ID: 920376957

View in Genome Browser
Species Human (GRCh38)
Location 1:205513924-205513946
Sequence GCTGCTGTTGGGCCACATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 183}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920376950_920376957 -7 Left 920376950 1:205513908-205513930 CCTCAGCCCATCTCCCGCTGCTG 0: 1
1: 0
2: 6
3: 126
4: 512
Right 920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG 0: 1
1: 0
2: 0
3: 29
4: 183
920376946_920376957 2 Left 920376946 1:205513899-205513921 CCCCCACTGCCTCAGCCCATCTC 0: 1
1: 0
2: 3
3: 49
4: 612
Right 920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG 0: 1
1: 0
2: 0
3: 29
4: 183
920376947_920376957 1 Left 920376947 1:205513900-205513922 CCCCACTGCCTCAGCCCATCTCC 0: 1
1: 0
2: 3
3: 61
4: 576
Right 920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG 0: 1
1: 0
2: 0
3: 29
4: 183
920376949_920376957 -1 Left 920376949 1:205513902-205513924 CCACTGCCTCAGCCCATCTCCCG 0: 1
1: 0
2: 1
3: 40
4: 536
Right 920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG 0: 1
1: 0
2: 0
3: 29
4: 183
920376948_920376957 0 Left 920376948 1:205513901-205513923 CCCACTGCCTCAGCCCATCTCCC 0: 1
1: 0
2: 2
3: 66
4: 632
Right 920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG 0: 1
1: 0
2: 0
3: 29
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920376957 Original CRISPR GCTGCTGTTGGGCCACATGC TGG Intronic
900704494 1:4071856-4071878 GCTGCTGCTGAGCCACTTCCAGG + Intergenic
901056349 1:6450263-6450285 GCTGCTCTGGGGCCCCATGAGGG - Intronic
902447840 1:16478391-16478413 CCTGCTGCTGGGCCACCTGCAGG + Intergenic
902467740 1:16628604-16628626 CCTGCTGCTGGGCCACCTGCAGG + Intergenic
902477997 1:16698222-16698244 GCTGCTCTGGGGCCCCATGAGGG + Intergenic
902506840 1:16944124-16944146 CCTGCTGCTGGGCCACCTGCAGG - Exonic
902777162 1:18682406-18682428 CCAGCTGTTGGGCCCCATGGAGG + Intronic
902833697 1:19033865-19033887 GCTGATGCTGGGCCAGATCCTGG - Intergenic
904330472 1:29755121-29755143 GCTGCTGTTGGCCCTCAAGCAGG + Intergenic
906187207 1:43871178-43871200 CCTGCTGTTGTCCCACATGTAGG - Intronic
910748843 1:90605364-90605386 GCAGCTGTTTAGCAACATGCAGG - Intergenic
910784458 1:90980000-90980022 GTTGCTGTTGGGCCATAGGAAGG - Intronic
912331984 1:108828341-108828363 GCTGCAGGTGGGCCACAGGAAGG - Intronic
913327739 1:117641720-117641742 GCTGCTGTTGCTCCACTTGCAGG + Intergenic
916204509 1:162302260-162302282 GCTTCATTTGGGCCAGATGCAGG - Intronic
917526545 1:175793269-175793291 GGTGCTGTGGGGCCACATGAGGG + Intergenic
919847161 1:201649403-201649425 GCTGCTCTTCAGCCAGATGCTGG + Exonic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
920779212 1:208971689-208971711 GCTGCTGTTGCCCCACTTACAGG + Intergenic
922092927 1:222414704-222414726 GCTGAGGATGGGCCACAAGCAGG - Intergenic
922377358 1:224981826-224981848 GCTGGTGTTGGGATTCATGCAGG + Intronic
1063123881 10:3123717-3123739 GGTGCTGAGGGGCCACATCCTGG + Intronic
1063368640 10:5507142-5507164 GCTGCTGTCGGGCCAGAGGGAGG - Intergenic
1065765186 10:29022849-29022871 GCTGCTGCTGGGCCCCATTATGG - Intergenic
1066043674 10:31578392-31578414 GCTGCAGTTGGCTCACCTGCTGG - Intergenic
1067081019 10:43212216-43212238 GCTGTTGTTGGAACACATCCCGG + Intronic
1068940997 10:62681228-62681250 GTTGCTGCTGGGCCACCAGCAGG - Intergenic
1068982164 10:63073079-63073101 GCTGCTGTGGGGACACGGGCTGG + Intergenic
1069784984 10:70982036-70982058 GGTGCTGTTGGGCCTCACCCAGG + Intergenic
1071509487 10:86252225-86252247 GCTCTTCTTGGGCCACATCCCGG - Intronic
1073059707 10:100726140-100726162 GATCCTGATGGGCCACATGCAGG - Intergenic
1073363680 10:102919434-102919456 ACTGCTGCTGGGCAACGTGCTGG + Exonic
1076165883 10:128282189-128282211 GCTGCTCCTGGGCCACACGCCGG + Intergenic
1076716571 10:132367825-132367847 GCTGCTTTTCAGCCTCATGCTGG + Intronic
1077433746 11:2528411-2528433 GCTGCTGCTGGGACACCAGCAGG - Intronic
1078707675 11:13760726-13760748 CCTTCTCTTGGGTCACATGCAGG - Intergenic
1079774736 11:24510574-24510596 GCAGCTGTTTGCCCACTTGCTGG - Intronic
1080905780 11:36543394-36543416 GCTGCTGCCAGGCCACATGCCGG + Intronic
1083374510 11:62208737-62208759 GCTGCTGATGGTCCTCATGCTGG + Exonic
1083381229 11:62270222-62270244 GTTGCTGATGGTCCTCATGCTGG + Exonic
1083960829 11:66013962-66013984 GCCATCGTTGGGCCACATGCAGG - Intergenic
1084204468 11:67583890-67583912 GCTGCGGGTTGGCCCCATGCTGG - Intronic
1084554510 11:69867948-69867970 GCTGCTGGCGGAGCACATGCTGG - Intergenic
1089102566 11:115975806-115975828 GCTGCTGTTTCGCCACACGGCGG + Intergenic
1089696655 11:120220040-120220062 GCTGCTCTTGAGCCAGAGGCAGG + Intronic
1090657547 11:128857442-128857464 TCTACTGTGGGTCCACATGCTGG - Intronic
1092936250 12:13366961-13366983 GCTGCTGCTGGCCCACCTGTGGG - Intergenic
1094813264 12:34162333-34162355 GCAGCTGCTTGGCCAGATGCAGG - Intergenic
1096895879 12:54820237-54820259 GCTGCTGCTGGCCCACGTGTGGG - Intergenic
1105455847 13:20540471-20540493 GCTGCAGTTGGGCCAGATGATGG + Intergenic
1105947840 13:25204493-25204515 GCTGCTGTTGTCCAGCATGCAGG - Intergenic
1106006361 13:25773576-25773598 GCTGCTGGTGGGTCCCAAGCTGG - Intronic
1106782835 13:33076870-33076892 GCTGCTGCTGTTACACATGCTGG - Intergenic
1107069742 13:36256924-36256946 GCTGCTGCTGGCCCACCTGTGGG - Intronic
1107720869 13:43246720-43246742 ACTGTGGTTGGGCCACATGCAGG + Intronic
1112071825 13:95861306-95861328 GCTGCTGATGGGGCTCATCCAGG + Intronic
1113893779 13:113750045-113750067 GCTGATGGTGGGACACCTGCTGG + Intergenic
1114495480 14:23128699-23128721 GCTCCTTATGGGCCACATGTGGG + Intronic
1115110427 14:29814569-29814591 ACTGCAGTTGGAGCACATGCAGG - Intronic
1116635079 14:47384280-47384302 GTTGCTGCTGAGCCACATGAGGG + Intronic
1119309530 14:73634311-73634333 GCTCCTGTGGAGCCTCATGCCGG + Intergenic
1119674557 14:76544195-76544217 GCTGGAGATGGGGCACATGCAGG - Intergenic
1120968472 14:90187942-90187964 GGCACTGATGGGCCACATGCCGG + Intergenic
1121440013 14:93942620-93942642 CCTGCTGTTGGGCTAGATTCAGG - Intronic
1121713095 14:96053608-96053630 GCTGCTGTTGGGGCTCAGCCTGG - Intronic
1122913726 14:104846206-104846228 GCTGCTGGTGGGTGACAGGCAGG + Intergenic
1122980352 14:105189192-105189214 TCTGCTGTTGGGTTACATCCTGG - Intergenic
1125192290 15:37007493-37007515 GCTGCTCTTTGTTCACATGCCGG - Intronic
1126893695 15:53235265-53235287 TCAGCTGCTGGGCCACATGTTGG + Intergenic
1128107984 15:65058443-65058465 CCTGCTGCTGGGCAACAAGCTGG - Exonic
1129164264 15:73767415-73767437 CCAGCTGTTGGCCCTCATGCTGG + Intergenic
1129208919 15:74054194-74054216 GCTGCTCTGGTGCCACCTGCAGG - Intergenic
1129478231 15:75802253-75802275 GCTGCTCTGGTGCCACCTGCAGG + Intergenic
1129524381 15:76204579-76204601 GCTGAAGCTGGGCCACAGGCTGG - Exonic
1129836320 15:78709565-78709587 GCTGCTCTGGTGCCACCTGCAGG + Intronic
1131958694 15:97765475-97765497 GCTGGTGTTGGAGCAAATGCAGG - Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1133529875 16:6645326-6645348 GCTGCTGTTGAACCCCGTGCTGG + Intronic
1135424275 16:22324610-22324632 GCTGCCGCTGGACCACATCCGGG - Exonic
1137726282 16:50658892-50658914 GCTCCTGTTGCTCCACATGCTGG - Intergenic
1138180699 16:54938475-54938497 TCTGCTGTTAGGCCACAACCTGG - Intergenic
1142132374 16:88436941-88436963 GCTGCTGCGGGGGCACCTGCAGG + Exonic
1144422091 17:15107999-15108021 GATGCTGTTGGGTCAGAAGCAGG + Intergenic
1144960446 17:19041505-19041527 GCTGCTGTGTGGCCTCAGGCAGG - Intronic
1144974714 17:19133019-19133041 GCTGCTGTGTGGCCTCAGGCAGG + Intronic
1146656964 17:34640108-34640130 GCTGCTTCTGGGACACATGCTGG - Intergenic
1149655644 17:58308465-58308487 GCTGCTGGTGGGCAGCAAGCAGG + Intronic
1150007719 17:61479946-61479968 TCTGCAGTCGGGCCACACGCAGG - Exonic
1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG + Exonic
1150979300 17:70123774-70123796 TCTGCTGTTAGACCACATTCTGG + Intronic
1154009907 18:10565537-10565559 GGTGCTGTGGGGCCAAAGGCAGG - Intergenic
1155259005 18:24023365-24023387 GCCGCTGCTGAGCCACATGCAGG + Intronic
1156473695 18:37392998-37393020 GCTGGTGTCAGGCCCCATGCTGG - Intronic
1158570664 18:58594764-58594786 GCTGCTGTTGGACTGGATGCTGG - Intronic
1160621141 18:80171397-80171419 GCTGCTGTGGCGCCCCCTGCTGG - Exonic
1160710519 19:549091-549113 GCGGCTGTTGTTACACATGCGGG - Exonic
1161379928 19:3959512-3959534 GCTGTTGTTGGGCGGCAAGCTGG + Exonic
1161459613 19:4389046-4389068 GCTGCTGTTGAGCCACCACCAGG + Intronic
1162105183 19:8365995-8366017 GCTGCTGCTGGGCCACCTTGTGG - Exonic
1162622040 19:11851259-11851281 GATGCTGTCAGCCCACATGCAGG - Intronic
1167457053 19:49601780-49601802 CCTGCTTTTTGGCCAGATGCAGG - Exonic
1202712017 1_KI270714v1_random:24049-24071 GCTGCTCTGGGGCCCCATGAGGG + Intergenic
929123161 2:38500008-38500030 GCTGCTGGCGGATCACATGCCGG - Intergenic
931214090 2:60225578-60225600 GAGGCTGGTGGGCCACATGCAGG - Intergenic
932089972 2:68797686-68797708 GCTGCTGTGGGACAACATTCTGG - Intronic
932246316 2:70199663-70199685 GCTGCAGGTGGGACACATGAGGG - Intronic
938928555 2:136066160-136066182 GCAGCTGTTGGGGCAAAAGCGGG + Intergenic
942950379 2:181714346-181714368 GCTGCTGCTGGAGCACAAGCAGG + Intergenic
948412494 2:237774909-237774931 GCTGCTGTTACTCCACCTGCTGG + Intronic
1171200235 20:23234820-23234842 GCAGCTGTTGGGCCAGCTGAGGG + Intergenic
1172224687 20:33297464-33297486 GCTGCTGTGGGGCTGCATTCTGG + Intronic
1172606509 20:36217694-36217716 CCTGCTGCTGGGCCACATTCTGG + Intronic
1173808005 20:45938836-45938858 GCTGCTGTGTGGCACCATGCTGG + Intronic
1174837890 20:53875574-53875596 GCTGCTGTTCGGAGACCTGCAGG - Intergenic
1175133380 20:56806102-56806124 GCAGCAGTGGCGCCACATGCCGG + Intergenic
1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG + Exonic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1179504870 21:41833728-41833750 GGTGCTGTTAGGCCAGGTGCTGG - Intronic
1180078160 21:45473611-45473633 GCAGCTGATGGGCCACCTGAGGG - Intronic
1180090602 21:45531989-45532011 GCTGCTGCTGGGCCACTCGGTGG - Exonic
1180222286 21:46366641-46366663 GCTGCTCCTGGGCCTCCTGCAGG - Exonic
1180800309 22:18628595-18628617 GCTGCTGCTGGGCACCATGGAGG - Intergenic
1180851543 22:19024159-19024181 GCTGCTGCTGGGCACCATGGAGG - Intergenic
1180955912 22:19741123-19741145 GCTGCTTTTGAGCCACTGGCAGG + Intergenic
1181030960 22:20148763-20148785 GCTGCTGCTGGGCGCCCTGCTGG - Exonic
1181104299 22:20564463-20564485 GCTGCTGCAGCGCCACCTGCTGG - Exonic
1181221407 22:21366671-21366693 GCTGCTGCTGGGCACCATGGAGG + Intergenic
1181512361 22:23394630-23394652 GCTGCTGCTGGGCACCCTGCTGG + Intergenic
1181939495 22:26464303-26464325 GCTGCTCTTGGGCTCCATGCTGG + Exonic
1183784374 22:40021155-40021177 GCTCCTTGTGGGCCACACGCTGG - Intronic
1185041779 22:48507891-48507913 GCTGCAGATGGGCCTCGTGCTGG - Intronic
952906388 3:38141721-38141743 GCTGTTGCTGGACTACATGCTGG + Exonic
953257365 3:41304881-41304903 CCTGCAGCTGGGCCAAATGCAGG - Intronic
953457336 3:43053622-43053644 GCTGCGGCTGGTCCACATCCTGG + Exonic
953985538 3:47439637-47439659 GCTGCTGCTGGGACATATCCTGG + Intronic
954604055 3:51895082-51895104 TCTGCGGATGCGCCACATGCGGG + Exonic
955341768 3:58130525-58130547 GCAGATGTTGTGCCACGTGCTGG - Intronic
957648866 3:82972226-82972248 GCTGTTGTTGGTACACAAGCAGG - Intergenic
960971166 3:123141243-123141265 GGTGCTGTTAGGCCAGCTGCTGG - Intronic
961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG + Intronic
963075817 3:141345380-141345402 GCTGATGTTGGACTACATGCTGG + Intronic
968794075 4:2690308-2690330 CCTGCTGTTCTGGCACATGCAGG - Intronic
969283985 4:6190998-6191020 GCTGCTGTTTGTCCCCATCCTGG - Intronic
969543762 4:7810736-7810758 GCTGTTGCTTGCCCACATGCGGG - Intronic
973815231 4:54613279-54613301 TTTCCTGTTGGGCTACATGCTGG - Intergenic
975986195 4:80203001-80203023 GCTGGTGCTGGGCCAGAAGCTGG + Exonic
977394836 4:96457591-96457613 TCTTCTGTTGGGTAACATGCAGG - Intergenic
977404786 4:96583007-96583029 GGTGATGTGGGGCCACATGTGGG + Intergenic
979582788 4:122379622-122379644 GCTGCTGCTGCGCCTCAGGCCGG - Intronic
982030369 4:151294551-151294573 GCATCTGTTGGGTAACATGCTGG - Intronic
984474288 4:180216576-180216598 GCTGCTGCTGGCCCACATGTGGG - Intergenic
984512978 4:180701558-180701580 GCTCCTGTTGGGCCACCAGCTGG - Intergenic
985744665 5:1639207-1639229 GCTGCTGTGGGGCTCCATGGAGG + Intergenic
986670802 5:10140862-10140884 GCTGCTGTTGGCCCCCTTCCAGG - Intergenic
987412140 5:17625402-17625424 GCTGCTTTTGGACCCCATGAGGG + Intergenic
992888624 5:81183751-81183773 GCTCCTGTGGGGCCCCAAGCTGG + Intronic
996016793 5:118547954-118547976 GCTACTGTAGGGCCACATTCAGG - Intergenic
997969491 5:138389110-138389132 GCTGCTGTTGCTTCACAGGCAGG - Intronic
999486457 5:152001906-152001928 GCTGCTGTTGGCCCTCATACAGG - Intergenic
1001844558 5:174910392-174910414 GCTGCTCTAGTGCCACCTGCAGG - Intergenic
1002467409 5:179414466-179414488 CCTGCTGTCGGGCCACAGGCAGG + Intergenic
1002770013 6:282526-282548 GCTGCTGCTGGGACACTTGAGGG + Intergenic
1005896878 6:30186071-30186093 GCTGGTGTTGGCCCAGATGCCGG + Exonic
1005992764 6:30913851-30913873 GCTGCTGCTGGCCCACGCGCGGG + Exonic
1006614965 6:35319948-35319970 GCTGCTGCTGGGCCTGCTGCAGG - Exonic
1007079062 6:39085985-39086007 GCTGCTGGTGGGACACTTGAGGG - Exonic
1011833773 6:91404719-91404741 TCTGCTGTTTGGCCTCCTGCTGG - Intergenic
1012925980 6:105268265-105268287 GCTCCTGTTGGTCCACATTCTGG - Intergenic
1013115710 6:107102376-107102398 CCTGCTGTAGGGTCACATGGTGG - Intronic
1013512692 6:110858965-110858987 GCTGCAGATGGGCTACACGCAGG + Intronic
1015099902 6:129464723-129464745 GCTGCTGTATGGCTCCATGCTGG - Intronic
1016986033 6:149896590-149896612 GCTGCTGTGGGGACACCAGCGGG + Intronic
1017885069 6:158592164-158592186 GCAGCTGCTGGGCCCTATGCTGG - Intronic
1019490768 7:1312231-1312253 GCTCCCGGGGGGCCACATGCCGG + Intergenic
1019527348 7:1486735-1486757 GCAGCTGCTGGGCCGCCTGCAGG - Exonic
1019614738 7:1954100-1954122 GGTTCTGATGGGCCACATGCGGG - Intronic
1020077070 7:5265223-5265245 GCTGCTCTTGGGCAAGATGTGGG - Intergenic
1020107621 7:5429420-5429442 GAGGCTGCTGGGCCACATTCCGG + Intergenic
1020113335 7:5460594-5460616 GCTGGTGTCGTGGCACATGCCGG - Intronic
1020287864 7:6699441-6699463 GCTGCTGATGGGACACACGGTGG + Intronic
1023124151 7:36938337-36938359 CCTGCTGTTGAACCACATGTGGG + Intronic
1023872994 7:44272737-44272759 GCTGCAGTAGGGCCACTTCCAGG + Intronic
1024043936 7:45574882-45574904 GCTGCAGCTGGGGCACCTGCAGG - Exonic
1029852755 7:103481892-103481914 GCTGCTTTTGGACAACTTGCTGG - Intronic
1030994459 7:116341635-116341657 GCTAGTGTTGGACAACATGCAGG - Intronic
1033553971 7:142471898-142471920 GCTGCTGTTGGCCAACATTTGGG + Intergenic
1035599951 8:891510-891532 GCAGCTGCTGGGCCACAGGATGG + Intergenic
1035616351 8:1004912-1004934 GCTGCTGTCCGGCACCATGCAGG + Intergenic
1040284990 8:46094976-46094998 GCAGCTGTGGGGACACAGGCGGG + Intergenic
1040319761 8:46286646-46286668 GCAGCAGTGGGGCCACATGTGGG - Intergenic
1040444115 8:47476425-47476447 GCTGCTTATTGGCCGCATGCTGG - Intronic
1040981559 8:53250957-53250979 GCTGCTGTTGGGGGGCAGGCAGG + Exonic
1044441717 8:92231189-92231211 CCTGCACTTGGGCCACAGGCCGG - Intergenic
1048533701 8:135273537-135273559 GCTGCGGTTGGGGCACAGGTAGG - Intergenic
1049089721 8:140505607-140505629 GCTGCTGAAGGGCTCCATGCGGG + Intergenic
1049566590 8:143343433-143343455 GCTGCTGGTGACCCACGTGCTGG + Intronic
1049671178 8:143870532-143870554 GCAGCTGTTGGACCAAGTGCTGG - Exonic
1049791820 8:144475739-144475761 GCCGCTGCAGGGCCCCATGCGGG + Exonic
1049803241 8:144527738-144527760 GCTGCGGTTGGGTCTCAGGCGGG + Exonic
1053062633 9:35043953-35043975 GATGCTGGTGGGACACATTCAGG - Exonic
1056618681 9:88191624-88191646 GCTGCCTTTGAGCCACCTGCTGG + Intergenic
1056663362 9:88560861-88560883 GCTGCTGTGGGGTCAGATTCTGG - Intronic
1057498507 9:95578607-95578629 CCTGCTGTTGTTCCCCATGCTGG + Intergenic
1057932018 9:99201867-99201889 TCTGCTGTTGGCCAACATCCAGG - Intergenic
1060483984 9:124035591-124035613 GCTGCTGTTGGGCCAGGGGTGGG + Intergenic
1062462483 9:136667718-136667740 GCAGCTGCTGGCCCACCTGCTGG + Intronic
1062575436 9:137205099-137205121 GATGCTGTTGTGCCAGAAGCTGG - Exonic
1185862060 X:3588963-3588985 GATGCAGTTGGGCCCCAGGCTGG - Intergenic
1190681590 X:52831005-52831027 GCTGCTGTTTGGGCAGCTGCAGG - Intergenic
1192451928 X:71250094-71250116 GCTGCTGCTGGGCCTCATACAGG + Exonic
1199045583 X:143167446-143167468 GCAGGTGTTGGGCCAGAAGCAGG + Intergenic
1199082767 X:143595108-143595130 GCTGCTGTTGGGTAGTATGCTGG - Intergenic
1199264929 X:145818370-145818392 GCGGCTGTAGGTCCGCATGCCGG + Exonic