ID: 920378334

View in Genome Browser
Species Human (GRCh38)
Location 1:205521508-205521530
Sequence CACTGAACAAATGAACTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 165}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920378334_920378340 16 Left 920378334 1:205521508-205521530 CCGGCCAGTTCATTTGTTCAGTG 0: 1
1: 0
2: 1
3: 9
4: 165
Right 920378340 1:205521547-205521569 CAGGGCCCACTGACAGAGATGGG 0: 1
1: 0
2: 1
3: 15
4: 175
920378334_920378339 15 Left 920378334 1:205521508-205521530 CCGGCCAGTTCATTTGTTCAGTG 0: 1
1: 0
2: 1
3: 9
4: 165
Right 920378339 1:205521546-205521568 TCAGGGCCCACTGACAGAGATGG 0: 1
1: 0
2: 0
3: 19
4: 211
920378334_920378337 -3 Left 920378334 1:205521508-205521530 CCGGCCAGTTCATTTGTTCAGTG 0: 1
1: 0
2: 1
3: 9
4: 165
Right 920378337 1:205521528-205521550 GTGGAACTGAGTGAGACTTCAGG 0: 1
1: 0
2: 2
3: 17
4: 181
920378334_920378338 -2 Left 920378334 1:205521508-205521530 CCGGCCAGTTCATTTGTTCAGTG 0: 1
1: 0
2: 1
3: 9
4: 165
Right 920378338 1:205521529-205521551 TGGAACTGAGTGAGACTTCAGGG 0: 1
1: 0
2: 0
3: 30
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920378334 Original CRISPR CACTGAACAAATGAACTGGC CGG (reversed) Intronic
901359357 1:8683394-8683416 GACTAAAGAAATGAAATGGCTGG + Intronic
902393548 1:16119886-16119908 CAATAAACAAATGAACTGTGGGG - Intergenic
902787684 1:18743657-18743679 CCCTGACCAAATGATTTGGCTGG - Intronic
904598261 1:31660104-31660126 CACTGATCAAAGGCACTGCCTGG + Intronic
905727276 1:40263907-40263929 CACTGAAGAAATGGAATGGCTGG + Intronic
906577088 1:46900708-46900730 CCCTGAACAGAGGGACTGGCTGG + Intergenic
906999830 1:50840297-50840319 CACTAAGAAAATGAAATGGCCGG + Intronic
907722096 1:56981674-56981696 TTCTGAACAAATGAAGAGGCTGG - Intergenic
908409547 1:63849272-63849294 CAATAAACAAATGAACTGAATGG - Intronic
911067928 1:93808389-93808411 CACTTAACTAATAAATTGGCTGG - Intronic
912112417 1:106359260-106359282 CCCTGAACGAAGGGACTGGCTGG - Intergenic
912449692 1:109761317-109761339 CACTGAGCAGATGCTCTGGCAGG + Intronic
912953116 1:114134218-114134240 CTCTGAACACATGCACAGGCTGG + Intronic
915472480 1:156134345-156134367 CACAGAACACAAGAACTGGAAGG - Intronic
917458627 1:175208022-175208044 CACAGAATCAAAGAACTGGCAGG - Intergenic
920378334 1:205521508-205521530 CACTGAACAAATGAACTGGCCGG - Intronic
920515591 1:206582636-206582658 AAATGAACGAGTGAACTGGCAGG - Intronic
921085283 1:211785097-211785119 CACTGAAAGAAAGAACCGGCTGG - Intronic
923478924 1:234364606-234364628 CACTGAGCAAGTGAACTTGGAGG - Intergenic
1065662850 10:28023849-28023871 AACTGAGCAAATGATCTTGCGGG - Intergenic
1065914093 10:30337967-30337989 CATTGAAAATATCAACTGGCTGG + Intronic
1070568111 10:77619424-77619446 CAGATAACAAATGAACTGCCAGG + Intronic
1072591275 10:96831046-96831068 CAATGAACAGATGGACTGGGTGG - Intergenic
1075140831 10:119833665-119833687 CACTGACCAAATAAAATGTCTGG + Intronic
1076060016 10:127406492-127406514 CACTTCACAGATGAGCTGGCAGG + Intronic
1077582324 11:3424200-3424222 CACTGAACAAATTAGCTCTCGGG - Intergenic
1078024971 11:7686194-7686216 CAGTTTACAAATGATCTGGCTGG + Intergenic
1079154278 11:17929986-17930008 CACTGAACAAATGAACAAACTGG + Intronic
1080316867 11:30959383-30959405 CACTGAACATGTGAACAGGGAGG - Intronic
1081445229 11:43124786-43124808 CAAGGAACAAATGAACTTGCTGG - Intergenic
1084038374 11:66527277-66527299 GAATGAACAAATAAACGGGCAGG - Intronic
1084190776 11:67497785-67497807 CAGAGAAGACATGAACTGGCAGG + Intronic
1084199300 11:67544636-67544658 CTCTGGACGAATGAAGTGGCCGG + Intergenic
1088985453 11:114902228-114902250 CAGAGAACAAATAAAATGGCAGG + Intergenic
1089183378 11:116598175-116598197 CACAGAATGAATGCACTGGCAGG + Intergenic
1090234292 11:125135479-125135501 CACAGAACAGATAAACGGGCTGG - Intergenic
1095390453 12:41699866-41699888 CACTTATCAAAAGAACTGACAGG + Intergenic
1097448472 12:59706264-59706286 CACTGAACAAATGACATTGGTGG - Intronic
1097782155 12:63720449-63720471 CAGTGAATAAATGAACTTGTGGG - Intergenic
1097867297 12:64569398-64569420 CACTGCACAAAGCAGCTGGCTGG - Intergenic
1098119164 12:67217578-67217600 CACTGAACAAATGAAATGGTGGG + Intergenic
1101566109 12:105907159-105907181 CATTCAACAAATGAAGTGTCAGG - Intergenic
1102832850 12:116022501-116022523 CATTGATCAAATAAATTGGCTGG + Exonic
1119067452 14:71542878-71542900 CACAGAAGAAATGAAGGGGCAGG - Intronic
1119948864 14:78723759-78723781 AATTGAAAAAATGATCTGGCTGG + Intronic
1121193655 14:92050908-92050930 CTCAGAACAGATGAACTGGCTGG - Exonic
1122061281 14:99138319-99138341 CACAGAACAAATGTGCGGGCAGG - Intergenic
1124733179 15:32217424-32217446 CACTTAACAAATGAAACAGCAGG - Intergenic
1125805665 15:42491410-42491432 CACTGACTAAAGGAAATGGCGGG - Intronic
1126498079 15:49314713-49314735 CAATGAACAAATGAACACACAGG + Intronic
1126712543 15:51475564-51475586 CACTTAAAAAAACAACTGGCTGG + Intronic
1127939279 15:63677470-63677492 CAATGAACAGATTAGCTGGCTGG + Intronic
1130900803 15:88205713-88205735 CCCTGAATAAATAAAATGGCGGG + Intronic
1134435518 16:14252997-14253019 CACTGAGCAAATGCACTTGGAGG + Intronic
1135910324 16:26554748-26554770 CACATGACAAATGAAATGGCTGG - Intergenic
1136120213 16:28128021-28128043 CACGGAACCAATGAACTGAGAGG + Intronic
1137063244 16:35811158-35811180 CACTGAACAGGTGAGCTGGGTGG - Intergenic
1137551860 16:49442943-49442965 CAAAGAACAAAGGAAGTGGCAGG + Intergenic
1138250711 16:55499788-55499810 CACTAATCAAATGGACTGGCAGG - Intronic
1139234789 16:65326258-65326280 CATTTCACAAATGAACTGACAGG - Intergenic
1140929827 16:79617215-79617237 CACTGAACCAATGAAAGAGCAGG + Intergenic
1143638416 17:8180374-8180396 CAGTTAAGAAAAGAACTGGCCGG - Intergenic
1143960159 17:10710396-10710418 CACTAAATAAAAGAACAGGCTGG - Intronic
1147054952 17:37826834-37826856 CACTGAACACATGACTTGGCCGG + Intergenic
1147778327 17:42920120-42920142 TAGGGAACAAATGGACTGGCAGG - Intergenic
1149078696 17:52629214-52629236 CCATGAACATTTGAACTGGCAGG + Intergenic
1150582844 17:66491103-66491125 CACTGAGCAAATGACATGGTGGG - Intronic
1151948607 17:77333521-77333543 CACTAAGAAAATGAACAGGCCGG - Intronic
1153110148 18:1577015-1577037 CAGAGGAAAAATGAACTGGCAGG - Intergenic
1154311192 18:13267648-13267670 GAATGAACAAATGAAGTAGCTGG - Intronic
1155314064 18:24553679-24553701 AACTGAACAAGGAAACTGGCAGG - Intergenic
1157098990 18:44712396-44712418 CACTAAACAAATGAAATAACTGG - Intronic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1158745944 18:60200312-60200334 CACTTTACAAATGAATGGGCAGG - Intergenic
1160278430 18:77462085-77462107 CACTGGAGATATGAACTGGTAGG - Intergenic
1161366133 19:3880814-3880836 CCCTGCACAAAAGAGCTGGCGGG + Exonic
1163280709 19:16315403-16315425 CACTGAACAGACCAACTGGGAGG + Intergenic
1165946876 19:39448797-39448819 CATTCAACAAATGTTCTGGCTGG + Intronic
1166864584 19:45828169-45828191 CACTGAACATAAGAACGGGAGGG + Intronic
1167848017 19:52180355-52180377 GAGTGAAGAAATGAACTGGAAGG - Intergenic
1167931304 19:52867906-52867928 TACTGAACAAAAAAAATGGCCGG - Intronic
1168397273 19:56059163-56059185 CACTGAACAATTCACCTAGCAGG + Intronic
927623180 2:24683928-24683950 CACTGAACAAATAAACTATGGGG - Intronic
929702429 2:44175431-44175453 CAGTGAACATAAGAATTGGCTGG - Intronic
932832264 2:75002042-75002064 CAGTGAATAAATGAATTGGTTGG + Intergenic
933679916 2:85090519-85090541 CACTCAACAAGTTAACTGTCAGG - Intergenic
934949609 2:98567344-98567366 CACTGAGCTCATAAACTGGCAGG + Intronic
936449219 2:112620948-112620970 CACTGAGGAAAAGAGCTGGCAGG - Intergenic
940616839 2:156059446-156059468 CCCTAAACAACTGAACTGGTTGG - Intergenic
941511413 2:166415570-166415592 CCCTGAACAGAGGGACTGGCTGG + Intronic
943729938 2:191291781-191291803 CAATGTAAAAATGAACTGTCTGG + Intronic
943939624 2:193975433-193975455 CACTGAAGAAAAAAACTAGCTGG + Intergenic
946477394 2:220021193-220021215 CACTGAACACAGGGCCTGGCAGG + Intergenic
948124501 2:235555008-235555030 CCCTCTACAATTGAACTGGCTGG - Intronic
948574583 2:238941469-238941491 CACTGGACAAAGGAAGTGGAGGG + Intergenic
1169399900 20:5270900-5270922 TACTGAACAAATGAATAGCCAGG - Intergenic
1170277094 20:14603415-14603437 CTCTGAAAAAAAGAAGTGGCTGG + Intronic
1170808372 20:19654003-19654025 GACTGTACAAATGAGATGGCGGG - Intronic
1173349293 20:42230479-42230501 CACTGAACAACTGAAGTTGTTGG + Intronic
1173927041 20:46788381-46788403 CCCTGAAATAATGAACCGGCAGG + Intergenic
1175309696 20:58003181-58003203 CACTGAACAGAGGATGTGGCGGG - Intergenic
1176210301 20:63917187-63917209 CCCTGAACAGATGGACCGGCTGG - Intronic
1178643779 21:34367660-34367682 TACTAAACAAATAAACTTGCAGG - Intronic
1178698350 21:34813419-34813441 CACAGTACAAATGAACTGAGGGG + Intronic
1179496284 21:41773149-41773171 CACTGAATAAATGAAACCGCTGG - Intergenic
1182825431 22:33260681-33260703 GACTGAACAATAAAACTGGCAGG - Intronic
1183797312 22:40130483-40130505 TAGTTAACAAATGAATTGGCCGG + Intronic
1184441820 22:44521602-44521624 CACAGAACAAATGGAGAGGCAGG - Intergenic
950219906 3:11186550-11186572 CACTGAATAAATGAAGAGGAAGG + Intronic
950888917 3:16385911-16385933 CATTGAGGAAAAGAACTGGCAGG + Intronic
952015604 3:28952984-28953006 CACAGAACAAAAGAGCTGTCTGG - Intergenic
952391915 3:32887819-32887841 CACTGAACAGATGAAAAAGCAGG + Intronic
953671445 3:44965558-44965580 CACTCAACAAATGATGTAGCTGG - Intronic
953809534 3:46100210-46100232 AACAGAACAAATGAACTTGGAGG - Intergenic
958961919 3:100518859-100518881 CACTGAACACCTAAGCTGGCTGG + Intronic
959349975 3:105249843-105249865 CACTGAACAACTGAACTTCAGGG + Intergenic
965910548 3:173769769-173769791 CAGTGAATAAATGAACAGGGAGG + Intronic
967265254 3:187685588-187685610 CCCTGAACAGAAGGACTGGCTGG + Intergenic
970450379 4:16160542-16160564 CACTGACCAAATGATCTCTCAGG - Exonic
972220035 4:36944605-36944627 CAAGGAAAGAATGAACTGGCAGG + Intergenic
973695740 4:53488921-53488943 CAGTGAACAAAAGAACTTCCAGG + Intronic
977008978 4:91611658-91611680 CACTGAAGATATAAACTGGTAGG + Intergenic
978366661 4:107989946-107989968 CACGGAACGCATGAACTGCCTGG - Exonic
978978456 4:114911227-114911249 CACTGAGCAAAAGAAGTGGTTGG - Intronic
980145204 4:128974335-128974357 CAGTAAACAAATCAACTTGCAGG - Intronic
981575531 4:146200605-146200627 CACTGCACAAAGCAACTTGCAGG + Intergenic
983885021 4:172971040-172971062 CCCTGAACAGAGGGACTGGCTGG - Intronic
984041707 4:174743450-174743472 CATTCAACAAAATAACTGGCTGG - Intronic
986196373 5:5539959-5539981 CTCTGACCACATGAAATGGCAGG - Intergenic
986932227 5:12840346-12840368 CATTGAATAACTGAAATGGCTGG - Intergenic
990842670 5:60101197-60101219 CACTGAACAAATAAAGAGGGGGG + Intronic
994130199 5:96218647-96218669 TAATGAACAAATAAACTGGAGGG - Intergenic
995409125 5:111834801-111834823 CACTGAAAATAAGAACTGGGGGG - Intronic
996343597 5:122465689-122465711 CACTGAACAACTGAATTGCCAGG - Intergenic
997059194 5:130479835-130479857 CACTGAACATATGTGCTTGCAGG + Intergenic
999922787 5:156340763-156340785 CCCGGAACAAATGTACTGCCCGG - Intronic
1000315016 5:160082146-160082168 CACTAAAGAAATTATCTGGCCGG + Intronic
1000811255 5:165864799-165864821 CACTGAACAATATAACTGGCAGG + Intergenic
1002109454 5:176898511-176898533 GAATGAATAAATGAACTAGCTGG - Intronic
1002919305 6:1555074-1555096 CCCTGAACGAATGTCCTGGCGGG - Intergenic
1003450529 6:6227329-6227351 CATTGAACAAATTAACTGTGTGG - Intronic
1010499741 6:76582840-76582862 CTCTGAACAAAGGAACTGAGAGG + Intergenic
1010752680 6:79631983-79632005 AACTAAACAAATGCACTTGCTGG - Intronic
1012271068 6:97212230-97212252 CACTCAATAAGTGTACTGGCTGG + Intronic
1012950668 6:105514647-105514669 CCCTGAACAAGTAAACAGGCTGG + Intergenic
1015790913 6:136963582-136963604 CACTGAGGAAATTAAGTGGCAGG - Intergenic
1015987707 6:138901055-138901077 CACTGATGCAATGAACTGGTAGG - Exonic
1017317219 6:153045453-153045475 CACTGAACAAATAAGCTGATTGG - Intronic
1022815575 7:33910878-33910900 CATTGTTCAAATTAACTGGCTGG + Intronic
1022940753 7:35236552-35236574 CAGTGAATAAATGAACTTGTGGG - Intronic
1024286222 7:47759992-47760014 CAGTGCACAGATGCACTGGCAGG - Intronic
1026597709 7:71748268-71748290 AACAGAACAAATGAAATGGATGG + Intergenic
1026910955 7:74091707-74091729 CAGTGAACAAATGTAGTGTCAGG + Intronic
1027353573 7:77335556-77335578 CACTGAACAAAAGAACCAGTGGG + Intronic
1040431106 8:47343395-47343417 CAATGAACTAATGAAGTGGAGGG + Intronic
1041975543 8:63795017-63795039 CACTCAAGAAATGACTTGGCTGG + Intergenic
1042729729 8:71919180-71919202 AACTGAACAGAGGAACTGGTGGG + Intronic
1044600628 8:94000317-94000339 CACTCAACAAATTAACTGAAGGG + Intergenic
1047610580 8:126516958-126516980 CACTAAACAAATAAACTTGGGGG + Intergenic
1048528066 8:135222451-135222473 CACTGAGGAAGTGAATTGGCTGG + Intergenic
1048926648 8:139277839-139277861 CACTAAACTAATGAAGTGGTGGG + Intergenic
1050399308 9:5234448-5234470 CAGTGAAGGAATGAACTGGTGGG + Exonic
1051812377 9:21064520-21064542 CACTGATCAAAAGTACTGGCTGG + Intergenic
1054891888 9:70259903-70259925 CCTGGAACAAATGAACTGGAAGG - Intronic
1055941677 9:81656190-81656212 CTGTGATCAAATGAACTGGGTGG - Intronic
1061530445 9:131207877-131207899 GACTGAGAAAATGTACTGGCTGG + Intronic
1062049613 9:134440572-134440594 CACGGAACAAACGAACTGAATGG - Intronic
1186271015 X:7888160-7888182 CGCTCAACAAATGGACTGCCTGG + Intergenic
1186711417 X:12201592-12201614 CACTCAATAAATGAAGTGCCAGG + Intronic
1186857205 X:13637892-13637914 CCCTGAACAGAGGGACTGGCTGG - Intergenic
1187837534 X:23449391-23449413 CACAGTAGAAATGAAATGGCAGG - Intergenic
1187949448 X:24457373-24457395 CAAGGCACAAATGAACTGCCTGG + Intergenic
1188105872 X:26146044-26146066 CCCTGAACAAATGCACTGATGGG + Intergenic
1189749070 X:44200527-44200549 CACTGAATCAATGAACTAGATGG + Intronic
1195981382 X:110581881-110581903 CCCTGAACAGAGGGACTGGCTGG + Intergenic
1196965943 X:121055127-121055149 TATGGAACAAATGAACTGTCTGG - Intergenic