ID: 920380356

View in Genome Browser
Species Human (GRCh38)
Location 1:205531492-205531514
Sequence GGGCTGCCAAGCGGTCTTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920380356 Original CRISPR GGGCTGCCAAGCGGTCTTCC AGG (reversed) Exonic