ID: 920380356

View in Genome Browser
Species Human (GRCh38)
Location 1:205531492-205531514
Sequence GGGCTGCCAAGCGGTCTTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920380356 Original CRISPR GGGCTGCCAAGCGGTCTTCC AGG (reversed) Exonic
902483389 1:16724793-16724815 GGGCTGCCCCCGGGTCTTCCAGG + Intergenic
902893663 1:19463684-19463706 AGGGTGCCAAGTGGTCTTCCTGG - Intronic
902934928 1:19758229-19758251 GGGCTGCCCTGCTGTCTCCCAGG + Intronic
904826695 1:33277813-33277835 GGGGTGCCAGGCGGACATCCTGG + Intronic
916052637 1:161047193-161047215 GGGCTTCAAAGAGCTCTTCCTGG + Exonic
917602349 1:176588924-176588946 GGTCTGCCAAGCTGTTTTTCAGG + Intronic
920380356 1:205531492-205531514 GGGCTGCCAAGCGGTCTTCCAGG - Exonic
921812982 1:219535606-219535628 GGGCTGCAAAAGGGTCTTTCAGG + Intergenic
921904185 1:220478935-220478957 GGGCTGCCAACTCTTCTTCCTGG + Intergenic
922753798 1:228083061-228083083 CGGCGTCCAAGCGGACTTCCGGG - Intronic
1062857663 10:787341-787363 GGGCTGACACGCGCTCTGCCTGG + Intergenic
1064063770 10:12163069-12163091 GTGCTGCTCAGCTGTCTTCCAGG + Intronic
1066522767 10:36241133-36241155 GTACTGCCAAGTTGTCTTCCAGG + Intergenic
1069876461 10:71566247-71566269 GGGCTGCTGAGGGTTCTTCCTGG - Intronic
1069957288 10:72059909-72059931 GGGCAGCCAAGGGGAGTTCCAGG + Exonic
1072283857 10:93894366-93894388 GGGCTGCAAAGCGGAATTCCCGG + Intronic
1072553599 10:96497509-96497531 GGTCTGCCAAGATCTCTTCCTGG - Intronic
1083159740 11:60847778-60847800 GGCCTGACAGGCGGCCTTCCAGG - Intronic
1084898541 11:72293210-72293232 GGGCTGAGAAGGGGTCTTCATGG + Exonic
1086948392 11:92866827-92866849 GAGCTGGCACTCGGTCTTCCTGG + Exonic
1096777821 12:53974645-53974667 GCGCTGCCCCGCGGGCTTCCCGG + Intronic
1099955756 12:89351643-89351665 GGGCTGCCGGGCGTTCTACCTGG - Exonic
1106297518 13:28430094-28430116 TAGCTGGCAAGCGGTCTTACCGG - Exonic
1106448444 13:29857950-29857972 GGGCTGCAATGAGGGCTTCCTGG - Intergenic
1113418170 13:110147464-110147486 GAGCTGCCAAACCATCTTCCAGG - Intergenic
1113657685 13:112078518-112078540 GGGCTGGAAAGCGGGCTCCCTGG - Intergenic
1115851142 14:37591640-37591662 GGGGTGCCAAGCCGTGTGCCGGG + Exonic
1119777893 14:77259586-77259608 GGGCTGCCCTGCTGGCTTCCTGG - Intergenic
1121086049 14:91146891-91146913 GGGCTGCCAAGCTGTTCCCCTGG + Intronic
1123945208 15:25235608-25235630 GGGCTGCCCTGGGGTCTTGCTGG + Intergenic
1124416512 15:29476842-29476864 TGGCTGGCAATCGGTTTTCCAGG - Intronic
1132035507 15:98480537-98480559 GGGCTGTCTAGGGGTCTGCCTGG - Intronic
1133621908 16:7534536-7534558 GGGCTTCCAGGGGCTCTTCCTGG - Intronic
1136222919 16:28840034-28840056 GGGCTGCCAAGAGGAATTTCTGG - Intergenic
1138551803 16:57752620-57752642 GGGCGGCCCAGCGCTCCTCCCGG + Intronic
1142194475 16:88733130-88733152 GGGGCGCCAAGGGGGCTTCCTGG - Intronic
1142697935 17:1643851-1643873 GGGCTCCCCAGCGGTCGGCCTGG + Exonic
1143054455 17:4152416-4152438 TGGCTGCCAAGATGGCTTCCTGG - Intronic
1145912362 17:28550045-28550067 TGGCTGCCAGGAGGGCTTCCTGG - Intronic
1147181012 17:38685748-38685770 GGCCAGCCAAGCGGGCTGCCCGG - Intergenic
1149343943 17:55715608-55715630 GGTCTGTCAAGCTGTCATCCGGG + Intergenic
1149684416 17:58527204-58527226 GGGGTGCCCAGGGCTCTTCCTGG - Intronic
1151983201 17:77526376-77526398 GGGCTGCCCAGGGGGCTCCCCGG - Intergenic
1154486342 18:14874655-14874677 GGGTGGCCAAGAGGTCTTTCTGG - Intergenic
1157188132 18:45558028-45558050 GGCCTGCCAAGCTGTCTGCCAGG + Intronic
1157693359 18:49701283-49701305 GAGCTGCAAAGTGGTCTTCCAGG - Intergenic
1159413290 18:68109392-68109414 GAGCTGCCAAGTTGTCTTTCAGG + Intergenic
1160090767 18:75824890-75824912 CGGCTGCCAAGCGTCCTTGCTGG + Intergenic
1160594609 18:79964882-79964904 GGGGTGCCCTGCGGTCTTCGTGG + Intronic
1167566743 19:50261638-50261660 GGGCAGCCACGCTGTCTCCCGGG + Intronic
926160982 2:10489156-10489178 GGGCTGCCAGGGGATCTTCCTGG + Intergenic
926270827 2:11364779-11364801 TGGCTGCCATGCAGTGTTCCGGG + Intergenic
930752807 2:54948818-54948840 GGGCTGCAAGGCTGCCTTCCCGG - Intronic
931345159 2:61439632-61439654 GGGCTGCCATGCTGCCTTCTTGG - Intronic
932071423 2:68624536-68624558 AGGCTTTCAAGCAGTCTTCCAGG + Intronic
933449703 2:82431927-82431949 TGCCTGCCAACTGGTCTTCCAGG - Intergenic
942943496 2:181647372-181647394 GGGCTGACAAGCTGTCTTTTGGG - Intronic
945219960 2:207473480-207473502 GGGCTGCCAAGCTATCTCCCTGG + Intergenic
946864413 2:224030085-224030107 GTGTTACCAAGAGGTCTTCCAGG - Intronic
947768824 2:232654837-232654859 GGGCTGGGAAGCCGTCTCCCTGG + Intronic
1170235483 20:14099312-14099334 GGGATGCCAAGAGGGCTTCTGGG - Intronic
1170897138 20:20425634-20425656 AGGTTGCCAAGCGGCCTTCCTGG + Intronic
1175583998 20:60122879-60122901 GGGCTGCGGAGCTGACTTCCTGG - Intergenic
1176794960 21:13364725-13364747 GGGTGGCCAAGAGGTCTTTCTGG + Intergenic
1180005783 21:45019784-45019806 GTGCTACCATGCGGTCTCCCAGG - Intergenic
1181269675 22:21651886-21651908 GGGCTTCCAAGCGCTCTTGTCGG + Intergenic
1181440397 22:22932597-22932619 CAGCTGCCAAGAGGACTTCCGGG + Intergenic
1182024924 22:27110655-27110677 TGGCTGCACAGCTGTCTTCCGGG + Intergenic
1182369223 22:29799241-29799263 GGGCAGACAAGGGGTCCTCCAGG - Intronic
1182991897 22:34776233-34776255 GGGATTCCAAGAGGACTTCCTGG + Intergenic
1183710900 22:39502592-39502614 GGGCAGCCGAGGGGTCTCCCAGG - Intronic
1184356722 22:43985778-43985800 GAGCTGCCAGGCGAGCTTCCGGG + Intronic
1184910673 22:47531869-47531891 GTGCTGCCAAGTCTTCTTCCTGG - Intergenic
1184959409 22:47918141-47918163 GGGCTGCCTGAGGGTCTTCCTGG - Intergenic
954934345 3:54313122-54313144 GGGCTGCCCTGCAGTCTTACTGG - Intronic
963038138 3:141050142-141050164 TGGCTGCTAAGAGGTCTTTCTGG + Intergenic
968596577 4:1489130-1489152 GGGCTGCCGAGTGCTCTGCCCGG - Intergenic
975547398 4:75573824-75573846 GTGCTGCCAAGCCGTGATCCGGG - Intergenic
985835385 5:2268139-2268161 AGGCTGCCAGGGGGACTTCCGGG + Intergenic
999296828 5:150464942-150464964 GGGCTTCCCAGCGGTCTTAGAGG - Intergenic
1001227100 5:169954492-169954514 GGGTGGCCAAGAGGTCTTTCTGG - Intronic
1001371259 5:171205536-171205558 GGGCTGGCAAGAGATCTTCGAGG + Exonic
1001605725 5:172958702-172958724 GGGCCTCCAGGCAGTCTTCCAGG + Intergenic
1002607053 5:180389730-180389752 GGGCTGCACAGCCGTCCTCCCGG - Intergenic
1003176019 6:3752346-3752368 GGGCTGCCCCGCGGTCTGTCCGG - Intergenic
1006716234 6:36122498-36122520 CGGCTGCCAGGCACTCTTCCAGG + Intergenic
1007799369 6:44379001-44379023 AGGCTGCCAAGAGATTTTCCAGG + Intergenic
1010723296 6:79308148-79308170 GCCCTGCAAAGGGGTCTTCCAGG - Intergenic
1012506151 6:99948528-99948550 TTGCTGTCAAGCTGTCTTCCAGG - Intronic
1013831959 6:114283368-114283390 AAGCTGCCAAGAGGTCTTACAGG - Intronic
1016410391 6:143776813-143776835 GGGCTGCCAGGCAGACTTCAAGG - Intronic
1019055900 6:169223135-169223157 GGGATGCCATGTGGTCTTTCTGG - Intronic
1019124930 6:169831725-169831747 TGGTTGCCAAGAGGTCTCCCAGG + Intergenic
1019205500 6:170358348-170358370 GGACTGCACAGCTGTCTTCCGGG - Intronic
1022126009 7:27358143-27358165 GGGGTGCCAGGCAGCCTTCCTGG - Intergenic
1024192473 7:47026933-47026955 GAGCTGCCTGGCTGTCTTCCCGG + Intergenic
1029107878 7:98193399-98193421 GTGCTGACAAGCTGTCCTCCAGG - Exonic
1034448840 7:151126758-151126780 GGTCTGCGAAGGAGTCTTCCAGG - Intronic
1035296280 7:157868480-157868502 GGGCTGCGCTGCTGTCTTCCAGG + Intronic
1035322116 7:158038028-158038050 GGGCTGCCAAGGGCTCTGTCTGG + Intronic
1040825222 8:51612720-51612742 GGGCTGGCGAGGGCTCTTCCAGG - Intronic
1049211239 8:141387320-141387342 TGCCGGCCAAGCGTTCTTCCTGG - Intergenic
1053162162 9:35820636-35820658 GGGCTGCCAAAGGTTCTTCAAGG + Intronic
1053887266 9:42653467-42653489 GGGTGGCCAAGAGGTCTTTCTGG - Intergenic
1054226287 9:62460918-62460940 GGGTGGCCAAGAGGTCTTTCTGG - Intergenic
1062264434 9:135680267-135680289 GGGCTGGCAGGCGGTCTCTCCGG + Intergenic
1062327277 9:136018269-136018291 GGGCTGCCAAGGGGGCTGCTGGG + Intronic
1062355881 9:136162105-136162127 GGGCAGCCAAGGGGGCCTCCAGG - Intergenic
1190944195 X:55075118-55075140 GGTCCGCAGAGCGGTCTTCCTGG + Intronic
1190958396 X:55220456-55220478 GGTCTGCAGAGTGGTCTTCCTGG + Exonic
1190963951 X:55280156-55280178 GGTCCGCAGAGCGGTCTTCCTGG + Intronic
1195977210 X:110540403-110540425 GGGTTGCCCAGTTGTCTTCCAGG + Intergenic
1197863609 X:130995766-130995788 TGGCTGCCCAGCTGTCTTTCAGG - Intergenic
1201567674 Y:15383942-15383964 GGGCTGACAAGAGACCTTCCCGG - Intergenic