ID: 920379821

View in Genome Browser
Species Human (GRCh38)
Location 1:205528978-205529000
Sequence CCCTGCGAGGAGCAAGGGGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 402}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920379821_920379830 4 Left 920379821 1:205528978-205529000 CCTACCCCTTGCTCCTCGCAGGG 0: 1
1: 0
2: 3
3: 28
4: 402
Right 920379830 1:205529005-205529027 GGGCTGCATCCACTACGAGATGG 0: 1
1: 0
2: 0
3: 5
4: 72
920379821_920379831 11 Left 920379821 1:205528978-205529000 CCTACCCCTTGCTCCTCGCAGGG 0: 1
1: 0
2: 3
3: 28
4: 402
Right 920379831 1:205529012-205529034 ATCCACTACGAGATGGCCACAGG 0: 1
1: 0
2: 0
3: 4
4: 35
920379821_920379836 28 Left 920379821 1:205528978-205529000 CCTACCCCTTGCTCCTCGCAGGG 0: 1
1: 0
2: 3
3: 28
4: 402
Right 920379836 1:205529029-205529051 CACAGGGAGGCCCCTCTTCCCGG 0: 1
1: 0
2: 2
3: 43
4: 296
920379821_920379837 29 Left 920379821 1:205528978-205529000 CCTACCCCTTGCTCCTCGCAGGG 0: 1
1: 0
2: 3
3: 28
4: 402
Right 920379837 1:205529030-205529052 ACAGGGAGGCCCCTCTTCCCGGG 0: 1
1: 0
2: 1
3: 44
4: 333
920379821_920379832 12 Left 920379821 1:205528978-205529000 CCTACCCCTTGCTCCTCGCAGGG 0: 1
1: 0
2: 3
3: 28
4: 402
Right 920379832 1:205529013-205529035 TCCACTACGAGATGGCCACAGGG 0: 1
1: 0
2: 0
3: 3
4: 52
920379821_920379834 15 Left 920379821 1:205528978-205529000 CCTACCCCTTGCTCCTCGCAGGG 0: 1
1: 0
2: 3
3: 28
4: 402
Right 920379834 1:205529016-205529038 ACTACGAGATGGCCACAGGGAGG 0: 1
1: 0
2: 1
3: 4
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920379821 Original CRISPR CCCTGCGAGGAGCAAGGGGT AGG (reversed) Exonic
900138903 1:1130865-1130887 CCCCGTGAGGTGCAGGGGGTGGG + Intergenic
900361073 1:2289451-2289473 CCCTGCGCGGGGCTCGGGGTTGG - Intronic
900548192 1:3240482-3240504 CAATGCCAAGAGCAAGGGGTGGG + Intronic
901222116 1:7589184-7589206 CTCTGCCAGGAGGAAGGGGAGGG - Intronic
901556241 1:10033231-10033253 TCCCGCCAGGAGCAAAGGGTAGG + Intronic
902690303 1:18106925-18106947 TCCTGCGAGGATGAAGGGGAGGG - Intergenic
903422081 1:23225244-23225266 CCCGGGGAGCAGCAAGGGATGGG + Intergenic
903659153 1:24966326-24966348 CCCTGGGAGAGGCCAGGGGTTGG - Intergenic
904038564 1:27571565-27571587 GCCTGAGGGGAGCAGGGGGTGGG - Intronic
904253564 1:29240677-29240699 CCCTGCCAGCTGCTAGGGGTGGG - Intronic
904385731 1:30140792-30140814 CCCTGCCAGCAGCCAGGGGCCGG + Intergenic
904457828 1:30657969-30657991 CACTGTGAGGAGCGAGGGGGTGG + Intergenic
905525464 1:38635145-38635167 ACCTGGGAAGTGCAAGGGGTTGG - Intergenic
905649363 1:39646282-39646304 GCCTGGGATGAGCAGGGGGTGGG - Intergenic
906058104 1:42931375-42931397 CCAGGCGAGAAACAAGGGGTTGG + Intronic
906383272 1:45346304-45346326 ACCTGTTAGGATCAAGGGGTAGG - Intronic
906781345 1:48575721-48575743 CCTTGAGGGGATCAAGGGGTGGG - Intronic
907109963 1:51918198-51918220 CACTCCCAGGAGAAAGGGGTTGG + Exonic
907857845 1:58321466-58321488 ACCTGGGAAGTGCAAGGGGTCGG + Intronic
910318845 1:85921139-85921161 ACCTGGGAAGTGCAAGGGGTTGG + Intronic
910338245 1:86156790-86156812 GCCTGGGAGGAGAAAGGGGTGGG + Intronic
913607369 1:120478341-120478363 ACCTGGGAAGCGCAAGGGGTTGG + Intergenic
914583825 1:149043493-149043515 ACCTGGGAAGTGCAAGGGGTTGG - Intronic
915980512 1:160417093-160417115 CCCTCCAAGGACCAAGGGCTTGG - Intronic
917257576 1:173132182-173132204 ACCTGGGAAGTGCAAGGGGTTGG - Intergenic
917391842 1:174545534-174545556 ACCTGGGAAGTGCAAGGGGTTGG - Intronic
917573708 1:176297032-176297054 CACCGGGAAGAGCAAGGGGTTGG - Intergenic
917869661 1:179229813-179229835 CCCTGCGAGGAGGCGGGGGCGGG - Intergenic
917969353 1:180197114-180197136 CCAGACAAGGAGCAAGGGGTGGG - Exonic
918093084 1:181314078-181314100 CCCTGGAAGGAGCACAGGGTAGG - Intergenic
918968258 1:191378746-191378768 ACCTGGGAAGTGCAAGGGGTCGG - Intergenic
919063959 1:192668898-192668920 ACCTGGGAAGTGCAAGGGGTTGG - Intergenic
919391650 1:196992464-196992486 CCCTGGGAAGTGCAAGGGGTTGG - Intronic
920304166 1:205008245-205008267 CCCCAAGAGGAGCAAAGGGTGGG + Intronic
920379821 1:205528978-205529000 CCCTGCGAGGAGCAAGGGGTAGG - Exonic
920420526 1:205830196-205830218 GACTGCCAGGAGCATGGGGTAGG + Intronic
921401460 1:214727899-214727921 ACCTGGGAAGTGCAAGGGGTCGG - Intergenic
921455485 1:215365880-215365902 ATCTGGGAGGTGCAAGGGGTTGG - Intergenic
922352619 1:224746714-224746736 CCATCTGAAGAGCAAGGGGTGGG - Intergenic
922586214 1:226736770-226736792 ACCTGCGAGGAGCATAGGCTGGG + Exonic
922745226 1:228039470-228039492 GCCTGCCAGGAGAAGGGGGTTGG - Intronic
923975133 1:239254587-239254609 CCCTGCTAGGAACAATGGCTAGG - Intergenic
924254507 1:242169319-242169341 ACCTGGGAAGTGCAAGGGGTCGG + Intronic
924952544 1:248897997-248898019 CCCAGTGAGGAGGAATGGGTCGG - Intergenic
1062998542 10:1891844-1891866 CCCTCCGTGGAGGAAGGGGCAGG - Intergenic
1064099521 10:12451366-12451388 CCTTGGGAGGAGGAAGAGGTAGG + Intronic
1064125299 10:12654647-12654669 TCCTGAGAGGAGTAATGGGTTGG + Intronic
1064364910 10:14699036-14699058 CCCTGCGAGCAGGCAGAGGTGGG + Intronic
1065381674 10:25096903-25096925 CCCTGCCAGGAGTTAGGGGAGGG + Intergenic
1065799090 10:29334830-29334852 ACCTGGGAAGCGCAAGGGGTTGG + Intergenic
1066422952 10:35278806-35278828 CCCTGCCAGGAGCCAGGGGCTGG + Intronic
1067038295 10:42934621-42934643 CCCTGGCAGGAGCAAGGAGCAGG - Intergenic
1068575085 10:58676014-58676036 ACCTGGGAAGTGCAAGGGGTTGG + Intronic
1069360196 10:67633144-67633166 CCCTGTGAGGAGGAATGGATTGG - Intronic
1069739673 10:70679439-70679461 ACCTGGGAGGAACATGGGGTGGG + Intronic
1069867892 10:71515006-71515028 CCCTGGGAGGAGCAGGGAGGGGG - Intronic
1070007143 10:72435596-72435618 ACCTGGGAAGTGCAAGGGGTTGG + Intronic
1070217685 10:74403678-74403700 ACCTGGGAAGCGCAAGGGGTTGG - Intronic
1070632395 10:78096257-78096279 ACCTGGGAAGTGCAAGGGGTTGG + Intergenic
1070812536 10:79305613-79305635 CCTAGCGAGGGGCAGGGGGTGGG + Intronic
1070936731 10:80304234-80304256 ACCTGGGAAGTGCAAGGGGTGGG + Intergenic
1072244943 10:93535156-93535178 ACCTGGGAAGTGCAAGGGGTTGG + Intergenic
1072373876 10:94794290-94794312 ACCTGGGAGGCACAAGGGGTGGG - Intronic
1073322120 10:102621707-102621729 CCCTGAGAGGAGGAAAGGGAGGG + Intronic
1073940625 10:108693916-108693938 ACCTGGGAGGTGCAAGGAGTTGG + Intergenic
1074000470 10:109367433-109367455 ACCTGGGAAGTGCAAGGGGTTGG + Intergenic
1075261262 10:120965472-120965494 CACTGTGAGGAGCAAGGCCTGGG - Intergenic
1075983995 10:126767304-126767326 ACCTGAGAAGTGCAAGGGGTTGG - Intergenic
1077210253 11:1367826-1367848 CTCTGCCAGGACCCAGGGGTGGG + Intergenic
1077320372 11:1938330-1938352 CCCTGAGAGCAGCCTGGGGTCGG + Intronic
1078283798 11:9930804-9930826 ACCTGCGAAGAGCAAGAGATTGG + Intronic
1078369893 11:10735907-10735929 CCCTGGGCGGAGCAAGGGGTGGG - Intergenic
1078429117 11:11274063-11274085 ACCTGGGAAGTGCAAGGGGTTGG + Intronic
1078659918 11:13278148-13278170 CCCCGCGAGGAGGATGGGGGCGG - Intronic
1078812051 11:14777864-14777886 ACCTGGGAAGCGCAAGGGGTCGG + Intronic
1078891604 11:15562994-15563016 CCTTGTGAGGAGCCAGGAGTGGG - Intergenic
1079131795 11:17751029-17751051 CCCTGTGAGGTGGAAGGGTTAGG + Intronic
1081180829 11:39984204-39984226 ACCTGGGAAGTGCAAGGGGTTGG + Intergenic
1081666106 11:44918076-44918098 TCCTGCTATCAGCAAGGGGTTGG + Intronic
1081682447 11:45017749-45017771 ACCTGGGAAGTGCAAGGGGTCGG - Intergenic
1081905541 11:46667236-46667258 CCCTGCAAGCAGCAAGGGTTAGG - Intronic
1083262593 11:61531294-61531316 CCCTGGGGGCAGCAAGGGGCAGG + Intronic
1083321202 11:61848138-61848160 CCCTGTGGGGAGAGAGGGGTGGG - Exonic
1083368431 11:62157978-62158000 ACCTGGGAAGTGCAAGGGGTCGG + Intergenic
1083501771 11:63115503-63115525 ACCTGGGAAGTGCAAGGGGTTGG - Intronic
1083510148 11:63202024-63202046 GCCTGGGAAGTGCAAGGGGTTGG + Intronic
1083826920 11:65209247-65209269 CCCTGCTGGGAGCACTGGGTGGG - Intronic
1084515175 11:69634102-69634124 CACTTCCAGGAGTAAGGGGTGGG - Intergenic
1086421839 11:86644940-86644962 ACCTGGGAAGTGCAAGGGGTTGG + Intronic
1086612903 11:88778391-88778413 ACCTGGGAAGCGCAAGGGGTTGG - Intronic
1088818266 11:113435775-113435797 CCCAGAGAGGAGGAAGGGCTGGG + Intronic
1091084893 11:132712106-132712128 CCCAGAGAGGAGGAAGGGGTTGG + Intronic
1091457347 12:617854-617876 CCCTGGGGTGAGCAAGGGCTTGG - Intronic
1091513695 12:1155931-1155953 CACTGAGAGGAGCAAAGGATGGG - Intronic
1092242060 12:6841237-6841259 TCCTGCCAGGAACATGGGGTCGG - Exonic
1093402230 12:18760832-18760854 ACCTGGGAAGTGCAAGGGGTAGG + Intergenic
1093932430 12:24967362-24967384 CCCTGTGACGAGGTAGGGGTAGG + Intergenic
1094057637 12:26283007-26283029 CCCTGAGAGGAGCAAGGGGAGGG + Intronic
1094759939 12:33520921-33520943 ACCTGGGAAGTGCAAGGGGTTGG + Intergenic
1095140512 12:38657082-38657104 ACCTGGGAAGTGCAAGGGGTTGG + Intronic
1095917748 12:47497448-47497470 ACCTGGGAAGTGCAAGGGGTTGG + Intergenic
1095946755 12:47758205-47758227 CCCTGCCAGGAGCTGGGGGGAGG + Intronic
1096364557 12:51017485-51017507 CCCTGAGAGAAGGAAGGAGTAGG + Intronic
1097700978 12:62819980-62820002 ACCTGGGAAGCGCAAGGGGTCGG + Intronic
1097734640 12:63168190-63168212 ACCTGGGAAGAGCAAGGGGTCGG - Intergenic
1099667870 12:85654191-85654213 CCCAGTGAGGAGCAAAGGGTTGG + Intergenic
1099740341 12:86626924-86626946 ACCTGGGAAGTGCAAGGGGTTGG + Intronic
1100748622 12:97672758-97672780 ACCTGGGAAGTGCAAGGGGTCGG + Intergenic
1101628649 12:106471403-106471425 ACCTGGGAAGTGCAAGGGGTTGG - Intronic
1101854340 12:108429751-108429773 ACCTGAGAGGAGCAAGGTGGGGG - Intergenic
1102440386 12:112959275-112959297 ACCTGGGAAGTGCAAGGGGTCGG - Intronic
1103033856 12:117640681-117640703 CCCAGGGAGGAGGAAGGGGTGGG - Intronic
1103242786 12:119428901-119428923 CCCTGGGAGGAGCAGAGGGCAGG + Intronic
1104067378 12:125316991-125317013 CCCTGCCAGGAACAAGAGGTAGG - Intronic
1104203549 12:126615098-126615120 CCCCGCGATGAGCAAGGCGTGGG + Intergenic
1104988008 12:132608227-132608249 CCCTGCGATGGGCATGGGGGAGG - Intronic
1106144435 13:27039131-27039153 CTCTGCAAGGAGGAAGGGTTTGG + Intergenic
1106326379 13:28694144-28694166 ACCTGGGAAGTGCAAGGGGTCGG - Intergenic
1106547668 13:30744562-30744584 CCCGCAGGGGAGCAAGGGGTGGG - Intronic
1108051283 13:46441423-46441445 TCATGCAAGGAGCAAGAGGTTGG + Intergenic
1108170308 13:47734964-47734986 CCCCGGGAAGTGCAAGGGGTTGG + Intergenic
1109328583 13:60900214-60900236 ACCTGCGAAGCACAAGGGGTGGG + Intergenic
1109543838 13:63815043-63815065 TCATGCAAGGAGCAAGAGGTTGG + Intergenic
1109949638 13:69483793-69483815 ACCTGGGAAGTGCAAGGGGTCGG - Intergenic
1111071248 13:83171356-83171378 ACCTGGGAAGTGCAAGGGGTCGG + Intergenic
1112333575 13:98496120-98496142 CCCTGTGGGGAGCCATGGGTGGG + Intronic
1112549831 13:100409179-100409201 CCCTGGGAGCAGCAGGCGGTGGG + Intronic
1114320318 14:21541730-21541752 AACTGCGAGGAGCAAGGAGAAGG + Intergenic
1114535181 14:23418054-23418076 CCCTGAGAGGAGAAGGAGGTGGG + Intronic
1115818408 14:37187940-37187962 ACCTGGGAAGTGCAAGGGGTTGG + Intergenic
1115856338 14:37633385-37633407 ACCTGGGAAGTGCAAGGGGTTGG - Intronic
1117511340 14:56454646-56454668 ACCTGGGAAGTGCAAGGGGTGGG + Intergenic
1117773831 14:59162042-59162064 CCCTGGGCTGAGCATGGGGTGGG + Intergenic
1120450115 14:84655844-84655866 ACCTGGGAAGTGCAAGGGGTTGG - Intergenic
1121245723 14:92459701-92459723 CCCTGTGAGGAGCAGGCGGTGGG + Intronic
1125137698 15:36363197-36363219 TCCTGAGAGGAGCAAGGAGGAGG + Intergenic
1125602895 15:40925367-40925389 CCCGGTGAGAAGGAAGGGGTAGG - Intergenic
1126134540 15:45378025-45378047 TCCCGCTCGGAGCAAGGGGTTGG - Intronic
1127283964 15:57516647-57516669 CCCTGTGCTGAGCCAGGGGTCGG - Intronic
1129460622 15:75698458-75698480 CCCTTGGAGGTGCAAGGGGAGGG - Intronic
1131292549 15:91119137-91119159 CTTTGCAAGGAGCAAAGGGTTGG + Intronic
1132260176 15:100417264-100417286 ACTTGGGAAGAGCAAGGGGTCGG + Intronic
1132331076 15:101012914-101012936 CCCTGCGAGGAGTATGATGTGGG - Intronic
1132977534 16:2718043-2718065 GCTTGGAAGGAGCAAGGGGTCGG - Intronic
1135301799 16:21334980-21335002 ACCTGGGAAGCGCAAGGGGTTGG - Intergenic
1136600594 16:31284656-31284678 ACCTGGGAAGTGCAAGGGGTTGG - Intronic
1137825328 16:51489749-51489771 CCCTCCCAGGAGCAAGGCCTGGG - Intergenic
1138007349 16:53350320-53350342 ACCTGGGAAGTGCAAGGGGTCGG - Intergenic
1138678697 16:58670079-58670101 CCCTGAGAGGATCAAGGGCTGGG + Intronic
1138713248 16:58993186-58993208 ACCTGGGAAGTGCAAGGGGTCGG - Intergenic
1139290001 16:65849453-65849475 CCCCTCCAGGAGCAAGGGGTTGG + Intergenic
1142607067 17:1087793-1087815 CCCTCCCAGGAGCCAGGGGCAGG + Intronic
1142719488 17:1766807-1766829 CCCAGCCAGGACCCAGGGGTTGG - Intronic
1142880233 17:2878167-2878189 CACTTAGAGTAGCAAGGGGTTGG + Intronic
1143324184 17:6087727-6087749 CTCTGCCAGGAGCCAGGCGTCGG - Intronic
1143610180 17:8013537-8013559 CCCTGGGAGGAGCAGGGGAGGGG + Intronic
1144631018 17:16872536-16872558 CCTGCTGAGGAGCAAGGGGTTGG - Intergenic
1144650296 17:17002940-17002962 CCCGCTGAGGAGCAAGGGGCTGG + Intergenic
1144766571 17:17736258-17736280 CCATGAGAGGAGCCTGGGGTGGG - Intronic
1146974798 17:37101847-37101869 CCCTGCAGGGAGCAAAGGGATGG + Intronic
1147327007 17:39674492-39674514 CACTGGGAGGAGTATGGGGTGGG - Intronic
1147460205 17:40563549-40563571 CCCAGCAAGGAGCAAGAGGTGGG - Intronic
1147928103 17:43957836-43957858 CCTTGAGAAGAGCAGGGGGTGGG + Intronic
1148488005 17:48003599-48003621 CCCTGAGAGGGGCCAGGAGTGGG + Intergenic
1148967301 17:51446851-51446873 ACCTGGGAAGTGCAAGGGGTCGG + Intergenic
1151904289 17:77037685-77037707 CGCTGGGAGCAGCTAGGGGTGGG + Intergenic
1152740039 17:82014790-82014812 CACTGAGTGGGGCAAGGGGTTGG + Intronic
1153872666 18:9334873-9334895 CCCGGCGGGGATCTAGGGGTGGG + Exonic
1154288807 18:13086445-13086467 ACCTGGGAAGTGCAAGGGGTTGG - Intronic
1155384854 18:25266628-25266650 CACTGAGAAGTGCAAGGGGTCGG + Intronic
1156481482 18:37439224-37439246 CCCTGAGAGGGGCAGGCGGTGGG + Intronic
1157340180 18:46771376-46771398 GCCTGCCAAGAGCAAGGGGTGGG - Intergenic
1157731562 18:50008612-50008634 CCCTGAGAGGATGAAGAGGTGGG + Intronic
1159199531 18:65166574-65166596 ACCTGGGAAGCGCAAGGGGTCGG + Intergenic
1159570837 18:70110443-70110465 ACCTGGGAAGCGCAAGGGGTCGG + Intronic
1159690664 18:71483269-71483291 CCCTGCAAGCACAAAGGGGTTGG - Intergenic
1160742435 19:693394-693416 CTCTGCGGGGAGGAGGGGGTGGG + Intronic
1161041480 19:2112966-2112988 CCCTGCAGGGAGCCAGGGCTTGG + Exonic
1161132464 19:2599332-2599354 GGCTGGGAGGAGGAAGGGGTGGG - Intronic
1162506569 19:11089580-11089602 CGCGGCGAGGAGCAAGGCGACGG - Exonic
1163447071 19:17353064-17353086 TCCTGCGAGGGGTCAGGGGTTGG + Intronic
1163762636 19:19145869-19145891 CCGGGCGAGGAGCAAGGGATAGG + Exonic
1163849189 19:19653936-19653958 CCCAGCCTGGGGCAAGGGGTGGG - Intronic
1164090953 19:21951853-21951875 ACCTGGGAGGCACAAGGGGTTGG + Intronic
1164092961 19:21977456-21977478 CCCTGGGAAGTGCAACGGGTTGG + Intronic
1164110085 19:22148548-22148570 ACCTGGGAAGAACAAGGGGTTGG + Intergenic
1165249946 19:34522167-34522189 CCTAGAGAGGAGGAAGGGGTTGG - Intergenic
1165973014 19:39649371-39649393 ACCTGGGAAGTGCAAGGGGTCGG + Intergenic
1166300527 19:41909847-41909869 CCCTGCGGTGAGGAAGGGCTTGG - Intronic
1166739648 19:45106113-45106135 CCCTGAGATGAGGAAGGGGCTGG - Intronic
1166750693 19:45162782-45162804 CTCTGCCAGGAGCACGGGGAGGG + Intronic
925101525 2:1250534-1250556 CCTTGAGAGGAGCAAAGAGTGGG - Intronic
926491173 2:13527831-13527853 CCCAGCGAGGTTCAAGGGGATGG + Intergenic
926941779 2:18145089-18145111 ACCTGGGAAGTGCAAGGGGTCGG - Intronic
927150635 2:20193558-20193580 GGCTGCCAGGAGCCAGGGGTGGG + Intergenic
927158265 2:20234770-20234792 GGCTGCCAGGAGCCAGGGGTGGG - Intergenic
927893595 2:26767510-26767532 CCCTGCCAGGACCCAGGGATGGG - Intronic
928522759 2:32106392-32106414 ACCTGGGAAGCGCAAGGGGTTGG - Intronic
929602376 2:43212506-43212528 CCCTTCGAGGAGCCAGGCTTGGG + Intergenic
931566355 2:63619901-63619923 ACCTGGGAAGCGCAAGGGGTCGG + Intronic
931796093 2:65711631-65711653 CCCCGTGAGGAGAAATGGGTGGG - Intergenic
932051738 2:68405079-68405101 ACCTGGGAAGCGCAAGGGGTTGG + Intergenic
932385820 2:71331888-71331910 CCCTGTGGGGAGTAGGGGGTTGG + Intronic
932473255 2:71978452-71978474 ACCTGGGAAGCGCAAGGGGTCGG - Intergenic
934623573 2:95831401-95831423 CCCAGCGAGGAGGAATGGATTGG - Intergenic
934810177 2:97270694-97270716 CCCAGCGAGGAGGAATGGATTGG + Intergenic
934827515 2:97437245-97437267 CCCAGCGAGGAGGAATGGATTGG - Intergenic
934999627 2:99000711-99000733 ACCTGGGAAGCGCAAGGGGTCGG + Intronic
935653108 2:105398937-105398959 CCCTCCGGGGCGCAGGGGGTTGG + Intronic
935687642 2:105698320-105698342 CCCTGGGATGAGTATGGGGTGGG - Intergenic
936434016 2:112487679-112487701 GCCTCCGAGGGGCAAGGGGCAGG - Intronic
936859586 2:117001324-117001346 ACCCGGGAAGAGCAAGGGGTTGG + Intergenic
937253852 2:120541138-120541160 CCCTGCCAGGGCCCAGGGGTGGG - Intergenic
939354255 2:141080939-141080961 ACCTGAGAGGACTAAGGGGTGGG - Intronic
941532352 2:166686000-166686022 ACCTGGGAAGTGCAAGGGGTTGG + Intergenic
942459624 2:176160143-176160165 CCCTGGGAGGAGCTGGGCGTCGG + Intronic
942639836 2:178049561-178049583 ACCTGGGAAGTGCAAGGGGTTGG + Intronic
943706830 2:191044580-191044602 CCCAGCCAGGAGAAGGGGGTGGG + Intronic
943953850 2:194161711-194161733 TCCTGCTATGTGCAAGGGGTAGG + Intergenic
944393622 2:199245532-199245554 ACCTGGGAAGTGCAAGGGGTTGG - Intergenic
945016696 2:205525957-205525979 CCCTGCGAGAAGCAAGGGCAGGG - Intronic
945025091 2:205612895-205612917 GCCTGGGAGGAGCAAGGTGTGGG + Intronic
946396676 2:219447022-219447044 CCTTGCGGGGAGGAGGGGGTGGG - Intronic
947493966 2:230619437-230619459 ACCTGGGAAGTGCAAGGGGTTGG + Intergenic
947596069 2:231412452-231412474 CCCCGCGAGGAGCAAGGGGCTGG + Intergenic
947669183 2:231925911-231925933 CCCGGCGAGCAGCAAAGGGAGGG - Intronic
948170892 2:235901463-235901485 ACCGGGGAGGAGCAAAGGGTTGG - Intronic
948408844 2:237743428-237743450 CCCTGGGAGGACCAAGTGGGTGG - Intronic
948686731 2:239674918-239674940 GCCTGGGGGGAGCAGGGGGTGGG + Intergenic
948688383 2:239685996-239686018 CACTGGGAGGAGGATGGGGTCGG + Intergenic
948928752 2:241116939-241116961 CCCTGCGAGGTGCATGGGATAGG + Intronic
1169307127 20:4501764-4501786 ACCTGGGAAGCGCAAGGGGTTGG - Intergenic
1170133830 20:13052252-13052274 ACCTGGGAAGCGCAAGGGGTTGG + Intronic
1170603456 20:17859201-17859223 CCCCTCCAGGATCAAGGGGTAGG + Intergenic
1172226447 20:33308106-33308128 CCCAAGCAGGAGCAAGGGGTGGG + Intronic
1172456324 20:35077195-35077217 ACCTGGGAGTCGCAAGGGGTGGG - Intronic
1172577232 20:36018640-36018662 CCCTGGGAGCAGCAGAGGGTGGG + Intronic
1173166739 20:40691182-40691204 CCCTGCCAGTAGCTGGGGGTTGG + Intergenic
1173771832 20:45666361-45666383 ACCTGGGAAGGGCAAGGGGTTGG - Intronic
1174402613 20:50283998-50284020 CCCTGCAGGGAGCCAGGGGCCGG - Intergenic
1175226615 20:57448136-57448158 CCCTGGGAGGTGGCAGGGGTAGG + Intergenic
1175237866 20:57525997-57526019 CCCTGCGGGGGGCGAGGGGTGGG + Intergenic
1175776724 20:61658552-61658574 ACCTGCAAGGAGCAAAGGATGGG + Intronic
1175927055 20:62476079-62476101 CCCTGCGGGGAAGAAGGGGCGGG - Intergenic
1175942670 20:62545140-62545162 CACTGCAAGGAGCAGGGTGTTGG - Intergenic
1176296297 21:5075269-5075291 CCCTGAGAGGAGCAGGGAGGAGG - Intergenic
1176891706 21:14327036-14327058 ACCTGGGAAGTGCAAGGGGTTGG + Intergenic
1176980769 21:15378381-15378403 CTATGAGAGGAGCAAGGTGTGGG + Intergenic
1179860752 21:44186852-44186874 CCCTGAGAGGAGCAGGGAGGAGG + Intergenic
1180164025 21:46011217-46011239 CCATTCCAGGAGCAAGGGGTTGG - Intergenic
1182260623 22:29071378-29071400 CCCTGCGAGCAGCCGTGGGTGGG + Intergenic
1183199593 22:36376656-36376678 CCCTGGGAGGAGAAAGGTGGTGG - Intronic
1183744039 22:39683365-39683387 GCCTCCCAGGAGCCAGGGGTGGG + Intronic
1184413312 22:44338138-44338160 CCCTTGGAGGAGGAAGGGGCTGG - Intergenic
1184422286 22:44389236-44389258 ACCTGCCAGGAGGAACGGGTTGG - Intergenic
1185343704 22:50302411-50302433 CTCCGCGTGGAGCAAGGGGCTGG - Intronic
949579804 3:5376710-5376732 ACCTGGGAAGTGCAAGGGGTCGG + Intergenic
949987764 3:9553530-9553552 GCCCGCGAGGAGCAGGCGGTGGG + Intronic
950794385 3:15498769-15498791 TCCTGGGAGTAGCAATGGGTAGG + Intronic
950862781 3:16164780-16164802 ACCTGGGAGGTGCAAGGGGTCGG - Intergenic
951865521 3:27302781-27302803 CCCTGCAATGAGCATGGGGAAGG + Intronic
953254626 3:41277997-41278019 ACCTGGGAGGCACAAGGGGTCGG + Intronic
953926948 3:46987464-46987486 CCCTCCCAGGGGCCAGGGGTGGG - Intronic
954115882 3:48466608-48466630 CCTGGAGAGGAGCATGGGGTGGG - Exonic
954150736 3:48655921-48655943 CCCTGCGAGGAGAAGGGGCTGGG + Intronic
954507574 3:51091886-51091908 ACCTGGGAAGTGCAAGGGGTTGG + Intronic
954950453 3:54468311-54468333 ACCTGGGAAGTGCAAGGGGTTGG + Intronic
954971458 3:54654838-54654860 CCCTGCTAGGATGAAGGCGTTGG + Intronic
955361695 3:58281533-58281555 ACCTGGGAAGTGCAAGGGGTCGG - Intronic
955604841 3:60690353-60690375 CCCTGCCAAGACCAAGTGGTTGG - Intronic
955630332 3:60966369-60966391 ACCTGGGAAGTGCAAGGGGTTGG - Intronic
956477430 3:69637284-69637306 ACCTGGGAAGTGCAAGGGGTCGG - Intergenic
958704794 3:97641624-97641646 CCTTGGGAAGCGCAAGGGGTCGG + Intronic
959736443 3:109664922-109664944 ACCCGGGAGGTGCAAGGGGTTGG + Intergenic
960787722 3:121392338-121392360 ACCTGGGAAGCGCAAGGGGTGGG - Intronic
961085152 3:124060843-124060865 CTCTGCTAGGTGGAAGGGGTAGG + Intergenic
962232886 3:133681411-133681433 ACCTGGGAAGTGCAAGGGGTTGG + Intergenic
962386632 3:134937444-134937466 CCATGGGAGAAGGAAGGGGTGGG - Intronic
962861278 3:139404740-139404762 ACCTGGGAAGTGCAAGGGGTCGG + Intergenic
964522126 3:157581092-157581114 TCCAGCGAGGATCAAGGGATTGG + Intronic
964612034 3:158625161-158625183 CCCTGCCATGAGCAAGGTGGAGG + Intergenic
965497193 3:169413234-169413256 ACCTGCAAAGCGCAAGGGGTTGG + Intronic
966477547 3:180367532-180367554 ACCTGGGAAGTGCAAGGGGTTGG + Intergenic
967248455 3:187512892-187512914 ACCTGGGAAGTGCAAGGGGTTGG + Intergenic
968155927 3:196380683-196380705 ACCTGGGAAGTGCAAGGGGTCGG + Intronic
968754839 4:2409829-2409851 CCCTGCCAGCAGCACAGGGTGGG + Intronic
968883221 4:3312096-3312118 CCCTGGGAGGTGCAGGGGCTTGG + Intronic
969279907 4:6162763-6162785 CCCAGCCAGGAGCCAGGTGTGGG + Intronic
969629601 4:8328688-8328710 CCCTGGGAGGAGTGATGGGTGGG + Intergenic
971437216 4:26640611-26640633 ACCTGGGAAGGGCAAGGGGTTGG + Intronic
972685573 4:41349639-41349661 ACCTGGGAAGTGCAAGGGGTTGG + Intergenic
975638709 4:76477855-76477877 ACCTGGGAAGTGCAAGGGGTTGG + Intronic
975729888 4:77327548-77327570 ACCTGGGAAGTGCAAGGGGTTGG - Intronic
976223183 4:82774672-82774694 TGCTGGGAGGAGCAAAGGGTGGG - Intronic
976574804 4:86657155-86657177 CCCAGGGAAGTGCAAGGGGTCGG - Intronic
976993937 4:91405807-91405829 ACCTGGGAAGTGCAAGGGGTCGG - Intronic
977439039 4:97038354-97038376 ACCTGGGAAGTGCAAGGGGTCGG - Intergenic
978363553 4:107956895-107956917 ACCTGGGAAGCGCAAGGGGTCGG + Intergenic
978918074 4:114149153-114149175 CCCTGGGAGCAACAGGGGGTGGG + Intergenic
979757590 4:124361426-124361448 ACCTGGGAAGTGCAAGGGGTTGG + Intergenic
980634000 4:135474222-135474244 ACCTGGGAAGTGCAAGGGGTCGG - Intergenic
981668194 4:147255219-147255241 ACCTGGGAAGTGCAAGGGGTCGG + Intergenic
983044592 4:162970133-162970155 ACCTGGGAAGTGCAAGGGGTTGG - Intergenic
983787983 4:171759010-171759032 ACCTGGGAAGCGCAAGGGGTCGG + Intergenic
985473823 5:66065-66087 ACCTGAGAAGTGCAAGGGGTCGG - Intergenic
985579911 5:691186-691208 CCCTCCGAGGATCACGTGGTGGG + Intronic
985594758 5:783245-783267 CCCTCCGAGGATCACGTGGTGGG + Intergenic
986006093 5:3670172-3670194 ACCTGGGAAGTGCAAGGGGTCGG - Intergenic
987113355 5:14707647-14707669 CCTTGGGAGGTGCAGGGGGTGGG - Exonic
988199877 5:28054422-28054444 CCCTGAAAGGAGCCAGGAGTGGG - Intergenic
989087242 5:37688890-37688912 ACCTGGGAAGCGCAAGGGGTCGG + Intronic
989418206 5:41205431-41205453 ACCTGGGATGTGCAAGGGGTCGG + Intronic
989506309 5:42230573-42230595 CCTGGCGATGAGCAGGGGGTCGG + Intergenic
989522496 5:42418361-42418383 ACCCGGGAAGAGCAAGGGGTTGG - Intergenic
990869962 5:60420754-60420776 ACCTGGGAAGTGCAAGGGGTTGG + Intronic
990937137 5:61162720-61162742 TCCTGCGGGGACCAAGTGGTGGG + Intergenic
991128095 5:63090352-63090374 ACCTGAGAAGCGCAAGGGGTTGG + Intergenic
991151430 5:63375870-63375892 GCCTGGGAAGTGCAAGGGGTTGG + Intergenic
991242261 5:64473930-64473952 ACCTGGGAAGTGCAAGGGGTTGG + Intergenic
992157688 5:73971096-73971118 CTCTGCAAGGGGCAGGGGGTGGG + Intergenic
992614713 5:78536969-78536991 CACTTAGAGGAGCAAGGGGCTGG - Intronic
993470835 5:88305930-88305952 ACCTGGGAAGTGCAAGGGGTCGG + Intergenic
994387188 5:99146352-99146374 ACCTGGGAAGTGCAAGGGGTCGG + Intergenic
995457356 5:112366483-112366505 CACTTGGAAGAGCAAGGGGTGGG + Intronic
996420759 5:123259221-123259243 ACCTGGGAAGTGCAAGGGGTTGG - Intergenic
996609781 5:125364818-125364840 ACCTGGGAAGCGCAAGGGGTCGG - Intergenic
996987573 5:129585159-129585181 ACCTGGGAAGTGCAAGGGGTTGG - Intronic
1000220330 5:159208890-159208912 CCCTGGGAAGAGGAAGGGATGGG + Intronic
1002677089 5:180926204-180926226 ACCTGGGAAGTGCAAGGGGTTGG + Intronic
1003195665 6:3911980-3912002 CCCTGCTAGGTGCAAGGAGGGGG + Intergenic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1006198456 6:32263556-32263578 ACCTGGGAAGTGCAAGGGGTCGG - Intergenic
1006444781 6:34074081-34074103 CCCTGCCAGGAGAACGGGGCTGG + Intronic
1008423331 6:51328391-51328413 CCTTGCAAGGAGCAAGGTTTAGG - Intergenic
1008588134 6:52967533-52967555 TCCTGGGAGGAGCTTGGGGTGGG - Intergenic
1008782806 6:55127333-55127355 ACCTGGGAAGTGCAAGGGGTCGG - Intronic
1010703480 6:79078425-79078447 CCCTGCGGGGAGGAGCGGGTGGG - Intergenic
1011387765 6:86815893-86815915 ACCTGGGAAGTGCAAGGGGTTGG - Intergenic
1011524895 6:88253796-88253818 ACCTGGGAAGCGCAAGGGGTTGG + Intergenic
1011776862 6:90740006-90740028 ACCTGGGAAGTGCAAGGGGTTGG - Intergenic
1012209321 6:96500244-96500266 ACCTGGGAGGTGCAAGGGGTCGG - Intergenic
1013578344 6:111507662-111507684 ACCTGGGAAGCGCAAGGGGTTGG - Intergenic
1014184630 6:118421206-118421228 ACCTGGGAAGTGCAAGGGGTTGG + Intergenic
1017871327 6:158489012-158489034 GCCTGCGTGGAGCAAAGGCTAGG - Intronic
1018630035 6:165814348-165814370 CCCTGTGTGGAGCAAGGGGCTGG - Intronic
1019388667 7:773268-773290 CCCTGCCAGGAGCAAGCCGGTGG + Intronic
1019712577 7:2524332-2524354 CCCTGCCAGGTGCACGGGGCGGG + Intronic
1020108106 7:5431835-5431857 CCCAGAGAGGAGCACGAGGTAGG + Intronic
1021737893 7:23657133-23657155 CCCTGCCACGAGCAGGGCGTAGG - Intergenic
1021806202 7:24358456-24358478 CCGTACGAGGAGGAAGGGGCAGG + Intergenic
1022500910 7:30881967-30881989 CCCTGCGAGCAGCAGCAGGTGGG + Intronic
1022866952 7:34431506-34431528 ACCTGGGAAGTGCAAGGGGTTGG + Intergenic
1022987043 7:35665548-35665570 ACCTGGGAAGCGCAAGGGGTCGG - Intronic
1023034680 7:36120130-36120152 ACCTGGGAAGTGCAAGGGGTTGG + Intergenic
1023097238 7:36673591-36673613 TAATGCGAGGAGCAAGGGCTGGG + Intronic
1024165203 7:46723574-46723596 GCCTGTGAGGAGGAACGGGTTGG - Intronic
1028022173 7:85791089-85791111 ACCTGGGAAGTGCAAGGGGTTGG + Intergenic
1028630077 7:92925163-92925185 ACCTGGGAAGAGAAAGGGGTCGG - Intergenic
1028652917 7:93170673-93170695 ACCTGAGAAGTGCAAGGGGTTGG - Intergenic
1029898413 7:104011603-104011625 ACATGGCAGGAGCAAGGGGTAGG - Intergenic
1030142578 7:106320353-106320375 ACCTGGGAAGTGCAAGGGGTTGG + Intergenic
1031365942 7:120900925-120900947 ACCTGGGAAGTGCAAGGGGTCGG + Intergenic
1033384897 7:140863739-140863761 ACATGGCAGGAGCAAGGGGTAGG - Intronic
1033592275 7:142819715-142819737 CCCAGGGAGGAGAAAGCGGTGGG + Intergenic
1034202626 7:149291976-149291998 CCCTGGGAGGGGCCTGGGGTTGG - Intronic
1035243718 7:157548863-157548885 TCCTGAGAGGAGCACGGGGAGGG - Intronic
1036551116 8:9815849-9815871 ACCTGGGAAGCGCAAGGGGTCGG + Intergenic
1036557865 8:9875868-9875890 CCCTGTGAAGAGCTAGGGATTGG + Intergenic
1037731314 8:21526105-21526127 CCCTGCAAGGATCCAGGGGCTGG + Intergenic
1040424457 8:47271705-47271727 CCCTGAGAGGAGCCAGAAGTTGG - Intronic
1040805903 8:51396141-51396163 GCCTGCGAGAAGAAAGGGATGGG + Intronic
1040914902 8:52558989-52559011 GCCTGACAGGAGCAAGGGGCAGG + Intronic
1041292256 8:56319163-56319185 CTCTGCGGGGTGCAAGGGGTTGG + Intronic
1041666248 8:60447944-60447966 ACCTGGGAAGTGCAAGGGGTTGG + Intergenic
1041713718 8:60914938-60914960 CCCTGAGAGGAACAGGAGGTAGG - Intergenic
1041900709 8:62978975-62978997 ACCTGGGAAGTGCAAGGGGTTGG - Exonic
1042887536 8:73569019-73569041 ACCTGGGAAGCGCAAGGGGTCGG + Intronic
1043165874 8:76902033-76902055 ACCTGGGAAGTGCAAGGGGTCGG - Intergenic
1043237010 8:77880416-77880438 ACCTGGGAAGTGCAAGGGGTCGG - Intergenic
1043729065 8:83651441-83651463 CCCTGGAAGGAGTGAGGGGTGGG - Intergenic
1044374019 8:91448245-91448267 GCCTGCGGGGAGCAAGGATTAGG - Intergenic
1044940337 8:97335400-97335422 ACCTGGGAAGTGCAAGGGGTCGG - Intergenic
1045390506 8:101710154-101710176 ACCTGGGAAGTGCAAGGGGTTGG + Intronic
1045417646 8:101983248-101983270 CCCTGAGATGAGCCAGGGGTGGG - Intronic
1045547524 8:103141385-103141407 CCCTGGGCGGATCAGGGGGTGGG - Intronic
1047866949 8:129035193-129035215 CCCTGCGAGGCAGCAGGGGTGGG + Intergenic
1049172823 8:141172560-141172582 CCCTGAGCGGCGCAAGGGGCAGG + Intronic
1049261172 8:141640066-141640088 CCCGGCGAGGAGAAAGGAGAGGG - Intergenic
1049369645 8:142257699-142257721 CCCCGCGATGACCCAGGGGTGGG + Intronic
1049467389 8:142757866-142757888 CCCTGTTAGGAGCAGCGGGTAGG + Intergenic
1049621455 8:143600043-143600065 CCCTGAGAGGAGCATGGGCCAGG - Exonic
1050450761 9:5779379-5779401 ACCTGGGAAGCGCAAGGGGTCGG + Intronic
1052146981 9:25061593-25061615 CCCTGGGAAGTGCAAGGGGTGGG - Intergenic
1052326420 9:27220669-27220691 ACCTGGGAAGCGCAAGGGGTTGG + Intronic
1053041621 9:34878425-34878447 ACCTGGGAAGCGCAAGGGGTGGG + Intergenic
1053411204 9:37917277-37917299 CCCTGAGAGGGGCAGGAGGTTGG + Intronic
1054719959 9:68594415-68594437 ACCTGGGAAGTGCAAGGGGTTGG - Intergenic
1056584520 9:87919664-87919686 CCCTGTGAGGAGAAAGGACTGGG - Intergenic
1056612346 9:88133256-88133278 CCCTGTGAGGAGAAAGGACTGGG + Intergenic
1060494715 9:124109975-124109997 CCCTGCCTGGAGTAATGGGTAGG + Intergenic
1061901097 9:133672503-133672525 GTCTGCGAGGAGCAGGGGGAAGG + Intronic
1061912474 9:133732390-133732412 CCCTGCGGGGGGCAAGGAGGGGG - Intronic
1062012679 9:134275494-134275516 CCCTGCGGGGAGGGAGGGATGGG - Intergenic
1062340087 9:136090261-136090283 CCCTGGGAGGAGGAAGATGTGGG + Intronic
1062393886 9:136344917-136344939 CCATGCAAGGACCATGGGGTTGG - Intronic
1062556408 9:137115031-137115053 ACCTGCCAGGAGCAAGTGCTGGG - Intronic
1186773385 X:12839622-12839644 ACCTGGGAAGTGCAAGGGGTCGG - Intergenic
1187389553 X:18877062-18877084 CACTGCGAGGAGCCAGAGTTTGG + Intergenic
1189090854 X:38081205-38081227 CCTTAGGAGGAGCGAGGGGTGGG + Intronic
1189364284 X:40376419-40376441 CCCTGAAATGAGCAAGGTGTTGG - Intergenic
1190495161 X:51021326-51021348 ACCTGGGAAGTGCAAGGGGTCGG - Intergenic
1190840764 X:54142286-54142308 ACCTGGGAAGCGCAAGGGGTCGG + Intronic
1191099050 X:56705217-56705239 ACCTGGGAAGTGCAAGGGGTTGG - Intergenic
1191114025 X:56832937-56832959 ACCTGGGAAGTGCAAGGGGTTGG - Intergenic
1191155701 X:57270712-57270734 ACCTGGGAAGTGCAAGGGGTCGG + Intergenic
1191222277 X:58002591-58002613 ACCTGGGATGTGCAAGGGGTCGG + Intergenic
1191728074 X:64302375-64302397 ACCTGGGAAGCGCAAGGGGTCGG - Intronic
1192897601 X:75460198-75460220 CCCAGTGAGGAGAAATGGGTTGG - Intronic
1193019969 X:76781048-76781070 ACCTGGGATGTGCAAGGGGTGGG - Intergenic
1193043873 X:77032035-77032057 ACCTGGGAAGTGCAAGGGGTTGG - Intergenic
1193456942 X:81743360-81743382 ACCCGGGAAGAGCAAGGGGTCGG + Intergenic
1194643480 X:96429848-96429870 ACCTGGGAAGCGCAAGGGGTCGG - Intergenic
1194677878 X:96815465-96815487 ACCTGGGAAGTGCAAGGGGTAGG - Intronic
1195097990 X:101524517-101524539 ACCTGGGAAGTGCAAGGGGTCGG + Intronic
1199949995 X:152699504-152699526 CCCTGCGAGGAGTCATGGGGAGG + Intronic
1199952186 X:152715377-152715399 CCCTGCGAGGAGTCAAGGGGAGG + Intronic
1199954824 X:152734570-152734592 CCCTGCGAGGAGTCAAGGGGAGG + Intronic
1199955058 X:152735676-152735698 CCCTGCAAGGAGAAAGGTGAGGG + Intronic
1199957497 X:152753071-152753093 CCCTGCGAGGAGTCAAGGGGAGG - Intronic
1199959679 X:152768957-152768979 CCCTGCGAGGAGTCATGGGGAGG - Intronic
1200549017 Y:4554751-4554773 ACCTGGGAAGTGCAAGGGGTTGG - Intergenic
1200928222 Y:8673648-8673670 CCATGCAAGGAGCAAGGTGGAGG + Intergenic
1201332753 Y:12844909-12844931 GCTTGCCAGGAGAAAGGGGTTGG + Intronic
1201364247 Y:13186220-13186242 ACCTGGGAAGTGCAAGGGGTAGG + Intergenic