ID: 920377289

View in Genome Browser
Species Human (GRCh38)
Location 1:205516000-205516022
Sequence AACCTTGCCCTGCCCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 6, 3: 53, 4: 376}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920377289_920377296 25 Left 920377289 1:205516000-205516022 CCAGGCTGGGGCAGGGCAAGGTT 0: 1
1: 0
2: 6
3: 53
4: 376
Right 920377296 1:205516048-205516070 GCTGACGCCGCCACAGCTCCAGG 0: 1
1: 0
2: 0
3: 18
4: 176
920377289_920377292 -6 Left 920377289 1:205516000-205516022 CCAGGCTGGGGCAGGGCAAGGTT 0: 1
1: 0
2: 6
3: 53
4: 376
Right 920377292 1:205516017-205516039 AAGGTTGTGAGGAGGCCCCAAGG 0: 1
1: 0
2: 0
3: 22
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920377289 Original CRISPR AACCTTGCCCTGCCCCAGCC TGG (reversed) Intronic
900000287 1:11057-11079 ACCCTCCCCCCGCCCCAGCCCGG - Intergenic
900229494 1:1549231-1549253 CACCGTGCCCGGCCCCAGGCTGG - Intronic
900523322 1:3116543-3116565 GACCAGGCACTGCCCCAGCCGGG - Intronic
900774255 1:4570298-4570320 AATCTTGCCCGCCCCCACCCCGG + Intergenic
901212395 1:7534042-7534064 AACCCTGCCCTTGCCCAGCCTGG + Intronic
901390028 1:8939245-8939267 AACCTTGCCTTGCCACATTCTGG + Intergenic
901530463 1:9849482-9849504 ACCCCTGACCTACCCCAGCCAGG - Exonic
901652990 1:10753681-10753703 GAACTTGCCCTGCTCTAGCCTGG - Intronic
902213902 1:14923117-14923139 AACCTTACCCTGCCCAGGCTTGG - Intronic
902385158 1:16072227-16072249 TACCTTCCCCTTCCCCAGCCGGG + Intronic
902392553 1:16114999-16115021 AACTTTGGCCTCCCCCGGCCCGG + Intergenic
903335666 1:22622631-22622653 ATCCTGGCCCTGCCCCTTCCTGG - Intergenic
903383196 1:22910586-22910608 ACCCTGGCCCTGCCCCAGCCAGG + Intronic
903885084 1:26536404-26536426 ATCCTTGCCCTGCCCCACTCTGG - Intronic
904145803 1:28390499-28390521 CACCATGCCCTGCCCCAGCCTGG - Intronic
904528832 1:31155073-31155095 AGCCTCGCCCTGCCCCGCCCAGG - Intergenic
905141178 1:35846064-35846086 AACATTCCCATGCCCCTGCCTGG - Intronic
905293345 1:36938426-36938448 AACCTTGACCTGCTACTGCCGGG + Intronic
905394107 1:37656212-37656234 CACCATGCCCAGCCCCTGCCTGG - Intergenic
906703443 1:47876657-47876679 AAACTTCCCCTGGCCCAGCCGGG + Intronic
907020129 1:51059265-51059287 AACTTTGCTCTGCCCCAGAGTGG - Intergenic
907162062 1:52378056-52378078 CACCGCGCCCCGCCCCAGCCCGG - Intronic
907571324 1:55486633-55486655 AGGTTTCCCCTGCCCCAGCCTGG - Intergenic
910776804 1:90885014-90885036 AGCCTTGCTCTGGCCCATCCAGG - Intergenic
911054958 1:93701405-93701427 ATCAATGCCCTCCCCCAGCCTGG - Intronic
912796245 1:112695339-112695361 AGACTTGCCCTGCCCCAGCCTGG + Intronic
913233724 1:116762990-116763012 AGGCCTGCCCTGCCCCACCCCGG + Intronic
913996637 1:143656060-143656082 AACCTTCCCCTGCCCACCCCAGG - Intergenic
915903456 1:159862333-159862355 ACCCTTGCCCTGCTGCAGCCGGG - Intronic
917276662 1:173338540-173338562 AACCTTGCCCTAGCCCTGCAAGG - Intergenic
919761578 1:201101531-201101553 CACCCGGCCCTGCCCCAGCCGGG - Intronic
920377289 1:205516000-205516022 AACCTTGCCCTGCCCCAGCCTGG - Intronic
922621037 1:226988358-226988380 AACCCAGGCCAGCCCCAGCCAGG + Intergenic
922801239 1:228365657-228365679 GTCCCAGCCCTGCCCCAGCCTGG + Intronic
924700183 1:246443578-246443600 AACCCTCCCTTGCCCCAGACTGG - Intronic
1062951240 10:1505578-1505600 AGCCTCACCATGCCCCAGCCAGG + Intronic
1063310588 10:4948467-4948489 GAAATTGCCCTGCCCCAGCTTGG - Intronic
1064265941 10:13825560-13825582 ATCCTTGCCCCTCCCCACCCTGG + Intronic
1064544430 10:16436824-16436846 ACCCTTGCCACGCCCCACCCTGG - Intergenic
1065186517 10:23174573-23174595 CACCCTGCCCTCCCCCAGCCCGG - Intergenic
1066307221 10:34157192-34157214 AACCTTGCCTTGTCCAAGCCAGG - Intronic
1066961392 10:42230795-42230817 ACCCTAGCCCTGCCCCACCTTGG - Intergenic
1067078938 10:43203070-43203092 ACCCCGACCCTGCCCCAGCCAGG + Intronic
1068380174 10:56242870-56242892 CACCACGCCCAGCCCCAGCCAGG + Intergenic
1068570400 10:58621615-58621637 CACCATGCCCTGCCCCAGGCTGG - Intronic
1069789700 10:71011759-71011781 ATCCTGGCCCTGCCTCATCCTGG + Intergenic
1069920007 10:71810698-71810720 CTCCTAGCCCTGCCCCAGTCTGG - Intronic
1070241818 10:74689613-74689635 AACCTTGCCCTGTCCTACCTAGG + Intronic
1070334774 10:75445648-75445670 AACTCTGCCCTGCCCCAATCAGG - Intronic
1070581005 10:77719528-77719550 ATCTTTGCTCTGCCACAGCCTGG - Intergenic
1070665038 10:78336720-78336742 TTCCCTGCCCTGCTCCAGCCTGG - Intergenic
1070815270 10:79318712-79318734 AACCTTGCAATGCCAGAGCCTGG - Intergenic
1072683175 10:97521272-97521294 AAGCGTGCCCTCCACCAGCCAGG - Intronic
1073457615 10:103647102-103647124 TATCTTGGCCTGCCACAGCCAGG - Intronic
1073564389 10:104522650-104522672 CACCCTGCCCTGCCCCATTCAGG - Intergenic
1074428779 10:113375025-113375047 CACCTTCCCCTGGCCCAGGCTGG + Intergenic
1074870969 10:117575855-117575877 CACCCTGCCCTGCCCCACCCTGG + Intergenic
1076305246 10:129461543-129461565 AACTTTCCCCTACCCCTGCCAGG + Intergenic
1076329517 10:129654256-129654278 ATCCTCGCCCTTCCCCAGCATGG - Intronic
1076733281 10:132448632-132448654 ACCCTTGCCCAGCCCCTGCTTGG + Exonic
1076733485 10:132449095-132449117 ACCCTTGCCCAGCCCCTGCTTGG + Exonic
1076828305 10:132981509-132981531 CGCCTTGCCATGCCCCAGCCTGG - Intergenic
1077213012 11:1382202-1382224 CTCCTGTCCCTGCCCCAGCCCGG - Intergenic
1077297699 11:1833896-1833918 CTCCTTGCTCTGCCCCAGACTGG + Intronic
1077533493 11:3108073-3108095 CCCCTGGCCCTGCCCCAGCAGGG + Intronic
1078089165 11:8253255-8253277 AAGCTTGCCCTGCTCCAGACAGG - Intronic
1078347014 11:10559042-10559064 CTCCTTACCCTGCCCCAGCTGGG - Exonic
1079296902 11:19241946-19241968 ACCCCTGCCCAGCCCCAGGCCGG + Intergenic
1080472858 11:32562943-32562965 AACCTTGCCGTGGCCCCTCCAGG + Intergenic
1081537353 11:44005381-44005403 AACCCTCCCCTCCCCCACCCAGG - Intergenic
1081674491 11:44960569-44960591 AATCTCTCCCTCCCCCAGCCTGG + Intergenic
1081811101 11:45914504-45914526 CACCTTCCCCTGCCCCAGCCTGG - Intronic
1082988712 11:59189140-59189162 ACCCATGCCCTGCCCCTTCCAGG + Exonic
1083235987 11:61350946-61350968 GACCTGGCCCTGTCCCACCCTGG + Intronic
1083412600 11:62504700-62504722 AAGGTTCCCCAGCCCCAGCCAGG - Intronic
1084981288 11:72830080-72830102 GGCCTTGCTCTGCCCCACCCTGG - Intronic
1085122072 11:73973685-73973707 CACCTGCCCCTGCCCCAGCTAGG - Intergenic
1088800050 11:113297127-113297149 AAGCTTGCCCTACCTTAGCCAGG - Intergenic
1089147839 11:116343318-116343340 AAACTTGCCCTGCCCCAAGGCGG + Intergenic
1089277903 11:117351772-117351794 AACTCTGCCCATCCCCAGCCAGG + Exonic
1090036716 11:123255652-123255674 ACCCTTGTCCTGGCCCAGGCAGG + Intergenic
1090052107 11:123388631-123388653 ACCATTGCCCTACTCCAGCCTGG + Intergenic
1091937308 12:4444101-4444123 AACCTGGCACTTCCCCGGCCTGG + Intronic
1093989533 12:25574343-25574365 ACCCTTGCCCTCCCCCATCCAGG + Intronic
1095852940 12:46830870-46830892 AACCTGTCCCGGCCCTAGCCGGG + Intronic
1095962685 12:47845222-47845244 CACCTGGCCCTGTCCCTGCCTGG + Intronic
1096521216 12:52185820-52185842 AGCCCTGCCCTGCCCTCGCCTGG - Intronic
1096604320 12:52753946-52753968 CCCCATGCCCTGCCCTAGCCTGG + Intergenic
1096842463 12:54388119-54388141 AAGAGTGGCCTGCCCCAGCCAGG - Intronic
1097022647 12:56031562-56031584 AACCTTGCCATGCCAAAGCTGGG - Intronic
1101945281 12:109131601-109131623 GTCCTTGCCCTGCCCTTGCCTGG + Intronic
1103601454 12:122057214-122057236 CACCTTGGTCTGCCCCTGCCTGG - Intronic
1103719196 12:122964444-122964466 AGCACTGCTCTGCCCCAGCCTGG - Intronic
1103927059 12:124429079-124429101 AAACCGGCCCTGCTCCAGCCAGG + Intronic
1104923294 12:132302560-132302582 CACCTGGACCTGCCCCACCCAGG - Intronic
1105780158 13:23698733-23698755 CACCGTGCCCGGCCCCAGCTAGG + Intergenic
1106923396 13:34588580-34588602 TACCCTGCCCTGCCCACGCCTGG - Intergenic
1107999162 13:45890580-45890602 ACCCTTGCCCTACCCCTGCCTGG - Intergenic
1112054445 13:95677341-95677363 AGTCCTGCCCTGCCCCGGCCAGG + Intronic
1112175538 13:97019962-97019984 AACCTCCCCCTGCCCCAGCTTGG + Intergenic
1112507387 13:99983057-99983079 ACCCTTCCCCTGCCCCTTCCCGG + Exonic
1113565991 13:111320167-111320189 ACCCCTGCCCTGATCCAGCCTGG + Intronic
1113838298 13:113343854-113343876 CACTCTGCCCTTCCCCAGCCTGG - Intronic
1115670949 14:35611205-35611227 CACCATGCCCGGCCCCAGGCTGG - Intronic
1119140989 14:72266841-72266863 AAACTTGCCCTCACCCAGCCTGG - Intronic
1120383998 14:83820520-83820542 CACCGTGCCCTGCCAAAGCCAGG + Intergenic
1120389335 14:83885833-83885855 AATCTTGCACTGCTCCACCCAGG + Intergenic
1120737660 14:88071691-88071713 GACCTTGCGCTCCCCCAGGCTGG - Intergenic
1121961725 14:98266377-98266399 ACCCTTTCCCTGCCCCTCCCTGG - Intergenic
1122780182 14:104140168-104140190 CACCCTGCCCTGCCCCAGACAGG - Intronic
1122810198 14:104284012-104284034 AGCCTGGCCCAGCCCCAGCCAGG - Intergenic
1122888689 14:104722956-104722978 CACCTGACCGTGCCCCAGCCTGG - Intergenic
1122896679 14:104761024-104761046 AGGCTTGCTCTGCCCCAGCCAGG + Intronic
1123043192 14:105498974-105498996 AAGCCTGCCCTGGCCCAGCCTGG + Exonic
1123048741 14:105530681-105530703 ATCCTGGCCTTGCCCCAGCACGG + Intergenic
1123151513 14:106186034-106186056 AGCCCTGCCCTGCCCCTGCAAGG + Intergenic
1124058084 15:26260884-26260906 ATGCTCGCCCTGCCCCACCCTGG - Intergenic
1126170050 15:45687877-45687899 CACCTGGTCCTGCCTCAGCCAGG + Intronic
1127262721 15:57337763-57337785 ACCCTCCTCCTGCCCCAGCCTGG - Intergenic
1127903061 15:63355251-63355273 CCCTTTGCCCTGCCCCAGCGAGG - Intronic
1127906460 15:63379804-63379826 GAGCTTGCCCTGCCCAAACCTGG - Intronic
1129379978 15:75158646-75158668 AGCCTGGCCCTGCCTGAGCCTGG - Intergenic
1129427775 15:75476940-75476962 AAGTTTGCCCAGCCCCAGTCTGG - Intronic
1129475207 15:75780446-75780468 CATCTTGCCCTCTCCCAGCCTGG + Intergenic
1129607681 15:77032754-77032776 AATCTGGCCCTGGCCCATCCTGG - Intronic
1129687634 15:77695687-77695709 AGCCTCCCCCTGCCCCAGCCTGG + Intronic
1129707717 15:77804258-77804280 AGCCTTGCCCTGTTCCTGCCTGG - Intronic
1130171683 15:81521073-81521095 ATCCTTGCCAAGACCCAGCCAGG - Intergenic
1130890694 15:88131533-88131555 ATCCTCCCCCTGCCCCAGTCAGG - Intronic
1131369386 15:91867073-91867095 AGCCCTGACATGCCCCAGCCCGG - Intronic
1132453220 15:101979888-101979910 ACCCTCCCCCCGCCCCAGCCCGG + Intergenic
1132745372 16:1434088-1434110 CACCTAGGCCTGCCCCCGCCAGG - Intergenic
1132792357 16:1698824-1698846 CACCTGGCTCTGCTCCAGCCGGG - Exonic
1132834279 16:1944940-1944962 AAACACGCCCTCCCCCAGCCAGG + Intronic
1132882140 16:2167180-2167202 AGCCGTGCCCTGCCCCATCATGG - Intronic
1133162541 16:3921498-3921520 AACTTTCCCCTGCAACAGCCGGG - Intergenic
1133952217 16:10405409-10405431 CACCTTGCTCTGCCCCTTCCAGG - Intronic
1134065637 16:11226211-11226233 AACCATCCCCGGCCCCAGCCTGG - Intergenic
1135303620 16:21350847-21350869 AACCAGGCCCTGCCCCTTCCTGG - Intergenic
1136103867 16:28014939-28014961 GCCCCTGCCCTGCCCCAGCCAGG + Intronic
1136238960 16:28932620-28932642 CTCCTGCCCCTGCCCCAGCCCGG - Intronic
1136279497 16:29199677-29199699 CCGCTTTCCCTGCCCCAGCCCGG + Intergenic
1136300366 16:29330042-29330064 AACCAGGCCCTGCCCCTTCCTGG - Intergenic
1136452141 16:30359455-30359477 GTCCTTGCCTTGCCCCACCCTGG - Intronic
1136608987 16:31354979-31355001 ATCCCTGCCCTGCCCCTCCCAGG - Intergenic
1137448601 16:48549685-48549707 TCCCTTGCCCTGCACCAGGCTGG - Intronic
1137557978 16:49484631-49484653 ATCCTTGACCTGCCTGAGCCGGG - Intergenic
1140286286 16:73605894-73605916 CACTGTGCCCTGCCCCAGCATGG - Intergenic
1140986047 16:80158953-80158975 AACTTTTTCCTGACCCAGCCAGG - Intergenic
1141137214 16:81474212-81474234 CACCTTGCCCTCTCCAAGCCCGG - Intronic
1141217006 16:82034098-82034120 AACCTTGCCTCCCTCCAGCCAGG + Intergenic
1142083888 16:88165778-88165800 CCGCTTTCCCTGCCCCAGCCCGG + Intergenic
1142210312 16:88805468-88805490 TTCCATGCCCTGGCCCAGCCCGG + Exonic
1142362275 16:89633104-89633126 AGCCCTGCCCAGCCCCACCCAGG + Intronic
1142471844 17:169055-169077 AACCTAGCCCTGCCCCGCCCTGG + Intronic
1142564700 17:832471-832493 CACCATGCCCAGCCTCAGCCAGG + Intronic
1142576371 17:911199-911221 AATCATGCCCTGCCCCTGCTTGG + Exonic
1142742248 17:1937929-1937951 ACCCTGGCCTTGCTCCAGCCAGG - Intronic
1142797318 17:2318566-2318588 ACCATTGTCCTGCCTCAGCCTGG + Intronic
1142850094 17:2700647-2700669 AACCTGGCCCTGCCCTCGCTGGG - Intronic
1143471483 17:7178463-7178485 CACCTTGCCCTGCCTCTGCAAGG - Intronic
1144451188 17:15380264-15380286 AACCTTCTCCTGGCCCAGCGTGG - Intergenic
1144632500 17:16881342-16881364 AGCCTTGTTCTCCCCCAGCCTGG - Intergenic
1144638219 17:16924231-16924253 AGCCTTGTCCTCCCCCAGCCTGG - Intergenic
1145250314 17:21293676-21293698 AGCCCTGCCCTGCCTCTGCCCGG - Intronic
1145760399 17:27422278-27422300 AACTGGGCCCTGACCCAGCCTGG - Intergenic
1146266660 17:31457547-31457569 CACCTTGTCCCGCCCCACCCCGG - Intronic
1146565049 17:33905712-33905734 CACATTTCCCTGCCCCAGCAGGG - Intronic
1146815710 17:35940342-35940364 AACCCTTTCCTGCTCCAGCCTGG - Intronic
1147700147 17:42388520-42388542 ATCCTCGCCCAGCCCCAGCCTGG + Exonic
1148229125 17:45920247-45920269 AACATTGCCGAGCACCAGCCAGG - Intronic
1148235331 17:45964867-45964889 ACCCTGTCCCTGCCCCACCCTGG + Intronic
1149581141 17:57751092-57751114 AAGCTGGCCCTTCTCCAGCCTGG + Intergenic
1151175623 17:72285504-72285526 GTACTTTCCCTGCCCCAGCCCGG - Intergenic
1151539698 17:74758758-74758780 AACCCAGCCCTGCCCCAGCTTGG + Intronic
1151570902 17:74924881-74924903 AACCGTGCGCTGCCCCTGCGCGG + Exonic
1152108086 17:78342257-78342279 CACCTTGTCCTGCTCGAGCCAGG + Intergenic
1152281045 17:79385042-79385064 AACATTTCCCGGCCCCTGCCAGG + Intronic
1152284351 17:79403638-79403660 AGCCCCGCCCTGCCCAAGCCAGG - Intronic
1152429267 17:80238742-80238764 AACTTTACCCTGGCACAGCCTGG - Intronic
1153547005 18:6218508-6218530 TACCTGGTCCTGTCCCAGCCTGG + Intronic
1153895419 18:9554746-9554768 TCCCTTTCCCTGTCCCAGCCTGG - Intronic
1153985453 18:10346987-10347009 GGCCTTCCCCTGCCACAGCCTGG - Intergenic
1154289440 18:13094575-13094597 ATACTTTCCCTGCCCCACCCTGG + Intronic
1154415583 18:14173807-14173829 GGCCCTGCCCTGGCCCAGCCTGG - Intergenic
1156290700 18:35747082-35747104 AGCCTTGCCCTGCCCTGCCCTGG + Intergenic
1156502989 18:37571372-37571394 AACCATTCCCTGCCAGAGCCAGG - Intergenic
1157384338 18:47248441-47248463 AAGCGCGCACTGCCCCAGCCGGG - Exonic
1160736522 19:665086-665108 AGCCTCGCCCCTCCCCAGCCTGG - Intergenic
1161023261 19:2021744-2021766 CACCTGGCCCAGCCCCAGGCTGG + Intronic
1161588054 19:5116110-5116132 TACCATGCCCAGCCCCAGTCTGG - Intronic
1161765478 19:6205526-6205548 AACCTTGCACTCACCCAGCAGGG + Intergenic
1162017210 19:7852176-7852198 CGCCTTGCCCCGCCCCAGCCCGG + Intronic
1162105294 19:8366487-8366509 AGCCCTGACCTGGCCCAGCCAGG + Intronic
1162530049 19:11230768-11230790 GGCCTGGCCCTGCCCAAGCCTGG + Intronic
1162577621 19:11507934-11507956 AACCTTACCCAGGCCCTGCCAGG - Intronic
1162716312 19:12636651-12636673 TACCCTGCCCCGCCCCATCCTGG + Intronic
1162981439 19:14242799-14242821 CACCATGCCCTGCCCCAGTCTGG - Intergenic
1163054263 19:14706452-14706474 CACCTTCCCCAGCCCCTGCCTGG + Intronic
1163531937 19:17855227-17855249 ACCCGTGCCCTTCCCCACCCTGG + Intergenic
1163555131 19:17987703-17987725 TACCATGCCCAGCCCCAGGCAGG - Intronic
1163667355 19:18609665-18609687 AATCCTGCCCAGCCCCACCCTGG + Intronic
1163890436 19:20007890-20007912 AACCTTGCTCTCTCTCAGCCTGG - Intronic
1164687260 19:30175454-30175476 AACCGGGGCCTGCCCCAGCAGGG - Intergenic
1165098193 19:33421860-33421882 AACCTTGGCCTGCACCAGGGAGG - Intronic
1165826741 19:38709941-38709963 AGCCATGCACTGCCCCAGCTGGG + Intronic
1165932604 19:39369714-39369736 CACCTTCCCCTGCTTCAGCCAGG + Exonic
1166121005 19:40686880-40686902 AGCCCTGCCCTGTCCCAGGCTGG + Intronic
1166230894 19:41425438-41425460 CTCCTTGGCCTCCCCCAGCCAGG - Exonic
1166410435 19:42552894-42552916 GGCCATGCACTGCCCCAGCCTGG - Intronic
1166786924 19:45373178-45373200 AGTCTTGCTCTGTCCCAGCCTGG + Intergenic
1166887867 19:45972887-45972909 CTCCTTCCCCTCCCCCAGCCAGG + Intronic
1166981392 19:46634295-46634317 CACCTTGCCCCGCCCCATACAGG + Intronic
1168028583 19:53662024-53662046 AACCTTGCCTGGCCAGAGCCAGG - Intergenic
1168344951 19:55645699-55645721 AACCTTCCCATTCCCCAGCCAGG - Intronic
1168713331 19:58513827-58513849 AACCAGCCCCAGCCCCAGCCCGG + Exonic
925194157 2:1910056-1910078 ACCCTTGCCCTCACACAGCCTGG + Intronic
925596604 2:5561594-5561616 AATCTTGCTCTACCCCAGGCTGG + Intergenic
926010211 2:9400927-9400949 AGCCCCGCCCTGCCCCAGCCAGG - Intronic
926165644 2:10521100-10521122 ACCCTCCCCTTGCCCCAGCCTGG - Intergenic
926578453 2:14608516-14608538 CACCTTGCCTTGTCCCAGCTTGG + Intergenic
927653411 2:24926441-24926463 AACCAAGCCCAGCACCAGCCTGG - Intergenic
928252558 2:29694802-29694824 AGCCTGGCCCTGACCCACCCAGG + Intronic
928323442 2:30301882-30301904 AAGCTGACCCAGCCCCAGCCTGG + Intronic
928885277 2:36141340-36141362 AACCTAGCTCTGCCCCAGTTTGG - Intergenic
930663779 2:54082050-54082072 CCCCCTGTCCTGCCCCAGCCTGG + Intronic
930896240 2:56449790-56449812 AACATTGCCCCACCCCAGACAGG - Intergenic
931224807 2:60320627-60320649 AACCTTGTCATGCCTCAGCAAGG + Intergenic
931587639 2:63845540-63845562 AACGTTACCTTGCCCCACCCCGG - Intronic
931811159 2:65856388-65856410 AACCTTTCCCTGGGGCAGCCAGG - Intergenic
932146077 2:69318570-69318592 AACCTTGAGCTGTCCCACCCAGG + Intergenic
932193581 2:69763184-69763206 AACCCTGCCCTGGCCCAGAGAGG + Intronic
932422903 2:71611979-71612001 GACCATGTCCTCCCCCAGCCTGG + Intronic
933742614 2:85546672-85546694 AACCTTGCTCTGGCCCAGGCTGG - Exonic
936061063 2:109296059-109296081 ATCCCTTCCCTGCCCCAGCCAGG + Intronic
936622675 2:114116840-114116862 GAGCTTGCCCAGCCACAGCCTGG - Intergenic
937230820 2:120397161-120397183 AACCCTGCCCTGCCCTGCCCTGG + Intergenic
937295447 2:120807243-120807265 ACCCTTGCCCTGCCCCTTCTCGG + Intronic
938378943 2:130825937-130825959 ATCCTCTCCCCGCCCCAGCCTGG + Intergenic
938398226 2:130965953-130965975 AACCCTGCCCTGCCATTGCCGGG - Intronic
938926766 2:136050280-136050302 TCATTTGCCCTGCCCCAGCCTGG + Intergenic
940048692 2:149437713-149437735 AACCTGGCCCTGCTCTGGCCTGG + Exonic
942023843 2:171894006-171894028 CTCCTTCCCCTCCCCCAGCCGGG + Intronic
942250831 2:174046572-174046594 AACCTTGCTCTGCCCCTTCCTGG + Intergenic
946187949 2:217991785-217991807 CACCATCCCCTGCCCCAGCCCGG + Intronic
947636900 2:231684809-231684831 AACCATGCTCTGCCCAAGGCGGG - Intergenic
948277553 2:236721122-236721144 AAACATGCCCCTCCCCAGCCTGG + Intergenic
948330444 2:237160455-237160477 ATCTTTGCCTTGCCCCACCCTGG - Intergenic
948666150 2:239535976-239535998 CACTTTTCCCTGCCCCAACCTGG + Intergenic
948795996 2:240402334-240402356 GACCCTGCCCTGTACCAGCCGGG + Intergenic
948945160 2:241215629-241215651 ATCCGTGCCCTGCTCCTGCCAGG - Intronic
1168896540 20:1327593-1327615 AACCCTGCCCTGCCTGGGCCTGG - Intronic
1169968961 20:11248087-11248109 AGCCCTACCCTGCCCCACCCGGG - Intergenic
1171784407 20:29449125-29449147 AGCCAGGCCCTGCCCCAGCCAGG - Intergenic
1171784412 20:29449141-29449163 AGCCTGGCCCTGGCCGAGCCAGG - Intergenic
1171857661 20:30361945-30361967 AACCCTGCGCTGGCCCTGCCGGG + Intergenic
1172098004 20:32470026-32470048 GGCCCTGACCTGCCCCAGCCAGG + Intronic
1172109253 20:32535938-32535960 ACCCTCTCCCTGCCCCCGCCAGG - Intronic
1172446309 20:34995291-34995313 TACCTGGCCCTCCCCCAACCTGG + Intronic
1172565126 20:35924233-35924255 ACCATTGCACTACCCCAGCCTGG - Intronic
1173230981 20:41198028-41198050 AGTCTTGCTCTGCCCCACCCAGG + Intronic
1173468287 20:43301898-43301920 AACTCAGCCCTGCCCCAGGCAGG + Intergenic
1173959769 20:47061986-47062008 CACCTTGCTATGCCCCAGCTTGG + Intronic
1174181747 20:48679494-48679516 TACCCTGCCCTGCCCCGTCCTGG - Intronic
1174287092 20:49481484-49481506 AACCTCACTCTGCCCCAGCAAGG - Intronic
1174410297 20:50330759-50330781 TGCCTGGCCCTGCTCCAGCCAGG + Intergenic
1174470955 20:50760392-50760414 AATCTTGCTCTGGCCCAGGCTGG - Intergenic
1175412131 20:58777344-58777366 AACATGGCCCTGCTCCATCCTGG - Intergenic
1175940979 20:62537447-62537469 AACATTGCCCCACCCCTGCCAGG + Intergenic
1176098938 20:63356283-63356305 GTCCTGGCCCTGCCCCACCCTGG - Intronic
1176412649 21:6457416-6457438 AGCCCTGCCCCGCCCCTGCCTGG + Intergenic
1176519970 21:7817159-7817181 AAACCTGCCCTGCCTCAGTCTGG + Exonic
1176866130 21:14056151-14056173 GCCATTGCCCTGCCCTAGCCTGG - Intergenic
1177792265 21:25734559-25734581 GACCTTGGGTTGCCCCAGCCAGG + Exonic
1178018124 21:28375860-28375882 AACATTCCCCAGCACCAGCCTGG - Intergenic
1178494824 21:33077860-33077882 AACCATGAACTGCCCCAGCGAGG + Intergenic
1178632928 21:34278262-34278284 AGCCTGTCCCTGCACCAGCCTGG + Intergenic
1178653998 21:34447172-34447194 AAACCTGCCCTGCCTCAGTCTGG + Intergenic
1179688143 21:43065738-43065760 AGCCCTGCCCCGCCCCTGCCTGG + Intronic
1179923779 21:44521600-44521622 ACCCTGGCTCTGCCCCACCCTGG - Intronic
1180624646 22:17186093-17186115 AACCCTGCCCTGCCCCATGCAGG - Intronic
1180752476 22:18134092-18134114 CACCATGCCCAGCCCCAGCCCGG - Intronic
1181261539 22:21601672-21601694 TGCCTGGCCCTGCCCCAGGCTGG - Intronic
1181547352 22:23609646-23609668 AACCCTGCCTTCTCCCAGCCAGG + Intronic
1181748570 22:24973121-24973143 CACATTGCCCTGCACTAGCCTGG - Intronic
1182548402 22:31088614-31088636 CCCCATCCCCTGCCCCAGCCTGG - Intronic
1182593102 22:31397446-31397468 CACTGTGCCCAGCCCCAGCCTGG + Intergenic
1183412958 22:37666091-37666113 CATCTTGGCCTGACCCAGCCAGG + Exonic
1183483112 22:38075556-38075578 ACCCTTGCCTCGCCCCAGACCGG + Exonic
1183705712 22:39473906-39473928 AACCTTGCCCTGATCTACCCTGG - Intronic
1184104116 22:42357578-42357600 AATCTTGCCATCCCCCAGGCAGG - Intergenic
1184242104 22:43216772-43216794 AACCTGGCCCTTCCCCTGCCAGG + Intronic
1184417421 22:44360435-44360457 GGCCTTGCCCTGCCCCACCCGGG + Intergenic
1184474334 22:44712423-44712445 GACCCTGCCCTGCGCCAGCGAGG + Intronic
1185057541 22:48588697-48588719 GGCCCTGCCCTGCCCCAACCGGG - Intronic
1185128495 22:49024739-49024761 ATCCCTGCTCTGCCCCAACCTGG - Intergenic
950182282 3:10923295-10923317 CACCTTGTCTTGCCCTAGCCCGG - Intronic
950196728 3:11014696-11014718 AACATTGCCATGCCCAGGCCAGG + Intronic
950677272 3:14561859-14561881 ATCCTCTCCCTCCCCCAGCCTGG - Intergenic
951109096 3:18780286-18780308 AACTTTTCCCAGCCCAAGCCTGG - Intergenic
952843745 3:37669415-37669437 GCCCTGTCCCTGCCCCAGCCTGG + Intronic
952865836 3:37854616-37854638 GGCCATGCCCTCCCCCAGCCGGG + Intergenic
954063556 3:48088685-48088707 AGCCTTGCCCTGCGGCAGCTGGG - Intronic
955025679 3:55165146-55165168 CACCTGGCCCTTCCTCAGCCTGG - Intergenic
958570087 3:95869127-95869149 AGTCTTGCTCTGCCCCAGGCTGG + Intergenic
958785722 3:98594184-98594206 CACCGCGCCCGGCCCCAGCCTGG - Intergenic
960210287 3:114956500-114956522 AACCTTTCCCTCCCTCAGCTGGG + Intronic
961352178 3:126311058-126311080 GACCCTCCCCAGCCCCAGCCTGG - Intergenic
961451539 3:127004447-127004469 GACCCTGCCCTGGCCAAGCCAGG - Intronic
961769924 3:129241560-129241582 CACCGTGCCCGGCCCCAGCCTGG + Intergenic
962285131 3:134078940-134078962 AACCTTTCCCAGCCACAGACTGG + Intronic
962826986 3:139107568-139107590 CACCTTGCTCTGCCCTAGGCAGG - Intronic
966918560 3:184597950-184597972 AACCTTGTCCTGTCCCACACAGG - Intronic
967531493 3:190553572-190553594 AGCATTCCCCAGCCCCAGCCGGG + Intronic
967884339 3:194322906-194322928 CACCTTGCCCTGCCCCACCCAGG - Intergenic
968494167 4:906415-906437 ACCCTAGCCCTGGCCCAACCAGG + Intronic
968893416 4:3384875-3384897 AACCATGCCCCGACGCAGCCTGG - Intronic
969447255 4:7252348-7252370 AGCTCTGCCCTGCCCCACCCGGG - Intronic
969457343 4:7307538-7307560 AGCCCTGACCTGCCCCAGCCTGG - Intronic
969671350 4:8592043-8592065 AACCTTGCCCTCTCTCTGCCTGG - Intronic
969697260 4:8741859-8741881 ACCAGTGCCCTGCCCTAGCCAGG + Intergenic
973907672 4:55547095-55547117 CACCGTTCCCTGCCCCGGCCGGG + Intronic
974856318 4:67465781-67465803 GACATTCCCCTGCACCAGCCTGG + Intergenic
975023513 4:69520578-69520600 AACTTTGCTCTACCCCAGACTGG - Intronic
976009247 4:80467530-80467552 TTCCTTGCCTTGCCCCAACCTGG + Intronic
976247201 4:83015871-83015893 AATCTTGCTCTGTCCCAGGCTGG - Intergenic
977303563 4:95296056-95296078 AGTCTTGCCCTGTCCCAGACGGG - Intronic
977559272 4:98516151-98516173 AAACTGGCCCTGCCCCAACAGGG + Intronic
977624897 4:99179575-99179597 AACATTCACCTGCACCAGCCTGG - Intergenic
977771939 4:100870240-100870262 AACATTCCCCAGCACCAGCCTGG - Intronic
979584820 4:122403681-122403703 AAGCTTGCCCTACCTTAGCCAGG + Intronic
982067684 4:151668860-151668882 AAACTGGCTCTGCCCCAGGCTGG - Intergenic
984503605 4:180589760-180589782 AACCCAGCCCTGCCCCCGCCCGG + Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
985805273 5:2038874-2038896 AGCCCTGCCCGGCCCCTGCCCGG - Intergenic
985811687 5:2094781-2094803 CACCTTGTCCTTTCCCAGCCAGG - Intergenic
986276413 5:6279054-6279076 TTCCTTGCCATGACCCAGCCAGG - Intergenic
986417497 5:7544091-7544113 ATCCTTTCCCTGCCCCACTCTGG + Intronic
986634001 5:9801908-9801930 TACCTATCCCTGCCCCAACCTGG + Intergenic
987022342 5:13887765-13887787 AACCTTCCACTGCCCCACCCAGG + Intronic
989355458 5:40539281-40539303 CACCTATCCCTGCCCCAACCTGG - Intergenic
989400620 5:41004224-41004246 TTCCTTGGCCTGCCCCAGACAGG - Intronic
991630855 5:68655282-68655304 CACATAGCCCTTCCCCAGCCAGG + Intergenic
993450631 5:88069276-88069298 AACCTCCCCCTGCCCCCACCAGG + Intergenic
998230363 5:140357678-140357700 AGCCTTGCCCTGGCCCACCGCGG - Intergenic
998810699 5:145963333-145963355 AACCTTCCCCTTGACCAGCCAGG + Intronic
999231502 5:150064847-150064869 AACCCTCCCCTGCCCCTGCTGGG + Intronic
1001035009 5:168291505-168291527 ACCCTTACGCTGCCCCTGCCAGG - Intergenic
1001651178 5:173317507-173317529 TGCCTTGCCCTGCCCCTCCCTGG + Exonic
1002081883 5:176742290-176742312 AACCTGTCCCTGCCTCACCCTGG + Intergenic
1002849320 6:979140-979162 GACCTTCCCCAGCACCAGCCTGG - Intergenic
1006519754 6:34564469-34564491 GCCCTGGCACTGCCCCAGCCTGG - Intergenic
1006912986 6:37576092-37576114 AGCCTGGCCCAGCCCCAGCCTGG - Intergenic
1007647717 6:43395777-43395799 AATCCTCCCCTGGCCCAGCCTGG - Intergenic
1007815925 6:44525545-44525567 ACCCTTGGCCTGCCCTGGCCTGG + Intergenic
1011366412 6:86586983-86587005 AACCTCGCTCTGTCCCAGGCTGG - Intergenic
1011770123 6:90666380-90666402 CACCTGGCCCTGTCCCAGCAAGG + Intergenic
1013126511 6:107189623-107189645 CACTGTGCCCGGCCCCAGCCAGG + Intronic
1013413183 6:109900286-109900308 ATACTTGCCCTGCCCCACCCTGG + Intergenic
1014384647 6:120785816-120785838 AACTTTGCTCTGCCCCAGAGTGG - Intergenic
1014482030 6:121950935-121950957 CACCTATCCCTGCCCCAACCTGG - Intergenic
1014573416 6:123040063-123040085 AACCCACCCCTGCCCAAGCCTGG - Intronic
1017132024 6:151115614-151115636 CACCGTGCCCTCCCTCAGCCGGG + Intergenic
1017587882 6:155947066-155947088 AACTTTGCTCTGCCCCAAGCAGG - Intergenic
1017740040 6:157398300-157398322 ATCCCTGCCCTGACCCTGCCAGG - Intronic
1018812188 6:167306328-167306350 GACCCTGCCCTGCCCCACCCTGG - Intronic
1018874070 6:167804556-167804578 GTCCTTGCCCTGCCCCATGCAGG + Intergenic
1023038799 7:36154590-36154612 AAACTTGACCTGCTCCAGCTTGG - Exonic
1024524388 7:50336248-50336270 ACCCTCCCCCTGCCCCCGCCGGG - Intronic
1024632004 7:51256658-51256680 ACACTTGCCCTGCCTCTGCCTGG - Intronic
1024779938 7:52836203-52836225 ATCCCTGCCTTGCCCCAGCATGG - Intergenic
1025028522 7:55537178-55537200 GACCCTGCCCTGTCCCAACCAGG + Intronic
1026319748 7:69258293-69258315 AAAATTGCCATTCCCCAGCCTGG + Intergenic
1026878498 7:73893589-73893611 CACCTGGCCCTGGCCCAGCCTGG + Intergenic
1026909264 7:74083277-74083299 CACCTTCCCCGGGCCCAGCCTGG + Intronic
1026911382 7:74093657-74093679 CCCCTTCTCCTGCCCCAGCCTGG + Intronic
1027269490 7:76512052-76512074 GGCCTTGCCCGGCCCCAGCGGGG - Intronic
1027320200 7:77005946-77005968 GGCCTTGCCCGGCCCCAGCGGGG - Intergenic
1029435841 7:100563647-100563669 AACCCTGCCCTCTCCCTGCCCGG - Intronic
1031843857 7:126780725-126780747 AATCTGGCCCTGCCCCCGTCAGG - Intronic
1032246684 7:130219327-130219349 AACCTTTCTCTGCTGCAGCCTGG + Intergenic
1032475841 7:132211043-132211065 AACCTCCCCCAGCCCCAGTCTGG - Exonic
1034255768 7:149723931-149723953 TACATTACCCTGCCCCAGGCAGG + Intronic
1034400055 7:150856333-150856355 CCCCTTGCCCTGCCCCAAGCTGG - Intronic
1034480963 7:151320389-151320411 AACCTGGCCCAGCCCCATCATGG - Intergenic
1034939385 7:155220556-155220578 CCCCCAGCCCTGCCCCAGCCTGG + Intergenic
1035957978 8:4104014-4104036 GGCCTGTCCCTGCCCCAGCCTGG + Intronic
1036159185 8:6370565-6370587 AACCTGGCCACACCCCAGCCTGG + Intergenic
1037513005 8:19602637-19602659 AGACCTGCCCTGCCCCTGCCTGG + Intronic
1038407986 8:27336111-27336133 AAACCTGCCATGCCCCAGGCTGG - Intronic
1041691659 8:60693519-60693541 AACCTTGCCCTGCCCAAGACAGG - Intronic
1042303025 8:67306299-67306321 AATCTTGCCCTGTCCCACCCAGG - Intronic
1042542293 8:69919371-69919393 CACCGTGCCCGGCCCCAGCCAGG - Intergenic
1044743664 8:95352189-95352211 CACCTTCCTCTGCCACAGCCAGG - Intergenic
1045007444 8:97928658-97928680 AACCCTGCCCCTACCCAGCCTGG + Intronic
1045485515 8:102628106-102628128 GGCCTTGCCCTGACCCAGGCAGG - Intergenic
1048579596 8:135720089-135720111 ACCACTGCCCTGCCCCTGCCTGG + Intergenic
1048878072 8:138852224-138852246 ACCCTTTCCCTGTCACAGCCGGG - Intronic
1049644401 8:143729578-143729600 GCCCTTGCCGTGCCCCAACCTGG - Intronic
1051273326 9:15375726-15375748 GACCTTCCCCAGCACCAGCCTGG + Intergenic
1051996067 9:23219611-23219633 AGCCTTGCCATGGCCCTGCCTGG - Intergenic
1052830601 9:33212187-33212209 AACCCTACCCTTCCCCAACCTGG - Intergenic
1053428956 9:38029179-38029201 AACTCTGCCCAGCCCCAGCCTGG + Intronic
1054955694 9:70907268-70907290 CACCTTGTCCTGCCTCAGCTGGG - Intronic
1056597052 9:88016260-88016282 CCCCTTTCCCAGCCCCAGCCCGG + Intergenic
1056803662 9:89711652-89711674 ATCCCTGGCCTGCCACAGCCTGG - Intergenic
1057005408 9:91553327-91553349 CACCTTGCCCTGTCCCAGCTGGG - Intergenic
1057282330 9:93721794-93721816 AACCTTGCCTGGCACCAGCGGGG - Intergenic
1058432002 9:104928073-104928095 CGCCCTGCCCTGCCGCAGCCCGG + Exonic
1059197092 9:112380270-112380292 ATCCTTGACCTCCCACAGCCGGG - Intronic
1059335252 9:113564991-113565013 GGCTTTGCGCTGCCCCAGCCTGG + Intronic
1059391927 9:114004665-114004687 AGCCCTGCCCTGACCCAGACTGG + Intronic
1059463512 9:114450465-114450487 AACCTTGGCCAGCCCCTTCCTGG + Intronic
1060189335 9:121582219-121582241 AAGCTTGCTCTCCCCCAGCCGGG - Intronic
1060265382 9:122108929-122108951 CACCTGGCCCTGCCTCAGGCAGG + Intergenic
1060887464 9:127165338-127165360 GCCCTTCCCCTTCCCCAGCCAGG + Intronic
1061187433 9:129063119-129063141 GCCCTGGCCCTGCCTCAGCCTGG - Intronic
1061387882 9:130301145-130301167 AGCCCTGCCTTGCCCCACCCAGG - Intronic
1061395847 9:130342945-130342967 AACCCTGCCCTGGCCCTTCCTGG + Intronic
1061749683 9:132769212-132769234 CACCCTGCCCTGCCACTGCCTGG + Intronic
1062026337 9:134342421-134342443 ATCCTTGCCCTTTCCCTGCCAGG + Intronic
1062145581 9:134988007-134988029 ACCCTTGGCCTTCCCCACCCTGG + Intergenic
1062170067 9:135129777-135129799 CACCTTGCTGTGCCCCAGTCGGG + Intergenic
1062248256 9:135581162-135581184 GACCTGGCCCTGCCCGATCCAGG + Intergenic
1062402331 9:136378090-136378112 AAGCTGCCCCTGCGCCAGCCTGG - Exonic
1062595811 9:137298670-137298692 AGTCTTGCCCTGGGCCAGCCCGG - Intergenic
1203445019 Un_GL000219v1:46020-46042 AGCCTGGCCCTGACCGAGCCAGG - Intergenic
1185558848 X:1043124-1043146 CACCATGCCCGGCCCCAGCTTGG + Intergenic
1189412361 X:40783949-40783971 ATCCTGGCCTGGCCCCAGCCAGG + Intergenic
1190962259 X:55264463-55264485 CACCTCGCCCTGCCACTGCCCGG + Intronic
1192177436 X:68894734-68894756 AGCCCTGCCCTGTGCCAGCCTGG - Intergenic
1193022257 X:76802829-76802851 AACATTGCTCTGCTGCAGCCAGG + Intergenic
1199715990 X:150507736-150507758 AAGCCTGCCCTGCCCCGGCGTGG + Intronic
1201240609 Y:11954079-11954101 ACCCCTACCCTGCCCCACCCCGG - Intergenic
1201312474 Y:12609417-12609439 AACCTTGGCCTCCCAAAGCCTGG - Intergenic
1202036435 Y:20641430-20641452 ACCCTTGCTCGCCCCCAGCCTGG - Intergenic