5:107389717-107389739 ATACGCCTCCAGGAAAAAACTGG + Intronic
995805973 5:116052830-116052852 ATACCCCACCTGGAAACAAAAGG - Intronic
996203473 5:120702363-120702385 TTGCCCCTCCTGTAGAAAAGTGG + Intergenic
996915428 5:128706693-128706715 TTAGCTTTCCTGGAAATAACTGG - Intronic
997689237 5:135814471-135814493 TGACCCATCCTGGAAGAAGCAGG - Intergenic
998510423 5:142708958-142708980 TTACTCCTCCAGGGAAAAAAAGG + Intergenic
999320477 5:150611791-150611813 CTACCCCAACTGGAAAACACTGG + Intronic
1000366418 5:160495352-160495374 CTACCATTCCTCGAAAAAACTGG - Intergenic
1001007806 5:168069796-168069818 TTACACCTGCTGCCAAAAACAGG + Intronic
1001729312 5:173938194-173938216 TTAGTCCTCCTGGAAAAGTCAGG + Intronic
1002027436 5:176404988-176405010 TTAAACCTCCTGTATAAAACAGG + Intronic
1003655252 6:8001272-8001294 TTTCCCCACCTGTAAAATACGGG - Intronic
1003861827 6:10329452-10329474 TTGCACCTCCTGGCACAAACTGG + Intergenic
1007558890 6:42789288-42789310 TTCCCAATCCTGGAAAAAAATGG + Intronic
1007942147 6:45791483-45791505 TTAAGCAGCCTGGAAAAAACAGG - Intergenic
1016406283 6:143734453-143734475 TAACTCCCCCTGGAAAAGACGGG - Intronic
1022738596 7:33099584-33099606 TTACACCTGATTGAAAAAACAGG + Intronic
1026359720 7:69591895-69591917 CTACCGCTCCAGGAAAAAGCAGG - Intergenic
1029025910 7:97416927-97416949 TTACCCCTCCTGGATAATCCAGG + Intergenic
1036936377 8:13006188-13006210 TGATCCATCCTGGAGAAAACAGG - Exonic
1039537094 8:38326353-38326375 TTACCCCTGTTGGAAACAAATGG - Intronic
1039912779 8:41837964-41837986 TTACCCCTCCTCTAAAACTCAGG - Intronic
1042389221 8:68214005-68214027 TTACCCCACCTGGAAAATATAGG - Intronic
1048185017 8:132232006-132232028 TTAACTCTCCTGGAAATTACTGG - Intronic
1056413583 9:86354946-86354968 TTACTCCCCCTGGAAGTAACCGG - Intergenic
1056505773 9:87257081-87257103 ATGCCCCTCCTGGATACAACAGG + Intergenic
1060455347 9:123788109-123788131 TTGCCACTCTTAGAAAAAACAGG + Intronic
1062542401 9:137047446-137047468 CTTCCCATCCTGGAGAAAACTGG + Intergenic
1187665162 X:21599770-21599792 TTACCACTCTTGGGAAAGACTGG - Intronic
1190043415 X:47091171-47091193 GTGCCCCTCCTGCAAGAAACAGG + Intronic
1191876157 X:65798702-65798724 ATAACTCTCCTGGAAAAAGCAGG - Intergenic
1198027485 X:132721833-132721855 TTACCCTTCTTGCAAAAAAGAGG + Intronic