ID: 920377320

View in Genome Browser
Species Human (GRCh38)
Location 1:205516145-205516167
Sequence CAGGGTCAGCTGGAGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 507
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 461}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920377307_920377320 29 Left 920377307 1:205516093-205516115 CCCTGAGGTTTGTCCCAGGCTCC 0: 1
1: 0
2: 1
3: 14
4: 141
Right 920377320 1:205516145-205516167 CAGGGTCAGCTGGAGGATGAAGG 0: 1
1: 0
2: 1
3: 44
4: 461
920377306_920377320 30 Left 920377306 1:205516092-205516114 CCCCTGAGGTTTGTCCCAGGCTC 0: 1
1: 0
2: 3
3: 20
4: 172
Right 920377320 1:205516145-205516167 CAGGGTCAGCTGGAGGATGAAGG 0: 1
1: 0
2: 1
3: 44
4: 461
920377317_920377320 -9 Left 920377317 1:205516131-205516153 CCAGCTGTGCAGAACAGGGTCAG 0: 1
1: 0
2: 0
3: 29
4: 225
Right 920377320 1:205516145-205516167 CAGGGTCAGCTGGAGGATGAAGG 0: 1
1: 0
2: 1
3: 44
4: 461
920377316_920377320 -6 Left 920377316 1:205516128-205516150 CCTCCAGCTGTGCAGAACAGGGT 0: 1
1: 0
2: 1
3: 28
4: 222
Right 920377320 1:205516145-205516167 CAGGGTCAGCTGGAGGATGAAGG 0: 1
1: 0
2: 1
3: 44
4: 461
920377311_920377320 16 Left 920377311 1:205516106-205516128 CCCAGGCTCCTGGAAACTAAGGC 0: 1
1: 0
2: 0
3: 15
4: 156
Right 920377320 1:205516145-205516167 CAGGGTCAGCTGGAGGATGAAGG 0: 1
1: 0
2: 1
3: 44
4: 461
920377308_920377320 28 Left 920377308 1:205516094-205516116 CCTGAGGTTTGTCCCAGGCTCCT 0: 1
1: 0
2: 2
3: 13
4: 189
Right 920377320 1:205516145-205516167 CAGGGTCAGCTGGAGGATGAAGG 0: 1
1: 0
2: 1
3: 44
4: 461
920377312_920377320 15 Left 920377312 1:205516107-205516129 CCAGGCTCCTGGAAACTAAGGCC 0: 1
1: 0
2: 0
3: 9
4: 178
Right 920377320 1:205516145-205516167 CAGGGTCAGCTGGAGGATGAAGG 0: 1
1: 0
2: 1
3: 44
4: 461
920377313_920377320 8 Left 920377313 1:205516114-205516136 CCTGGAAACTAAGGCCTCCAGCT 0: 1
1: 0
2: 2
3: 12
4: 159
Right 920377320 1:205516145-205516167 CAGGGTCAGCTGGAGGATGAAGG 0: 1
1: 0
2: 1
3: 44
4: 461

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920377320 Original CRISPR CAGGGTCAGCTGGAGGATGA AGG Intronic
900147597 1:1165251-1165273 CAGGCTCAGCTGGGGGACCAAGG - Intergenic
900621789 1:3590911-3590933 CCCTGTGAGCTGGAGGATGATGG - Intronic
900809095 1:4787604-4787626 CAGGGGCAGGGGCAGGATGAGGG + Exonic
901024004 1:6269580-6269602 CAGGGTCGGCTCCAGGCTGAGGG + Intronic
901024777 1:6273393-6273415 CAGGGGCAGCTTCAGGATGCAGG + Intronic
901055023 1:6445380-6445402 CAGGGTCACCTGGAAGGGGAGGG - Intronic
901436731 1:9251141-9251163 CAGGGTCATCTCTGGGATGAAGG - Intronic
901737542 1:11321998-11322020 CAGGCTCAGCAGAAGGATGGAGG - Intergenic
902039794 1:13484275-13484297 AAGGGGGAGATGGAGGATGATGG - Intronic
902236370 1:15060141-15060163 CAGGGACAGCTGGTGAGTGAGGG - Intronic
902479341 1:16703234-16703256 CAGGGTCACCTGGAAGGGGAGGG + Intergenic
902549454 1:17210746-17210768 CTGGGGCTGCTGGAGGTTGAGGG - Intronic
902551691 1:17223319-17223341 CAGGAGCAGCTGGCAGATGAGGG - Intronic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
903326830 1:22573664-22573686 GAGGAGGAGCTGGAGGATGAGGG - Intronic
903581951 1:24377613-24377635 GAGGGACAGCTGGAGCTTGAGGG - Intronic
904256914 1:29260041-29260063 AAGGGTCAGCTGGTGGACGCCGG + Exonic
904263950 1:29307053-29307075 CAGGGGCAGATGGAGGTGGACGG - Intronic
904354576 1:29930760-29930782 CAGGGACAGCTGTAGGGAGAGGG - Intergenic
904672159 1:32174037-32174059 CAGGGTCAGCTGGGATCTGAAGG - Exonic
904972872 1:34432795-34432817 CAGGGTCAGCTGGGGTTGGATGG - Intergenic
905102734 1:35539735-35539757 CAGAGTCAGCTGGAGGCTTATGG - Intronic
906274946 1:44508355-44508377 TGGGGTCAGCAGGTGGATGAAGG + Intronic
907332607 1:53681060-53681082 CAGGGTCAGAGAGAGGATGCAGG + Intronic
907470216 1:54668884-54668906 CAGGATCTGCTGGAGGCAGAAGG + Exonic
907684420 1:56595898-56595920 CTGTGTCAGCTTGAGAATGACGG + Intronic
907931040 1:59000469-59000491 CTGGGGCAGCTGGAGGAGCACGG - Intergenic
909026407 1:70487018-70487040 CAGGGTCTGCTGTGGGATCAAGG - Intergenic
909800136 1:79796672-79796694 CTGGGTCTGCTGGAGTATGTAGG + Intergenic
910471243 1:87555073-87555095 CATGGCCTGCTTGAGGATGAAGG - Intergenic
911314337 1:96338018-96338040 CAGGGTCTACTTGAGGATGGAGG + Intergenic
912450941 1:109767370-109767392 CAGGGTGAACAGGATGATGATGG - Intronic
913163585 1:116166458-116166480 CAGGCACAGCTGGTGGTTGAGGG + Intergenic
913334081 1:117692445-117692467 AAGGGTCTGCTGGGGGATGGAGG + Intergenic
914348848 1:146822445-146822467 CAGGGTCTCCTGGAGCATGGCGG + Intergenic
915973871 1:160372226-160372248 CAGGGTCAGCAGTGGAATGAAGG + Exonic
917325117 1:173824291-173824313 CAGGCTCAGCTGGAGAGGGACGG - Exonic
917772536 1:178295370-178295392 CAGGGCCTGCTGGGGGGTGAGGG - Intronic
918315185 1:183317242-183317264 CAGGGTATGCTGGAGGATGTGGG - Intronic
919493159 1:198230279-198230301 CAAGGTCGGGAGGAGGATGAAGG - Intronic
919840883 1:201608717-201608739 TGGGGTCAGCTGGGGGAGGAGGG + Intergenic
920377320 1:205516145-205516167 CAGGGTCAGCTGGAGGATGAAGG + Intronic
920379530 1:205527664-205527686 CAGGGTGTGCAGGAGAATGAGGG + Intronic
920655849 1:207874170-207874192 CAGAGTCAGAGGGATGATGAGGG - Intergenic
921159563 1:212463544-212463566 CTGGGTCAGGTAGAGGATGAGGG - Intergenic
922251866 1:223856582-223856604 CTGGGGCAGCTGGAGGAGCACGG + Intergenic
922561851 1:226575357-226575379 CAGCTCCAGCTGGAGGCTGAAGG + Intronic
923060700 1:230470785-230470807 CAGGGCCTGTTGGAGGATGAGGG - Intergenic
923384336 1:233451731-233451753 CAGGTGCAGCGGGAGGCTGAAGG + Intergenic
923429966 1:233910400-233910422 GAGGCTCTGCTGCAGGATGAAGG + Intronic
923472212 1:234302027-234302049 CAGGGCCTGTTGAAGGATGAGGG + Intronic
924384809 1:243490824-243490846 CTGGGTCTGGTGGAGGATGAGGG - Intronic
1063046182 10:2394435-2394457 CAGAATCCGCTGGAGGAGGAAGG + Intergenic
1063469473 10:6272836-6272858 CAGGGTCAGATGGAGGAGGCAGG + Intergenic
1063899474 10:10717722-10717744 CAGGGTCCTTTGGAGGAAGAGGG + Intergenic
1064063274 10:12157999-12158021 CAGGGCCGACTGGAGGATGATGG - Exonic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1064429696 10:15260173-15260195 TTGGGTGAGCTGTAGGATGAGGG - Intronic
1066218091 10:33308198-33308220 CAGGGTCTACTTGAGGATGGAGG + Intronic
1066648575 10:37634932-37634954 GAGGGTCAGCAGAAGAATGAGGG + Intergenic
1066719785 10:38325411-38325433 CAGGGCCTGCTGGGGGATGGGGG + Intergenic
1066745911 10:38604199-38604221 CAGGGAGGGCTGGAGGGTGATGG - Intergenic
1067030358 10:42875476-42875498 CAGGGAAGGCTGGAGGAAGAGGG - Intergenic
1067051768 10:43025527-43025549 CAGGGGCAGGTGGAGGAGGAGGG - Intergenic
1069048851 10:63771090-63771112 AAGGCTCATCTGGAGGAGGAAGG - Intergenic
1069623138 10:69850080-69850102 CTGGGTGAGCTGGAGGTGGAGGG + Intronic
1069917273 10:71795489-71795511 GAGAGTCAGCTGGAGGAAGGGGG - Intronic
1070602255 10:77873976-77873998 CAGTGTGAGCTGGAGGAGGGCGG - Intronic
1070850916 10:79560890-79560912 CAGGTTCAGCTGGAGGAGTCAGG + Intergenic
1070856281 10:79610384-79610406 CAGGTTCAGCTGGAGGAGTCAGG - Intergenic
1071951353 10:90706015-90706037 CAGGGCCTGTTGGAGGATGGGGG + Intergenic
1072740669 10:97907236-97907258 CACGGGCAGCAGGAGGAGGAAGG + Intronic
1072996445 10:100249050-100249072 CAGGGGCAGCTGGAGGAGCATGG - Intronic
1074305990 10:112278905-112278927 CAGGGTCAGCTGAGAGATGGGGG + Intergenic
1074757469 10:116635119-116635141 CAGGGTGGGCTGGAGGGGGAAGG + Intronic
1075668268 10:124245831-124245853 CAGGGACTGCAGGAGGATGCTGG + Intergenic
1075979153 10:126722289-126722311 CAGGGCCAGCTGGGGGATGGAGG + Intergenic
1076208211 10:128620139-128620161 ATGGGTCAGGTGGATGATGAAGG - Intergenic
1076568227 10:131413209-131413231 CAGAGTCAGCTGGTGGAGGCTGG + Intergenic
1076608073 10:131702188-131702210 CAGGGTTTGCTGAAAGATGAGGG - Intergenic
1076942685 10:133620321-133620343 CAGTGGAAGCTGGAGGATGCCGG - Intergenic
1076963699 10:133787274-133787296 CAGGGTCAGGGTGAGGGTGAGGG + Intergenic
1076980177 11:199930-199952 CAGGGTCACCTGGGAGAGGAGGG - Exonic
1077023202 11:428728-428750 CAGGGTCAGGACGAGGATGACGG + Exonic
1077709375 11:4520612-4520634 CAGGGCCAGTTGGAGGGTGTGGG - Intergenic
1080119539 11:28661293-28661315 CAAGGTCAGATGTAGGAGGATGG + Intergenic
1080381569 11:31777266-31777288 CAGGGTCACAAGGAGGAGGATGG - Intronic
1080817098 11:35769113-35769135 CTGGGTCAGGTGGAGGCTGTGGG - Intronic
1080934493 11:36848107-36848129 CAGGGTCTGTTGGGGGGTGAGGG + Intergenic
1081598339 11:44474682-44474704 CAGGGTCACCTTGCTGATGAGGG - Intergenic
1084943908 11:72628833-72628855 CAGGGGCAGCTGGAGGGAAAAGG - Intronic
1088397308 11:109382782-109382804 CAGGGCCAGGTGGAGGATGCGGG + Intergenic
1088416071 11:109590432-109590454 CAGGGCCTGTTGGAGGGTGAGGG - Intergenic
1088501395 11:110486851-110486873 CAGGGCCAGCTGGAGGGAGAGGG + Intergenic
1090247563 11:125227377-125227399 GAGGCTGAGGTGGAGGATGAGGG - Intronic
1090922030 11:131215183-131215205 CAGGGTCTGGAGTAGGATGATGG - Intergenic
1090961238 11:131558755-131558777 TAGTGTCAGCTGGAGGAGAAGGG + Intronic
1090961965 11:131565173-131565195 AAGGGTCAGCTGCAGGAAGGGGG - Intronic
1091156966 11:133383075-133383097 CAGGGTGACCAGGAGGATGTTGG - Intronic
1091297702 11:134485534-134485556 CAGGGGCAGCAGAAGGATGTGGG + Intergenic
1091301499 11:134510764-134510786 CAGGGGCAGCTGGAGGAGCAGGG - Intergenic
1091633729 12:2181853-2181875 GAGGAACAGCTGGAGGATGCAGG + Intronic
1091684652 12:2553121-2553143 CAGGGCTAGCTGGAGGTTGGTGG - Intronic
1091784797 12:3236770-3236792 CAGGTTCAGCAGGAGGGAGAGGG + Intronic
1092239217 12:6827179-6827201 CAGGGTCAGCTGGGGAAAGATGG - Exonic
1093843296 12:23933216-23933238 CAGGGTTAGCTGGAGCAGGATGG - Intronic
1094208911 12:27869849-27869871 CAGTGCCAGCAGGAGGATGGCGG + Intergenic
1095260499 12:40093755-40093777 CGGGGTCAGCTGGAAAAGGAGGG + Intronic
1097054697 12:56242609-56242631 CAGGGGCAGCTAGAGGATGAGGG - Exonic
1098519929 12:71423621-71423643 CAGTGTGAGCAAGAGGATGATGG - Intronic
1099024386 12:77447551-77447573 CAGCCACTGCTGGAGGATGAGGG - Intergenic
1100178361 12:92056747-92056769 CAGGGTCTGTTGAGGGATGAAGG - Intronic
1100430791 12:94530286-94530308 TGGGGTCAGCTGGAAGAGGAAGG - Intergenic
1100823861 12:98456867-98456889 CAGCGTGAGCAGCAGGATGAAGG + Intergenic
1100913726 12:99393970-99393992 CTATGTCAGCTGGAGGATGCAGG - Intronic
1101733265 12:107443949-107443971 CAGGGTCACCTAGATGAGGATGG + Intronic
1102218806 12:111180454-111180476 CAGGGACAGCTGGCGGCTGAAGG - Intronic
1102718926 12:114999700-114999722 CAGGGTCAGCAGGGTGGTGAGGG - Intergenic
1102745760 12:115247642-115247664 CAGGGTCATCTGGAGGACTGAGG - Intergenic
1103328309 12:120136540-120136562 CAGGTTCAGCTGGAATGTGAAGG - Exonic
1103615534 12:122149382-122149404 CAGAGGCAGCTGGAGCAGGATGG - Intergenic
1104071535 12:125350084-125350106 CAGTGTCCTCTGGAGGAGGAAGG + Exonic
1104194966 12:126528005-126528027 TAGGGACAGCTGGAGCATGTGGG - Intergenic
1104645655 12:130495471-130495493 CAGGGTGACCTGGAGGGAGAGGG - Intronic
1104715436 12:131013116-131013138 CAGGGCCAGGAGGAGGGTGAGGG - Intronic
1105202223 13:18190556-18190578 CTGGGACACCTGGATGATGAAGG - Intergenic
1105210204 13:18253001-18253023 CAGGGTGAGCTGGAGGCCTACGG + Intergenic
1105291826 13:19058336-19058358 CAGGCCCAGCAGGAGGGTGATGG - Intergenic
1105837978 13:24227117-24227139 CTGGGTGAGATGAAGGATGAAGG + Intronic
1107145778 13:37059440-37059462 CAGAGCCCGCTGGAGGAAGACGG - Intronic
1108045842 13:46383648-46383670 AAAGGGCAGCTGGAGGATGGGGG + Intronic
1111102772 13:83609565-83609587 CAGGATTAGCAGGAGTATGAGGG + Intergenic
1112578957 13:100662196-100662218 CAGGGTGAGGTGGAGGAGGGTGG - Intronic
1112578978 13:100662242-100662264 CAGGGTGAGGTGGAGGAGGGTGG + Intronic
1112776232 13:102846431-102846453 CAGTGGCATCTGCAGGATGATGG + Intronic
1113059744 13:106309430-106309452 CAGGGCCTGCTGGAGGGTGGGGG + Intergenic
1113110088 13:106813687-106813709 CGGGGCCTGCTGGAGGGTGAGGG + Intergenic
1113386869 13:109857071-109857093 CAGGGTAAGCAGGAAGATGATGG + Intergenic
1115701236 14:35955065-35955087 CAGGGTCAGATAGACGATGTGGG + Intergenic
1115735717 14:36327114-36327136 CAGGGTCTGCTGGAGGGAGGAGG - Intergenic
1117053289 14:51884407-51884429 CAGGGTCATCTAAAGGATAAAGG - Intronic
1117558718 14:56912876-56912898 CAGAGTCAGGGGAAGGATGAGGG + Intergenic
1118077133 14:62311710-62311732 CAGGGGCAGCTGGAAGGTGAGGG + Intergenic
1118780529 14:69004842-69004864 CAGGGAGAGCTGGGGGAAGAGGG - Intergenic
1118973151 14:70654242-70654264 CAGAGAGAGCTGGGGGATGAGGG - Intronic
1119204482 14:72783883-72783905 CAGGGGCAGCGGCAGGATGGGGG + Intronic
1119295667 14:73531079-73531101 TGGTGTCAGCTGGAAGATGAGGG - Intronic
1119299313 14:73558796-73558818 TGGTGTCAGCTGGAAGATGAGGG - Exonic
1119323875 14:73747097-73747119 GAGGGCCAGCTGGAGGAGGTAGG - Intronic
1119508952 14:75196369-75196391 CAGGGTCACCTGGGGGCTGTGGG - Intergenic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1119640820 14:76313566-76313588 CAGGCTCAGGTGCAGGAAGAGGG + Intronic
1122455143 14:101844416-101844438 CAGGGGCAGCCGGGGGATCAGGG - Intronic
1122849027 14:104516705-104516727 CAGGGTAGGCAGGAGGCTGAGGG + Intronic
1122886065 14:104710961-104710983 CAGGATCAGCTGGCAGAAGATGG - Exonic
1123026130 14:105425121-105425143 CAAGTTCAGCAGGAGGAGGAAGG - Intronic
1124022034 15:25933880-25933902 CTGGATCAGCTGGAGTTTGAAGG - Intergenic
1124094158 15:26633318-26633340 CAGGGTCAGCTGCAGTAGGATGG - Intronic
1124558724 15:30751019-30751041 CATGAAAAGCTGGAGGATGAAGG - Intronic
1124578216 15:30927842-30927864 CAGGGTCTGGTGTGGGATGAGGG - Intronic
1124689778 15:31812215-31812237 CAGGGTCAGCTGGGGCATTCTGG - Intronic
1125034318 15:35106495-35106517 CAGGGTCACTCAGAGGATGATGG + Intergenic
1125798801 15:42425948-42425970 CAGGGTTGGCTGGGGGATGAAGG - Intronic
1125931630 15:43604342-43604364 CAGGGTGAGATGAAGGAAGAAGG - Exonic
1125944734 15:43703822-43703844 CAGGGTGAGATGAAGGAAGAAGG - Intergenic
1127148335 15:56048666-56048688 TAGGGTCAGCAGGAGAATGAAGG + Intergenic
1129295782 15:74599325-74599347 CAGCGTCAGCTGGTGGATCCAGG - Intronic
1129390069 15:75215960-75215982 CTGGGCCAGCTGGAGGTTTAGGG - Intergenic
1129718945 15:77867174-77867196 GAGGGGCAGCAGGAGGGTGAAGG - Intergenic
1130018171 15:80203150-80203172 CAGGGACAGCTTTAGGAGGAGGG + Intergenic
1130459986 15:84153679-84153701 GAGGGGCAGCAGGAGGGTGAAGG + Intergenic
1131053612 15:89363041-89363063 CAGGGTCGGCTGGAAGTTGTGGG + Intergenic
1131856768 15:96605629-96605651 CAGGAGGAGCTGGAAGATGACGG + Intergenic
1132603378 16:783707-783729 CTGGGTCTTCTGGAGGCTGACGG + Intergenic
1133423999 16:5671846-5671868 CAGTGTGAGCTGGGGGTTGAAGG + Intergenic
1135634469 16:24062274-24062296 CAGTGTCAGCTGGAGGGACAGGG + Intronic
1137966119 16:52935612-52935634 CTGGGGCAGCTGGAGGAGCACGG - Intergenic
1139428374 16:66897165-66897187 CAGGGCCAGCTGGAGCAACATGG - Intergenic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1139985188 16:70893110-70893132 CAGGGTCTCCTGGAGCATGGCGG - Intronic
1140506705 16:75478140-75478162 CATGGTGAGAAGGAGGATGAAGG - Exonic
1141173639 16:81705615-81705637 CCGGGGCAGCTGGGGGGTGAGGG + Intronic
1141813401 16:86391973-86391995 CAGTGTCTGCTGGAGGAGGCAGG - Intergenic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1142103094 16:88285918-88285940 CAGGGTCAGCAGGAGTCTCATGG - Intergenic
1142183313 16:88682113-88682135 CATGGGCACCTGGAGGATGCCGG - Intronic
1142600781 17:1052526-1052548 CAGGGTCAGAGGGAGGGTGCCGG + Intronic
1142902069 17:3018303-3018325 CAGGGCAAGCTGGATGATGGTGG + Intronic
1143167185 17:4902639-4902661 CAGGGTGACCTTGAGGCTGATGG + Exonic
1143720664 17:8806840-8806862 CATGGTGAGCTGGAGTAAGAAGG - Intronic
1144338340 17:14292700-14292722 CAGGGCCTGCTGGGGGATGGGGG - Intergenic
1144468989 17:15520079-15520101 CTTCCTCAGCTGGAGGATGAAGG - Intronic
1144566622 17:16364623-16364645 CAACATCAGCTGGAGGATGATGG + Intergenic
1145912188 17:28549257-28549279 CAGGGGCAGCTGTGGGGTGAGGG - Intronic
1146255305 17:31388841-31388863 CAGGGCCGGCTGCAGGGTGAAGG - Intergenic
1147266702 17:39238607-39238629 CAGGGTGAGCTGGAGGTGGTAGG + Intergenic
1147513813 17:41097371-41097393 CAGAGTCAGCGGGATGGTGATGG + Exonic
1147562657 17:41518645-41518667 CAGGGTCAGGAGGAGGATATGGG - Exonic
1147677493 17:42218343-42218365 CAGGGACAGATGCATGATGAGGG + Intronic
1147684238 17:42277102-42277124 CAGGGTCATCTGTAGGATCCAGG + Intergenic
1147743238 17:42680384-42680406 CAGGGCCAGCTGGAGCAGGTGGG + Exonic
1147981933 17:44280157-44280179 CAGGGTCAGGGGAAGGAAGAGGG - Intergenic
1148670281 17:49404995-49405017 CTGGGGCAGCTGGAGGAGCACGG + Exonic
1148753091 17:49957156-49957178 CAGGATTAGCTGGAGAATAAAGG + Intergenic
1148891746 17:50812544-50812566 CAGGGTTTCCTGGAGGGTGATGG + Intergenic
1148999170 17:51739478-51739500 CAGAGTCAAGTGGAGGAGGATGG + Intronic
1149206443 17:54253603-54253625 CGGGGACATCTGGAGGCTGAGGG - Intergenic
1149655312 17:58306736-58306758 CAGGGTCAGGTGGAGTTGGAAGG + Intronic
1150143720 17:62750934-62750956 CGGGGGCAGCTGGAGGATTGAGG - Intronic
1150638310 17:66932084-66932106 CAGGGTGAGCTGGTGAAGGAAGG - Intergenic
1151161699 17:72171306-72171328 CAGGGTTAGTGGGTGGATGAGGG - Intergenic
1151428909 17:74049512-74049534 TAGCGTAAGCTGCAGGATGAGGG - Intergenic
1151819738 17:76491053-76491075 CTGGACCAGCTGCAGGATGAGGG - Intronic
1152103114 17:78314271-78314293 CAGGGTGAGCGGGAGGAGGGAGG + Intergenic
1152408287 17:80109739-80109761 CAGGACCAGCTGGCTGATGAGGG - Intergenic
1152630320 17:81408080-81408102 CAGGGGCAGCAGGAGGAAGGGGG - Intronic
1154110843 18:11567332-11567354 TAGGGTCAGATGGAGGCTGAGGG + Intergenic
1156465546 18:37346131-37346153 CTATGTCTGCTGGAGGATGAGGG + Intronic
1157819350 18:50754123-50754145 CTGGGTCAGCTGGAGGATCTGGG - Intergenic
1159628720 18:70724704-70724726 CAGGGTCAGGTTGAAGACGAGGG + Intergenic
1159706468 18:71695634-71695656 CAGGGGCATCTGAAGGATGTCGG - Intergenic
1159833125 18:73303061-73303083 CAGGATGAGGAGGAGGATGAGGG - Intergenic
1160099524 18:75906990-75907012 CAGGCTGAGCTGGAGGAAGAAGG + Intergenic
1160208672 18:76858725-76858747 CAGGTGCAGGTGGAGGAGGAAGG + Intronic
1160208699 18:76858813-76858835 CAGGTGCAGGTGGAGGAGGAAGG + Intronic
1160208769 18:76859033-76859055 CAGGTGCAGGTGGAGGAGGAAGG + Intronic
1160274017 18:77413633-77413655 CTGAGCCTGCTGGAGGATGATGG + Intergenic
1160398345 18:78588652-78588674 CAGAGCAAGCTGGAGAATGAGGG + Intergenic
1160408589 18:78659777-78659799 CAGGGACAGCTGGGGGATGGTGG - Intergenic
1161161283 19:2763029-2763051 CAGGGGCTGCTTGTGGATGACGG - Intronic
1161349137 19:3782888-3782910 CTGGCTCAGATGGTGGATGATGG + Intronic
1161513083 19:4682596-4682618 CAGGGCCAGCTGGGGCAGGAGGG + Intronic
1161865220 19:6828308-6828330 CAGGGTCAGCAGTACGATGGAGG + Intronic
1161944709 19:7428351-7428373 CAGGTTCTGCTGGAAGGTGAAGG - Intronic
1161964403 19:7540324-7540346 CAGGGGCTGCTGCAGGAGGATGG + Intronic
1162109321 19:8391499-8391521 TAGGGACAGCTGGAGGAAGCCGG + Intronic
1163497606 19:17655815-17655837 CAGGGTCAGCAGGGCTATGATGG - Intronic
1163510885 19:17734259-17734281 CAGGGTCACCTGCAGGTGGAGGG - Exonic
1164906616 19:31973465-31973487 CAGAGCCATCTGGAGGATGCTGG + Intergenic
1165067469 19:33237406-33237428 CAGGGGCAGGTGGAGGACGAGGG - Intergenic
1165425150 19:35741321-35741343 CCGGCTCAGTTGGGGGATGAGGG - Intronic
1165648722 19:37467658-37467680 CCGGGTCAGCTGGAGCCTTAAGG + Intronic
1167090572 19:47341131-47341153 CATGGTCAGCAGGATGATGGAGG - Exonic
1167209823 19:48127234-48127256 CAGGGGCAGCTGAGGGGTGACGG - Intronic
1167285331 19:48596043-48596065 CAGGGTCAGCTGGGGTGTGGGGG + Intronic
1167591485 19:50406775-50406797 CAGGGCCAGAGGGAGGAGGAGGG - Intronic
1168326616 19:55541818-55541840 CAGGTTGAGGTTGAGGATGATGG - Intronic
1202713380 1_KI270714v1_random:29140-29162 CAGGGTCACCTGGAAGGGGAGGG + Intergenic
925281305 2:2687173-2687195 CAGGGCCTGCTGGGGGATGGAGG + Intergenic
925333239 2:3074882-3074904 GAGGGACACCTGGAGGCTGAGGG - Intergenic
925446904 2:3934327-3934349 CAGGGCCTGTTGGAGGGTGAGGG - Intergenic
926161274 2:10491248-10491270 GAGGAGCAGCTGGAGGCTGAGGG + Intergenic
926633011 2:15154699-15154721 CAGGGTCAGCTTGATGACTAGGG - Intergenic
927139149 2:20118066-20118088 CAGGAGCAGCTGGAGGAGCAGGG + Intergenic
928194752 2:29207139-29207161 CAGGGATACCTGGAGGATGATGG + Intronic
928203994 2:29271164-29271186 CAGGGTCTGAGGGAGGATGCAGG + Intronic
930595421 2:53381645-53381667 CAGGGGTAGCTGTAGGAAGAAGG - Intergenic
930916307 2:56693014-56693036 TAGGGCCTGCTTGAGGATGAAGG + Intergenic
931254470 2:60557743-60557765 CGGGCTGAGCTGGAAGATGAAGG + Intergenic
932094656 2:68837014-68837036 CAGTGTTAGCGTGAGGATGAGGG + Intergenic
932450520 2:71807842-71807864 ATTGGTCAGCTGTAGGATGAAGG + Intergenic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
933231127 2:79808942-79808964 CAGGGTCTGTTGGGGGATGGGGG - Intronic
935106599 2:100050746-100050768 CAGGGACTGCTGGGAGATGAGGG - Intronic
935667928 2:105529248-105529270 CAGGGCCTGCTGGGGGATGGGGG - Intergenic
937141475 2:119605601-119605623 CCTGGTGAGGTGGAGGATGATGG - Intronic
937342719 2:121101479-121101501 AAGGGTCGGCTGGTGCATGAGGG + Intergenic
937912506 2:127082317-127082339 CAGGGGCCCCTGGAGCATGAGGG - Intronic
938083143 2:128380882-128380904 CAGGATGAACTGGAGGGTGAGGG - Intergenic
938409479 2:131052286-131052308 CAGAGTCAGCTGGAGACTAACGG + Exonic
939036372 2:137136136-137136158 CAGGGCCTGCTGGGGGGTGAGGG + Intronic
939318672 2:140586574-140586596 CAGTGTCACCTAGAGGATGATGG - Intronic
940485022 2:154287400-154287422 CTGGGGCAGCTGGAGGAGCATGG - Intronic
942497420 2:176554202-176554224 CAGGGTCAGCTCGTGTGTGAAGG - Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
944845548 2:203664492-203664514 CAGGGCCTGCTGGGGGATGGGGG - Intergenic
944856746 2:203775490-203775512 CAGAGCAAGCTGGAGGATGGGGG - Intergenic
944954925 2:204798186-204798208 CAGCGGCTGCTGGGGGATGAGGG - Intronic
945050741 2:205821913-205821935 CAAGCTCAGCTGGAGGAGGAAGG + Intergenic
946095827 2:217273450-217273472 CTGGGGCAGTTGGAGGAGGATGG - Intergenic
946373757 2:219296301-219296323 CGGGGTCAGCATGACGATGACGG + Exonic
947344986 2:229181131-229181153 CAGAATTAGCTGGAGGGTGAAGG - Intronic
947570407 2:231229237-231229259 CAGCCTTAGCTGCAGGATGAGGG - Intronic
948027481 2:234789579-234789601 CAGGGCCAGCTGGAGTCAGATGG + Intergenic
948457656 2:238114330-238114352 CGGGGTCTGCAGGAGTATGAGGG - Intronic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1169043524 20:2516807-2516829 GAGGGTCAGGTTGAGGATAAAGG + Intronic
1169959477 20:11143076-11143098 CAGGTTTGGCTGGAGGAAGATGG + Intergenic
1170788203 20:19486008-19486030 CAGGGTCAGCTGCAGTGTGGGGG + Intronic
1170791211 20:19511051-19511073 CAGGGTCAGCAGCAGGGTGGGGG - Intronic
1170821494 20:19758636-19758658 GAGGGACAGCTGGAGGGTGCAGG + Intergenic
1171179832 20:23084396-23084418 CAGGGCCAGCAGGAGTAGGATGG + Exonic
1172191204 20:33062974-33062996 TGGCCTCAGCTGGAGGATGAAGG + Intronic
1172221281 20:33276726-33276748 CAGGGACAGCCTGAGGAGGAGGG + Intronic
1172639604 20:36432729-36432751 CAGGGTCAGGGGTGGGATGAGGG + Intronic
1172793449 20:37521574-37521596 GAGGGTCAGCGCGAGGAGGACGG - Intronic
1173262196 20:41446560-41446582 CAGAGGCAGCTGGAGGGGGAGGG - Intronic
1173863387 20:46298588-46298610 GTGGGTGGGCTGGAGGATGATGG + Intronic
1174078887 20:47957168-47957190 CAGGGGCACCTGGAGGCTGCTGG - Intergenic
1174105207 20:48157021-48157043 CAAGGGCAGTTGGAGGCTGAAGG + Intergenic
1174171368 20:48620016-48620038 CAGGGCCAGCTGCAGGGTGGGGG + Intergenic
1174286271 20:49475936-49475958 CAGGGTTGTCTGAAGGATGAAGG - Intronic
1174361573 20:50032067-50032089 CAGCATCAGGTGGAGAATGAGGG + Intergenic
1174362053 20:50035051-50035073 CAGCATCAGGTGGAGAATGAGGG + Intergenic
1174657867 20:52186812-52186834 CAGGTACAGCTGGAGCATGGGGG - Exonic
1174765633 20:53251254-53251276 TAGGGTCACTTGGAGAATGAAGG - Intronic
1174846443 20:53947934-53947956 CAGGGTTAGCATGAAGATGAAGG - Intronic
1175242711 20:57561580-57561602 CTGGGCCAGATGGAGGAAGAGGG + Exonic
1175317398 20:58058617-58058639 CAAGGTGGGTTGGAGGATGACGG - Intergenic
1175802551 20:61809288-61809310 GATGGTCAGCGGCAGGATGATGG + Intronic
1176159223 20:63640219-63640241 GACGGTCAGCTGGAGGATGGCGG - Exonic
1176268995 20:64225701-64225723 CAGGGTCAGCTGCAGGAATCTGG - Intronic
1176715723 21:10347452-10347474 CTGGGACACCTGGATGATGAAGG + Intergenic
1177579858 21:23007631-23007653 CACTCTCAGCTGGAGGCTGAAGG + Intergenic
1179353037 21:40631490-40631512 CTGAGTCAGCTGGAGGAAAACGG - Intronic
1180184856 21:46134455-46134477 CAGGGTCAGGGTGAGGGTGAGGG + Intergenic
1180602617 22:17032501-17032523 CTGGGACACCTGGATGATGAAGG - Intergenic
1181417357 22:22770330-22770352 CACTGTCAGCTGGAGGCTCAGGG - Intronic
1181534603 22:23534931-23534953 CAAGGCCAGCGGGAGGCTGAGGG + Intergenic
1181778729 22:25178167-25178189 GATGGTCAGCTGGAGGACGGCGG - Intronic
1182041024 22:27239234-27239256 CAGCTGCAGCTGGAGGAGGAAGG + Intergenic
1182069700 22:27454956-27454978 CGGGGTCAGCTGGGTGATCAAGG - Intergenic
1182769162 22:32781276-32781298 GAGGGTGAGAGGGAGGATGATGG - Intronic
1182888494 22:33796706-33796728 CAGAGCCAGGTGGAGGAGGAGGG + Intronic
1183080545 22:35453043-35453065 CAGGGGCAGGGGGAGGGTGACGG + Intergenic
1183915630 22:41116368-41116390 CAGGGCCTGCTGGGGGATGGGGG - Intronic
1184238762 22:43200593-43200615 CAGGGTCAGCTGTAGTTTAACGG + Exonic
1184716920 22:46287718-46287740 CTGGGTCAGCAGTACGATGAGGG + Intronic
1184759385 22:46536364-46536386 CGCGTGCAGCTGGAGGATGAGGG + Exonic
1184877068 22:47282725-47282747 CAGAGTAAGCTGGAGGCTGGGGG - Intergenic
1185056424 22:48580980-48581002 CAGCGTCTGCTGGAGGGTCAGGG - Intronic
1185082629 22:48718293-48718315 CCGGGGCTGCTGGAGGAAGAAGG + Intronic
1185092800 22:48785373-48785395 CATGGACAGCAGGAGCATGAAGG + Intronic
1185323100 22:50210848-50210870 CAGGTGGAGCTGGAGGAAGACGG + Exonic
1185415846 22:50709807-50709829 CAGAGTCTGGGGGAGGATGAAGG + Intergenic
949286409 3:2411169-2411191 CGGGGTCAGGGGCAGGATGAGGG + Intronic
949368641 3:3310460-3310482 CAGTGTGAGCTGGAGGCAGAGGG - Intergenic
950248667 3:11445515-11445537 TAGGGTCTGGTGGAGGATGGAGG + Intronic
950550418 3:13662723-13662745 CAGGAGCAGCTGGGGCATGAGGG - Intergenic
950665935 3:14494981-14495003 CAGGGTCACCTGGAAGCAGAAGG + Exonic
950932406 3:16803606-16803628 CAGAGGAAGCTTGAGGATGAGGG + Intronic
951424066 3:22521308-22521330 CAGGGCCAGCTGGGGGAGGGGGG + Intergenic
952883544 3:37999450-37999472 CTGGGTTAGCTGGGGGAAGATGG + Intronic
952958449 3:38575246-38575268 CAGGGACGGCTGGAGGAGGAGGG - Intronic
953980666 3:47411342-47411364 CGGGGTCAGCTGGGGGATGTGGG + Exonic
954870579 3:53764661-53764683 CAGGGGCAGCGGGAGGAGCAGGG - Intronic
955737702 3:62057322-62057344 CAGTGTAAACTGGAGGATGAAGG - Intronic
955875093 3:63480682-63480704 TTGGTTCAGCTGGAAGATGAAGG - Intronic
956144974 3:66183152-66183174 CAGGGTCAGCTTCAGGCTGAGGG - Intronic
956145058 3:66183824-66183846 CAGGGTGAGGGTGAGGATGAAGG - Intronic
956146692 3:66198036-66198058 CAGGGTCAGCGTCAGGCTGACGG + Intronic
956146912 3:66199508-66199530 CAGGGTCAGGTTGAGGATTGAGG - Intronic
957395295 3:79628471-79628493 CAGGGCCTGTTGGGGGATGAGGG + Intronic
958085534 3:88801358-88801380 CAGGGCCTCCTGGAGGGTGAGGG - Intergenic
958803049 3:98778475-98778497 CAAGGAGAGCTTGAGGATGAGGG + Intronic
960636798 3:119792528-119792550 CTGGGGCAGCTGGAGGAGCACGG - Intronic
961820368 3:129572740-129572762 CAGGGGCAGCTGTGGGAGGAAGG + Exonic
962630729 3:137272814-137272836 CAGGGTCACCTCTAGGGTGAGGG + Intergenic
962826284 3:139103063-139103085 CAAGGTCAGGTGGAGGGAGATGG - Intronic
964419539 3:156486688-156486710 CAGGGCCTCCTGGAGGATGAAGG + Intronic
964472670 3:157071146-157071168 CAGGATCAGCTTGAGGAAGAGGG - Intergenic
965531496 3:169774488-169774510 CAGAGTCAGGTGAAGGCTGATGG + Exonic
968502629 4:958138-958160 CATGGCCAGCTGGAAGATGCTGG - Exonic
969339071 4:6529120-6529142 AGGGGGCAGCTGGAGGACGAGGG + Intronic
969348070 4:6581614-6581636 CAAGGTGAGATGGAGGATAAAGG - Intronic
969348633 4:6585013-6585035 GAGTGCCAGCTGCAGGATGAAGG - Intronic
969412945 4:7041894-7041916 CATGGGCAGCTGTCGGATGAGGG - Exonic
969842152 4:9890613-9890635 CAGGGTCAGCGTGATGGTGAGGG + Exonic
969884907 4:10206697-10206719 CAGTGTGAGGTGGGGGATGACGG + Intergenic
970166394 4:13242745-13242767 CAGGGTTAGGAGGAGGATGTAGG - Intergenic
971965478 4:33549956-33549978 CAGGGTCAGCCCCAGGATTATGG + Intergenic
972143379 4:35989669-35989691 CAGGGTCTACTTGAGGGTGAAGG + Intronic
972268774 4:37488852-37488874 AAGGGTCAACTGGAGGACTAAGG - Intronic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
974604904 4:64139632-64139654 CAGGGGCAGTTGGGGGATGGGGG - Intergenic
976042051 4:80898427-80898449 CAGGTTCAGCTGGCAGAGGAAGG - Intronic
980464253 4:133152317-133152339 CATGGCCAGCAGGAAGATGAAGG - Exonic
982635529 4:157891741-157891763 CAAGTTCAGTTGCAGGATGAGGG - Intergenic
984023573 4:174516472-174516494 CAAGGTCTACTTGAGGATGAAGG + Intronic
984330987 4:178318002-178318024 GAAGGTCAGCTGGCGGGTGAGGG - Intergenic
985235185 4:187865118-187865140 CAGGGCCTGCTGGAGGGTGGGGG - Intergenic
986019492 5:3787890-3787912 CAAGGTCAACTGGAGGAGAAAGG + Intergenic
987259151 5:16186360-16186382 TACGGTCAGCTGGAGGAGGGTGG - Intergenic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
988316387 5:29635089-29635111 CAGGATCAGCTGTGGGCTGAAGG - Intergenic
988611960 5:32735245-32735267 CAGAGCCAGATGGAGGAGGAGGG - Intronic
989289805 5:39750028-39750050 CAGGGCCAGCTTGAGGTTGGAGG - Intergenic
991246328 5:64512066-64512088 CAAGGTGTGCTGGAGGATGTTGG - Intronic
993340409 5:86718453-86718475 CAGGATCAGCTGGACTATGCAGG + Intergenic
993786366 5:92143213-92143235 AAGGGTCAGCTGGATGATCCAGG + Intergenic
994413800 5:99442566-99442588 AAGGGTCATCAGGAAGATGATGG - Intergenic
995315014 5:110759814-110759836 CAGGGTCAGAAGTAGGAAGATGG + Intronic
995390259 5:111632917-111632939 CAGGGTAAGCTGGAGTATATTGG + Intergenic
995814602 5:116153302-116153324 CAGGCTCATTTGGAGGCTGAGGG + Intronic
996743586 5:126825713-126825735 CAGGGTCAGCTGGTGTGTAAAGG + Intronic
996752015 5:126898053-126898075 AAGGGACAGCTGGAGAGTGAAGG + Intronic
996965216 5:129299919-129299941 CAGGGTCTGTTGGGGGGTGAAGG - Intergenic
999300579 5:150487691-150487713 CATGGGCAGCTGGAGCAGGAGGG + Intronic
999370504 5:151052314-151052336 CAGGCTGAGCTAGAGGATGGTGG + Intronic
999397352 5:151238492-151238514 CAGGGTGAGCTGGAGGCAGCAGG - Intronic
999727724 5:154450658-154450680 CAGTGTCAGTTGGGTGATGATGG - Intronic
1000479027 5:161747932-161747954 CAGGGCCTGTTGGAGGATGGGGG - Intergenic
1000683420 5:164216123-164216145 AAGGGTCAGTTGTAAGATGAAGG - Intergenic
1000978596 5:167792343-167792365 CTGGGACAGCCTGAGGATGAAGG + Intronic
1002454354 5:179337840-179337862 CAGAGTCAGCTGGGAGGTGAAGG - Intronic
1002454376 5:179337939-179337961 CAGAGTCAGCTGGGAGGTGAAGG - Intronic
1003006728 6:2389498-2389520 CTGGGTGTGCTGGAGGCTGAAGG + Intergenic
1003146226 6:3512821-3512843 CAGGGTCAGTTGGAGGCAGTGGG - Intergenic
1003607772 6:7580314-7580336 CATGGTGAGCTGGTGGATGGTGG - Exonic
1004128568 6:12897867-12897889 CAGGGCCTGTTGGAGGGTGAGGG - Intronic
1005139509 6:22611824-22611846 CAAGGTCAGCTTAAGAATGAAGG + Intergenic
1005441484 6:25873800-25873822 CTGGGTGACCTGGAGGAAGAGGG - Intronic
1005843993 6:29763269-29763291 CAGGGGCAGTGGGAAGATGAGGG - Intergenic
1006672378 6:35737394-35737416 CAGGGTGGGCTTGAGGAAGATGG - Intronic
1007062724 6:38956357-38956379 TGGGATCTGCTGGAGGATGATGG - Intronic
1007158681 6:39771234-39771256 CAGGGTAGGGTGGAGGAGGATGG - Intergenic
1008354508 6:50535388-50535410 CAGGGTCAAGTGGAGGATCTTGG - Intergenic
1009002169 6:57731404-57731426 CAGGGCCTGTTGGGGGATGAGGG - Intergenic
1009404896 6:63300139-63300161 CAGGCAAAGCTGGAGGAGGAAGG - Intronic
1010734724 6:79431154-79431176 CAGGAACAGCTTGAGGCTGAGGG - Intergenic
1014391657 6:120872380-120872402 CAGGGTCAGCAGGTTGATGATGG + Intergenic
1014537649 6:122634506-122634528 CAAGGTCAGCTGCAGCCTGAGGG + Intronic
1014582342 6:123154304-123154326 CAGGGTCTGTTGGGGGGTGAGGG - Intergenic
1015392487 6:132698587-132698609 CAGGGTCAGCTTGGAGCTGAAGG - Intronic
1016314297 6:142769946-142769968 GATGGTCAGCTGGAAGAGGAAGG - Exonic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1016979690 6:149843056-149843078 CACGGTCAGCTGGAAGGTGTAGG + Exonic
1017008178 6:150043335-150043357 CTGGGGCAGCTGGAGGAGCACGG - Intergenic
1017492758 6:154958781-154958803 CAGGGTGGGCAGCAGGATGAAGG - Intronic
1018803163 6:167238818-167238840 CAGGGCCAGCTGCAGGATTTAGG + Intergenic
1019485046 7:1285563-1285585 CAGGGACAACTGGGGGAGGAGGG - Intergenic
1019614138 7:1951269-1951291 CAGGACCAGCTGGTGGATGAAGG + Intronic
1019706090 7:2497947-2497969 CAGGGTCTGCTGGGGAAGGAGGG + Intergenic
1021185888 7:17564277-17564299 CAGGGTCTGTTGGAGGGTGGGGG + Intergenic
1021880920 7:25094463-25094485 CTGAGTCAGCTGCAGGCTGAGGG - Intergenic
1023116444 7:36867178-36867200 GATGGACAGCTGGAGAATGATGG - Intronic
1023996510 7:45162023-45162045 CAGGGGCAGCTTTAGGGTGAAGG + Intronic
1024251327 7:47507846-47507868 CAGGGACAGCTGTGGGAGGAGGG + Intronic
1026970176 7:74462925-74462947 CCAGGACAGCTGGAGGTTGAGGG + Intronic
1028257459 7:88617302-88617324 CAGAGTCATCTGGAAGATGGAGG + Intergenic
1029439968 7:100582119-100582141 CAGGGGCAGCTGGCAGATGTAGG + Exonic
1029952410 7:104601195-104601217 CAGAATCTGCTGGAAGATGAAGG + Intronic
1030570864 7:111221974-111221996 CACAGTCAGCAGGGGGATGATGG + Intronic
1031045077 7:116878654-116878676 CAGGGTCAAGTGGAGGGGGAAGG + Intronic
1032246799 7:130220230-130220252 CAGGGCACACTGGAGGATGAGGG - Intergenic
1033656794 7:143380729-143380751 CAGAGTCAGCTGGGGGGTGCTGG + Intergenic
1034348659 7:150402766-150402788 CAGGAGGAGCTGGAGGATGCGGG + Intronic
1034465160 7:151223691-151223713 CAGTGGGGGCTGGAGGATGAGGG - Exonic
1034926980 7:155130333-155130355 CTGAGGCAGCTGGAGCATGATGG - Intergenic
1035693764 8:1577836-1577858 CAGGGGCAGGTTGAGGAGGAAGG - Intronic
1036653774 8:10662577-10662599 CAGGGGAAGCGGGAGGGTGATGG - Intronic
1038284266 8:26192898-26192920 CATGGTCATTTGAAGGATGAAGG + Intergenic
1040672124 8:49704424-49704446 CAGGGTGACCTGGGGGATGGTGG - Intergenic
1041604072 8:59759561-59759583 CAGGGTCTGCTGTAGACTGAGGG + Intergenic
1045525963 8:102941525-102941547 CTTGGGCAGCTGGAGGAAGATGG - Intronic
1046638262 8:116697086-116697108 CAGGGACAGCTGGGTGGTGATGG - Intronic
1048172662 8:132122591-132122613 CAGTGCTATCTGGAGGATGAAGG + Exonic
1048582950 8:135745506-135745528 CAGGGAAAGATGGAGGATTAGGG + Intergenic
1049029352 8:140023010-140023032 CAGGGCCCACTGGAGGAGGAGGG + Intronic
1049191063 8:141287872-141287894 CAGGGGCACCTGGAGGAAGACGG + Intronic
1049350710 8:142163075-142163097 GAGAGACAGATGGAGGATGAAGG + Intergenic
1049497671 8:142944027-142944049 CAGAGTCAGCTGGGGGCTGCTGG - Intergenic
1049533931 8:143169361-143169383 GAGGGTAAGCAGTAGGATGATGG - Intergenic
1049950790 9:641745-641767 CAGGGTAAGCTGGTAGCTGAAGG - Intronic
1052064298 9:23997660-23997682 CAGGGTCAGTTGGGGGTTGGGGG + Intergenic
1052381107 9:27772012-27772034 TAGAGACAGCTGGAGGATGGGGG - Intergenic
1057268528 9:93634255-93634277 CAGGCCCAGCAGGAGGGTGATGG + Intronic
1057576923 9:96250093-96250115 CATTCTCAGCTGGAGGAAGAGGG + Intronic
1057898573 9:98929944-98929966 CAAGGTCAGCTGGTTGATAAAGG - Intergenic
1059134872 9:111795278-111795300 CAGGGTTAGCCGGAGGGCGAGGG + Intergenic
1060153030 9:121300705-121300727 CAGGGTCTGCAGGAGGCTGTTGG - Intronic
1060617752 9:125034193-125034215 AAGGGTCAGCAGGAGGTTGGAGG - Intronic
1061038265 9:128125409-128125431 CAGGGTCAGCTGCAGGCGGCTGG + Exonic
1061201109 9:129139022-129139044 CAGGATAAGCTGGAGGAGCAGGG + Intronic
1061449036 9:130658946-130658968 GAGGGTGAGCTGGAGGCTGGAGG + Intergenic
1061865750 9:133491050-133491072 GAGGAAAAGCTGGAGGATGAGGG + Intergenic
1061899595 9:133666147-133666169 CAGGGTCACCTGGAGGGGGTGGG + Intronic
1062425965 9:136506403-136506425 CAGGGTGAGGAGGAGGATGAAGG + Intronic
1185491193 X:518239-518261 CAGGCTGAGGTGGAGGATGGAGG - Intergenic
1185921675 X:4100013-4100035 CAGGGCCTACTTGAGGATGAAGG - Intergenic
1186533913 X:10327878-10327900 CAGCGTCAACTAGAGGATGGAGG + Intergenic
1187033707 X:15515139-15515161 CAGGGCCTGTTGGGGGATGAGGG + Intronic
1187614833 X:20981579-20981601 CAAAGTCACCTGGAGGATCATGG - Intergenic
1188298125 X:28475062-28475084 CAGGGCCTACTTGAGGATGAAGG + Intergenic
1189230018 X:39444878-39444900 CTGGGCCTGCTGGGGGATGAGGG + Intergenic
1189319788 X:40080772-40080794 CAGGGTCAGATGGAGGGTTGAGG + Intronic
1189559938 X:42182063-42182085 CAGGGTCAGCGTGAGGAGGAGGG + Intergenic
1190493700 X:51007134-51007156 CAGGGCCTGCTGGGGGGTGAGGG - Intergenic
1192165166 X:68823502-68823524 GAGGGGCAGCTGGAGGGTGGTGG + Intergenic
1192579875 X:72272108-72272130 CAGCGGCAGCTGGAGAATAAGGG + Exonic
1195275119 X:103274355-103274377 GAGGGACAACTGGAAGATGAGGG - Exonic
1195308691 X:103609233-103609255 GAGGGACAACTGGAAGATGAGGG + Exonic
1195418548 X:104647203-104647225 CTGGGACAGCTGGAGGAGGCAGG + Intronic
1195508813 X:105690056-105690078 CAGGGCCTGTTGGAGGATGGGGG + Intronic
1195624727 X:106996336-106996358 CAGGGTCAGCTGGAGCAGTAGGG + Intronic
1196758669 X:119180087-119180109 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1196758948 X:119182359-119182381 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1196787105 X:119430527-119430549 CAGTGTCAGCAGCAGGCTGATGG + Intronic
1197251718 X:124223865-124223887 CAGGGTCTGAGGGATGATGAGGG + Intronic
1198301986 X:135342576-135342598 CAGGAGCAGCTGGAGAATGTGGG - Exonic
1198373672 X:136016263-136016285 TTGGGGGAGCTGGAGGATGAGGG + Intronic
1199665824 X:150095659-150095681 CAGAGTCAGGAGGAGGATGGTGG - Intergenic
1199977592 X:152903595-152903617 CAGAGACAACTGCAGGATGAGGG + Intergenic
1200251712 X:154557562-154557584 CAGGCTCAGGTGAAAGATGACGG + Intronic
1200253919 X:154569246-154569268 CAGGCTCAGGTGAAAGATGACGG + Intergenic
1200263850 X:154635162-154635184 CAGGCTCAGGTGAAAGATGACGG - Intergenic
1200266055 X:154646854-154646876 CAGGCTCAGGTGAAAGATGACGG - Intergenic