ID: 920377213

View in Genome Browser
Species Human (GRCh38)
Location 1:205515536-205515558
Sequence TCTAGGACGCTGATGGCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 84}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920377213 Original CRISPR TCTAGGACGCTGATGGCAGT TGG Intronic
903333876 1:22612287-22612309 TCTAGGATTCTCATGGCAGCAGG + Intergenic
905881235 1:41465370-41465392 TCTAGTCTGCTGATGGAAGTTGG - Intergenic
908134150 1:61112663-61112685 TCTAGGAAGCTAATGGCAATTGG - Intronic
912143284 1:106758246-106758268 TCTAGGCCGATTATGACAGTGGG - Intergenic
912713208 1:111964271-111964293 GCTGGGACGCTGAGAGCAGTAGG + Intronic
918469692 1:184859421-184859443 TCTACCACAATGATGGCAGTGGG + Intronic
920122696 1:203670641-203670663 ACTAGGATGCTGATGATAGTTGG + Intronic
920377213 1:205515536-205515558 TCTAGGACGCTGATGGCAGTTGG + Intronic
1063430988 10:5988083-5988105 CTTAGGAGGATGATGGCAGTAGG - Intergenic
1084500914 11:69534623-69534645 TCTAGGGAGCTCATGGAAGTGGG - Intergenic
1084753570 11:71220694-71220716 TCTAGGAACCTCATGGGAGTGGG - Intronic
1087307253 11:96501663-96501685 TCCAAGGCGGTGATGGCAGTGGG - Intronic
1090284037 11:125483531-125483553 TCTAGAATGCTAATGGCACTTGG - Intronic
1106106908 13:26741372-26741394 TCTAAGACCCTGATGGTGGTAGG - Intergenic
1112816712 13:103281477-103281499 ACTAGGACGCTGATTGCAGATGG - Intergenic
1130298327 15:82662708-82662730 TCTTGGATGCTGATGCCAGCAGG + Exonic
1134970878 16:18529870-18529892 TCTGGGAGGCTGACGGCAGTTGG + Intronic
1136655848 16:31708749-31708771 TCTGGGAGCCTGATGGCAGGTGG - Intergenic
1141135780 16:81464253-81464275 TCTAGGAAGGTGCTGGCACTAGG - Intronic
1141587075 16:85041407-85041429 TCCAGGAGGCAGATGCCAGTAGG - Intronic
1141935867 16:87237275-87237297 TCTAGCACTCTGAAGGAAGTGGG + Intronic
1143054630 17:4153654-4153676 TGGAGGAGGGTGATGGCAGTGGG + Intronic
1144586230 17:16489601-16489623 TCTAGGACCCTGAGGCCATTTGG - Intronic
1146079780 17:29768758-29768780 TCTAGGACACTGATGGTATTAGG - Intronic
1146229386 17:31095003-31095025 TCTCGGACTGTGATGGCTGTGGG + Exonic
1149062057 17:52434231-52434253 TCTTGGACTCTGTTGGCACTGGG - Intergenic
1155317778 18:24589645-24589667 TCTAGGAAGCTAAGGGCAGATGG + Intergenic
1157303701 18:46500484-46500506 TGCAGCACGATGATGGCAGTGGG - Intronic
933918429 2:87019870-87019892 TCTAGGACTCATATGGCAATAGG + Intronic
934004567 2:87750043-87750065 TCTAGGACTCATATGGCAATAGG - Intronic
935318260 2:101859341-101859363 ACTAGAATGCTGAGGGCAGTAGG + Intronic
935767521 2:106384065-106384087 TCTAGGACTCATATGGCAATAGG - Intergenic
936639108 2:114292665-114292687 TCCAGGACGGTGATGTCAGAAGG - Intergenic
937955773 2:127421082-127421104 CCCAGGAAGCAGATGGCAGTTGG - Intronic
944146619 2:196513932-196513954 GCCATGACGCTGGTGGCAGTGGG + Intronic
947207513 2:227675353-227675375 TATAGGAGGCTGAAGGCAGTTGG + Intergenic
947518170 2:230824790-230824812 TCCAGGACGCTCAGGGCATTTGG - Intergenic
947873459 2:233452805-233452827 TCTGGGCAGCTGGTGGCAGTTGG + Intronic
948453405 2:238092740-238092762 TCTAGAGCGCTGGTGGCATTGGG - Intronic
1175887418 20:62300342-62300364 AATTGGTCGCTGATGGCAGTTGG - Intergenic
1179146880 21:38775799-38775821 TCTAGGAATCTAATGGCACTCGG - Intergenic
1181929297 22:26386983-26387005 TTTAGGAGGCTGAGGCCAGTGGG - Intergenic
1183321675 22:37168764-37168786 ACTAGGTGGCTGAAGGCAGTTGG + Intronic
1184024054 22:41840861-41840883 ACAAGGAGGCTGATGGCAGGGGG - Intronic
1185097436 22:48819135-48819157 TCTATGACACTGAGGGCCGTTGG + Intronic
949637323 3:5997159-5997181 TCTAGGAAGCTGAGGGCATTCGG - Intergenic
951117230 3:18879086-18879108 TCAAGGATGATGATGGCAGGAGG - Intergenic
953764741 3:45729622-45729644 TCTTGGAGGCTGAAGACAGTGGG - Intronic
954869793 3:53759068-53759090 TCTAGGAAGCAGAAGGCAGGTGG - Intronic
956702284 3:71968895-71968917 TCTTGGAGGCTGGGGGCAGTAGG - Intergenic
957199650 3:77116192-77116214 TCCTGGACAGTGATGGCAGTTGG + Intronic
957228219 3:77476242-77476264 TATAGGACACGGAAGGCAGTTGG + Intronic
959037449 3:101383799-101383821 GATAGGAGGTTGATGGCAGTGGG + Intronic
959289840 3:104459778-104459800 TTCAGGAGGCTGATGGCAGTTGG - Intergenic
964993194 3:162841673-162841695 TGTAGGACACTGATGGCTGATGG + Intergenic
965593343 3:170382960-170382982 TTTGGGAGGCTGATGGCAGGTGG - Intronic
965821896 3:172692605-172692627 TCTAGGAGGCTGAGGCAAGTGGG - Intronic
972714758 4:41634477-41634499 CCAAGGACCCTGATGGCAGTGGG + Intronic
974139263 4:57863606-57863628 TCTAGGAAGCTGATTTAAGTGGG + Intergenic
982641687 4:157969536-157969558 CCAAGAAGGCTGATGGCAGTGGG - Intergenic
985316996 4:188668586-188668608 TTTGGGAGGCTGAGGGCAGTAGG - Intergenic
988706222 5:33728372-33728394 TCCAGGACACTGTTGGCTGTGGG + Intronic
989026211 5:37071439-37071461 ACTAGGAGGATGATGGCAGTAGG + Intergenic
992745489 5:79816223-79816245 TCTTGCAAGGTGATGGCAGTAGG + Intergenic
993884857 5:93404009-93404031 TCCGGGACACTTATGGCAGTTGG + Intergenic
1000378078 5:160602791-160602813 TTTAGGACTCTGCTGGCCGTAGG - Intronic
1004813851 6:19290943-19290965 TCTAGGTCGCTGATGACACATGG - Intergenic
1006008078 6:31019077-31019099 TCCAGGAGACTGTTGGCAGTTGG - Intronic
1010329725 6:74609071-74609093 TGCAGGACCCTGGTGGCAGTTGG + Intergenic
1016393572 6:143598992-143599014 TTTAGAACAATGATGGCAGTGGG + Intronic
1018128360 6:160704191-160704213 TCTAGGACTCATATGGCAATAGG - Intronic
1018873977 6:167804046-167804068 GTTATGACGCAGATGGCAGTGGG - Intergenic
1027517895 7:79165338-79165360 TCTAGGGCTTTGATTGCAGTGGG - Intronic
1031985758 7:128163745-128163767 TATATGACGCTGATGGCAATGGG - Intergenic
1037473963 8:19237954-19237976 CCTAGGACGCTGACAGCAGGCGG - Intergenic
1037645146 8:20786438-20786460 TCTGGGATGATGGTGGCAGTTGG - Intergenic
1038559277 8:28556990-28557012 TCTAGGAGAATGGTGGCAGTGGG + Intronic
1039772671 8:40703561-40703583 TCTAGGAATCAGAGGGCAGTGGG + Intronic
1049806825 8:144544861-144544883 TCTAGGTCACGGATGGCAGAAGG + Intronic
1050190475 9:3019896-3019918 TCTAGAAGCCTGAGGGCAGTGGG + Intergenic
1051084683 9:13334628-13334650 TCTAGGAAGCTGGGGGCAGCTGG - Intergenic
1058105767 9:100969966-100969988 TCTAGGACCCTGTTGCCAATTGG + Intergenic
1062516235 9:136937984-136938006 TTTGTGACCCTGATGGCAGTGGG - Intronic
1185577008 X:1182496-1182518 TCTATGACCCTGCTGGAAGTGGG - Intergenic
1187459683 X:19475632-19475654 TCTAGGAAGCTGTTTGCAGATGG - Intronic
1197972000 X:132124297-132124319 TCTAGAATGATGATGGGAGTGGG - Intronic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic