ID: 920380775

View in Genome Browser
Species Human (GRCh38)
Location 1:205533354-205533376
Sequence GGGCAGCAGGACGAGGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 434}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920380775 Original CRISPR GGGCAGCAGGACGAGGGTGT GGG Intergenic
900320651 1:2081831-2081853 GGGCAGCAGGAAGGGGATGCTGG - Intronic
900430321 1:2598305-2598327 GGGCAGAAGGTAGAGGGTGAGGG + Intronic
900473083 1:2864047-2864069 GGCCAGCAGGACTGGGGGGTGGG - Intergenic
900613021 1:3552358-3552380 GGGCAACAGGACTGGGGTCTAGG + Intronic
900665126 1:3810105-3810127 GGGTAGCAGGAGGAGGGAGGAGG - Intergenic
900789900 1:4672921-4672943 GGGCAGGAGGGTGAGGGTGGTGG + Intronic
901061281 1:6473112-6473134 GGGCAGCCCGAAGAGGCTGTAGG + Exonic
901139000 1:7015896-7015918 GAGCAGGAGGAAGAGGGTGAAGG + Intronic
901165233 1:7216140-7216162 GAGCAGGAGGAAGAGGGTGAAGG + Intronic
901297582 1:8172349-8172371 GGGTAGCAAGAGGCGGGTGTCGG + Intergenic
901646883 1:10721627-10721649 GGGGGGCTGGACGAGGGTGGAGG + Intronic
901771951 1:11535083-11535105 GGGCAGCAGGAGCAGGATGTGGG - Exonic
902201476 1:14836656-14836678 GGGGAGCAGGAGGTGGGAGTTGG - Intronic
902686376 1:18080249-18080271 GGGCAGGAGCACGAGGGGGTGGG + Intergenic
903027858 1:20442415-20442437 GTGAAGCAGGATGAGGGGGTGGG - Intergenic
903183559 1:21617450-21617472 GGGCAGCAGGATGAGGGGGAAGG + Exonic
903855589 1:26336232-26336254 GGGAAGGAGGACGATGGAGTGGG + Intronic
904084207 1:27892985-27893007 TGGAATCAGGACAAGGGTGTTGG + Intronic
904224562 1:29005228-29005250 GAGCAGGAGGAAGAGGGGGTGGG + Intronic
904274206 1:29369699-29369721 GGACAGCAGCACCAGGGTGAGGG - Intergenic
904364497 1:30001789-30001811 GGGCAGCAGCACCAGGGTAAGGG - Intergenic
904423758 1:30410390-30410412 GGACAGCAGCACCAGGGTGAGGG + Intergenic
904480251 1:30788848-30788870 GAGCAGAAGGAGGAGGGTCTAGG + Intergenic
905858112 1:41328341-41328363 GGGCAGCAGGAAGAGAGGGTAGG - Intergenic
906102654 1:43273057-43273079 GAGCAGCACCACGAGGGCGTCGG - Exonic
906544545 1:46612053-46612075 GGGCAGCAGGAGGGGGTTGTTGG - Intronic
906933191 1:50189346-50189368 GGGCATCAGGACGAGGGCTGAGG - Intronic
907364022 1:53945473-53945495 AGGCAGAAGGACGGGGATGTTGG - Intronic
908516440 1:64897451-64897473 GAGCAGGAGGACGAGGGAGGAGG + Intronic
908816736 1:68042956-68042978 GGGCAGCAGGAGGTGGGGGTGGG - Intergenic
909392414 1:75132636-75132658 GGGAAGCAGGGCGGGGGTGCGGG - Intronic
912386374 1:109273091-109273113 GGGAAGCAGGACTGGGGTGGTGG + Intronic
912702555 1:111888999-111889021 GGGCAGCAGGAGGAGGGGCAGGG + Intronic
913332785 1:117681367-117681389 GGGCAACAGGATGAGAATGTGGG + Intergenic
914681164 1:149939189-149939211 GGGCAGCCGGAGGAGGGAGGTGG + Exonic
915091379 1:153428665-153428687 GGGCAGAGGGAGGAGGGGGTCGG + Intergenic
915140357 1:153764062-153764084 GGGCAGGAGGGCTTGGGTGTAGG + Intronic
916961481 1:169893804-169893826 GGGGAGGAGGCCGAGGGTCTTGG + Exonic
919813184 1:201421801-201421823 GGGCAGCAGGAGGGGGCAGTGGG - Intronic
919932378 1:202229680-202229702 GGGCAGCAGGGGGAGGTTGTGGG + Intronic
920276233 1:204807102-204807124 GGGCAGCAGAACACTGGTGTTGG - Intergenic
920380775 1:205533354-205533376 GGGCAGCAGGACGAGGGTGTGGG + Intergenic
920388073 1:205581876-205581898 GAGCAGCAGGGCAAGGGTGGGGG + Intronic
920500069 1:206480226-206480248 GGTGAGCAGGAGGAGGGGGTGGG + Intronic
920870173 1:209787597-209787619 GGGCGGCAGGGAGAGGGGGTAGG - Exonic
921123064 1:212153400-212153422 GGGCAGGAGGTGGAGGGTGGAGG - Intergenic
921863521 1:220064419-220064441 TGGAAGGAGGAGGAGGGTGTGGG + Intronic
922452948 1:225751262-225751284 AGACAGCAGGACCTGGGTGTGGG - Intergenic
922575556 1:226658830-226658852 GGGCAGGAGAACGAGGATGATGG + Intronic
1062777455 10:164900-164922 GGGTGGCAGGAAGAGGGGGTAGG + Intronic
1062798633 10:363014-363036 GCTCAGCAGATCGAGGGTGTAGG - Intronic
1063330445 10:5153650-5153672 GAGCAGCAGGAAGAGAGTGAAGG + Intergenic
1064299591 10:14111856-14111878 GGGCAGGTGGAGGAGGGAGTAGG + Intronic
1065689543 10:28319165-28319187 GAGCAGGAGGAAGAGGGTGAAGG + Intronic
1066200108 10:33136366-33136388 GGGCAGAAAGACGGGGGAGTGGG + Intergenic
1066412952 10:35191773-35191795 GCTCAGCAGGAAGAGGGTGGGGG - Intronic
1068816430 10:61320181-61320203 GTGCAGCAGGACTAGCGGGTAGG - Intergenic
1069774252 10:70917674-70917696 GGACAGCAGGCAGAGGGTCTTGG + Intergenic
1069878953 10:71579897-71579919 CGGCAGCAGGAAGGGGGTGCTGG + Intronic
1069889133 10:71642338-71642360 GGGCAGCAGCACAGGGTTGTGGG + Intronic
1070319116 10:75341840-75341862 TGGGAGCAGGAGGAGGGAGTGGG - Intergenic
1072313639 10:94181040-94181062 GGGCAGCAGGAGGAGGCAGTGGG + Intronic
1072808592 10:98443000-98443022 GGGCAGCATGAGCAGGGTGCTGG - Intronic
1073377652 10:103050657-103050679 GGGCAGTGGGTCGGGGGTGTGGG + Intronic
1074127400 10:110539977-110539999 GGGCCAGAGGACGAGGGTCTTGG + Intergenic
1074370760 10:112899049-112899071 GGGCAGCAGGGGGTGGGGGTGGG + Intergenic
1074523819 10:114247833-114247855 GGGCACCAGGATGAGGATGAGGG + Intronic
1074801904 10:117008225-117008247 GGGGAACAGGACCAAGGTGTGGG + Intronic
1075024645 10:118975626-118975648 GAGCAGCAGGACTGGGGGGTGGG + Intergenic
1076336874 10:129712818-129712840 AGGCAGCAGGATGGGGTTGTAGG - Intronic
1076582382 10:131520365-131520387 TGGGGGCAGGACGAGGGGGTCGG - Intergenic
1076841590 10:133048577-133048599 AGGCAGCAGGAGGAAGCTGTGGG + Intergenic
1077304533 11:1863190-1863212 GGGCAGCACGCCGGGGGTGGCGG - Intronic
1077374064 11:2197429-2197451 GGGCTGCAGGAGGAGGGTGCTGG + Intergenic
1077384751 11:2263602-2263624 GGGCAGTAGGTGGAGGGTGGGGG - Intergenic
1078042304 11:7879121-7879143 GAGCAGGAGGAAGAGGGTGGGGG + Intergenic
1078409802 11:11105114-11105136 GGGCTGCAGGAGGAGGGCTTAGG + Intergenic
1079136281 11:17777480-17777502 GGGCTGAGGGAGGAGGGTGTTGG - Intronic
1079450459 11:20596871-20596893 GGGCAGCAGGTCGTGCGTATGGG - Intergenic
1081604384 11:44518276-44518298 GGGCTGCAGAAGGAGGCTGTGGG + Intergenic
1081763018 11:45590457-45590479 GGGCAGCAAGACGTTGTTGTTGG - Intergenic
1083141170 11:60722986-60723008 GGGCCGGAGGACGAGGCTCTAGG + Intergenic
1083419725 11:62546085-62546107 GGGCAGCTGGAGGAGGCTGAGGG + Intronic
1083594995 11:63914961-63914983 GGGCAGCAGGGGCAGGGTCTTGG + Intronic
1083678596 11:64341191-64341213 GGGCAGAGGCAGGAGGGTGTGGG - Intronic
1083914012 11:65728241-65728263 GGGCAGCTGCAAGAGGGGGTAGG - Intergenic
1084365294 11:68693585-68693607 GGTCAGCAGCACAAAGGTGTCGG + Intergenic
1084746297 11:71171996-71172018 GGGCAGCAGCAGTAGGGTGATGG + Intronic
1084887508 11:72220815-72220837 TGGCAGGAGGAGGAGGGTATGGG + Intronic
1085455029 11:76660753-76660775 GGGGAGCCGGATGAGGTTGTTGG + Exonic
1086246613 11:84760900-84760922 GGGGAGCAGGAAGAGGGGGATGG - Intronic
1086564562 11:88211343-88211365 GCGGTGCAGGACGAGGGTGAGGG + Intergenic
1086865245 11:91972276-91972298 TGGCAGCAGGGCGTGGGGGTGGG - Intergenic
1088596362 11:111443763-111443785 GGGCAACAGGACGAGGACCTGGG + Intronic
1089174314 11:116537326-116537348 GGGCAGAGGAACGTGGGTGTTGG - Intergenic
1089518416 11:119048261-119048283 TGGCTGGAGGATGAGGGTGTTGG - Exonic
1089777740 11:120850455-120850477 GGGCACCAGGAGGAGAGTGCTGG + Intronic
1089834444 11:121357650-121357672 GGGCAGGTGGATGAGGGTGCAGG + Intergenic
1090187799 11:124749674-124749696 GGGCATCAGGAAGAGGGTACTGG - Intronic
1090188944 11:124756079-124756101 GGGGAGGAGGAGGAGGATGTGGG - Intronic
1090339504 11:126004060-126004082 GGGCAGCTGGATGATGGGGTTGG - Exonic
1091847619 12:3669533-3669555 GTGCAAAAGGACAAGGGTGTGGG + Intronic
1092286258 12:7130647-7130669 GGGCAGCAGCAGGAGGGTCATGG - Exonic
1093194875 12:16118750-16118772 GGGCAGCAGTACAAGGGGGCTGG - Intergenic
1096546806 12:52345682-52345704 GGGCTGCTGGAGGAGGGTGGGGG + Intergenic
1097107082 12:56632305-56632327 GGGCGGCGGGATGGGGGTGTGGG + Intronic
1097166608 12:57089448-57089470 GGGAAGCAGGACGGGGGTGGGGG + Intronic
1097594435 12:61610860-61610882 GGGCAGCAGGAAGAGGGCATTGG - Intergenic
1097863923 12:64543498-64543520 GGGCGGCGGGGGGAGGGTGTGGG - Intergenic
1099688000 12:85913817-85913839 GGGCAGCAACAAGATGGTGTTGG - Intergenic
1100186485 12:92145366-92145388 GGTGAGCAGGGCGAGGGCGTCGG - Exonic
1102965830 12:117124746-117124768 GGGCAGCAGGAGGAGAGTCCAGG + Intergenic
1103133402 12:118487747-118487769 GTGGAGAAGGACGTGGGTGTTGG + Intergenic
1103681304 12:122696282-122696304 GGTCAGAAGGATGAGGTTGTTGG + Intergenic
1103683034 12:122709707-122709729 GGTCAGAAGGATGAGGTTGTTGG + Intergenic
1103721151 12:122976273-122976295 GGGAAGGAGGAGGAGGGAGTGGG - Exonic
1104975124 12:132548775-132548797 GGGCACCTGGACGGGGGTGAGGG + Intronic
1106467772 13:30028028-30028050 GGGCTGCAGGAGGAGGCTGAAGG + Intergenic
1107769933 13:43778844-43778866 GGGCAACAGGACGAGGTGGAGGG + Intronic
1108696837 13:52909608-52909630 GGGCAGGAGGAAGATGGGGTGGG + Intergenic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1113260429 13:108555736-108555758 GGGGAGGAGGAGGAGGGAGTTGG - Intergenic
1113992064 14:16035588-16035610 GGCCAGCTGGAGGAGGGTGGCGG - Intergenic
1114036747 14:18636492-18636514 GGGCAGCAGGAGGGGGGTCCCGG - Intergenic
1114121889 14:19678545-19678567 GGGCAGCAGGAGGGGGGTCCCGG + Intergenic
1114441136 14:22748927-22748949 GGGCACCAAGAGGAGGGTGCAGG + Intergenic
1114567613 14:23644258-23644280 GGGCAGCAGGAGGATGGTGGGGG - Intronic
1117374427 14:55107945-55107967 AGGCAGCAGCACGAGGCTGCAGG + Intergenic
1117920644 14:60723091-60723113 GGGCAGCCGGACCAGGCTGGTGG + Intronic
1118589561 14:67391391-67391413 GGGGAGCTTGAGGAGGGTGTGGG - Intronic
1119174839 14:72561539-72561561 GGGCACCAGGAGGAGGGTGAGGG - Intronic
1119243436 14:73082248-73082270 AGACAGAAGGAGGAGGGTGTAGG - Intronic
1119472268 14:74907474-74907496 GGGCAGCTGGAGCTGGGTGTGGG + Exonic
1121006966 14:90496587-90496609 GCGCAGCAGGAGCAGGGTGGGGG - Intergenic
1121048906 14:90807201-90807223 GGGCACCAGGAGGAGGATCTTGG - Intronic
1121118677 14:91361801-91361823 GGGTGGTAGGGCGAGGGTGTTGG - Intronic
1121938687 14:98045627-98045649 GTGCAGGAGGAAGAGGGTGAAGG - Intergenic
1122362401 14:101175166-101175188 GGGCAGGAGGCCAGGGGTGTGGG + Intergenic
1122422020 14:101583720-101583742 GGGCATCTGGATGAGGGTGTTGG + Intergenic
1122828999 14:104386606-104386628 GGGCAGCATGGCCAGGGCGTGGG + Intergenic
1122939771 14:104976084-104976106 GGGCAGCAGGTGCAGGGTGGGGG + Intronic
1122979733 14:105186028-105186050 GGTCAGGAGGTCGGGGGTGTGGG + Intergenic
1202918725 14_KI270723v1_random:10820-10842 TGGCAGAAGGATGAGGGAGTGGG + Intergenic
1202925899 14_KI270724v1_random:23750-23772 TGGCAGAAGGATGAGGGAGTGGG - Intergenic
1123467412 15:20527149-20527171 GGGCAGCAGGAGGTAGGGGTGGG + Intergenic
1123574328 15:21651748-21651770 TGGCTTCAGGACCAGGGTGTTGG + Intergenic
1123610943 15:22094335-22094357 TGGCTTCAGGACCAGGGTGTTGG + Intergenic
1123650702 15:22473893-22473915 GGGCAGCAGGAGGTAGGGGTGGG - Intergenic
1123741111 15:23282735-23282757 GGGCAGCAGGAGGTAGGGGTGGG - Intergenic
1123745887 15:23319823-23319845 GGGCAGCAGGAGGTAGGGGTGGG + Intergenic
1124278159 15:28343140-28343162 GGGCAGCAGGAGGTAGGGGTGGG + Intergenic
1124304542 15:28568468-28568490 GGGCAGCAGGAGGTAGGGGTGGG - Intergenic
1124952612 15:34337686-34337708 GGGCAGCAGGGTGAGGGAGAAGG + Exonic
1125535270 15:40438711-40438733 TGGCAGCAGGACGAGGTGGCAGG - Intergenic
1125597884 15:40899233-40899255 GGGCAGCTGGTGGAGAGTGTGGG + Exonic
1125834712 15:42738620-42738642 GGGCGGAAGGATGAGGGTGGGGG + Intergenic
1126142743 15:45451059-45451081 GGCCAGCAGGAGGTGGGTGGGGG - Intergenic
1126413667 15:48396503-48396525 CGGCAGCAGGAAGAGGCAGTGGG - Intergenic
1126568109 15:50121326-50121348 GGGCTGCAGGAAGAGAGTATGGG + Intronic
1127282124 15:57501599-57501621 GGGGAGCAGGAGGAGGGTAAGGG + Intronic
1127784420 15:62343255-62343277 CGGCAGCAGCCAGAGGGTGTGGG - Intergenic
1128453564 15:67820980-67821002 GGGGAGCAGGTCGTGGGGGTAGG - Intronic
1129150543 15:73684998-73685020 GCCCAGCAGGGCGAAGGTGTGGG + Intronic
1129237944 15:74234954-74234976 GGGCAGCAGGTTCAGGGGGTGGG - Intergenic
1129746853 15:78028068-78028090 GGCCAGCAGGAATAGGGTGCAGG - Intronic
1129771243 15:78204739-78204761 GGGTAGCAGGAGGAGGCCGTTGG - Intronic
1130057017 15:80535072-80535094 GGGCAGGAGGAAGAGGAGGTGGG + Intronic
1130885278 15:88087508-88087530 GGACAGGAGGAAGAGAGTGTAGG + Intronic
1131106240 15:89736759-89736781 TGGCAGCTGGAGGAGGCTGTTGG + Intronic
1132093039 15:98960929-98960951 GAGCAGCAGGACCAGGGAGACGG - Exonic
1132156128 15:99496345-99496367 CGGGGGGAGGACGAGGGTGTGGG + Intergenic
1202983192 15_KI270727v1_random:386091-386113 TGGCTTCAGGACCAGGGTGTTGG + Intergenic
1132514643 16:360492-360514 GGGCAGCAGGACGTGGTCGGGGG + Intergenic
1132973872 16:2702007-2702029 GGGCAGCGGGAGGAGAGTGGAGG - Intronic
1133328325 16:4956005-4956027 GGGCTGGAGGAGGAGGGAGTGGG + Intronic
1134670116 16:16048356-16048378 GGGCAGTGGGCCGAGGGAGTGGG + Intronic
1135858377 16:26032826-26032848 CGGCAGCAGGACGTAGGTGCTGG + Intronic
1136748645 16:32614100-32614122 GGGGAGCAGGACAAGGCTGCTGG - Intergenic
1137284586 16:47004630-47004652 AGGAAGCAGGATGAGGGTGTTGG - Intergenic
1137546154 16:49405121-49405143 GGGCAGCAGGGTGTGGCTGTGGG - Intergenic
1137833265 16:51564964-51564986 AGGCAACAGCACGAGGGTGATGG + Intergenic
1137879060 16:52027259-52027281 GGGCAGTAGGACAATGGGGTAGG - Intronic
1138216274 16:55207749-55207771 GGGCAACAGGACCTGGGTGGTGG - Intergenic
1138293413 16:55867313-55867335 GGGCAGCAGCATGGGGGTGTGGG - Intronic
1138352933 16:56355966-56355988 GGGCAGCAGCACGAGGGGTCAGG - Intronic
1139576881 16:67847376-67847398 GGGTAGCAGGACGTGGGGCTGGG - Intronic
1140038528 16:71389896-71389918 GGGCAGCAGAAGCAGGGTTTGGG - Exonic
1141054443 16:80803516-80803538 GGGCAGCAGGTGGGGGGTGAGGG + Intronic
1141702112 16:85647252-85647274 GGGTAGCAGGGGGAGGGTGCAGG - Intronic
1141941494 16:87278975-87278997 GGGCAGCAGTGCGAGAGTGCAGG + Intronic
1142008237 16:87700565-87700587 GGGTAGAAGGAAGAGGGTGGAGG + Intronic
1142135604 16:88450634-88450656 GGGCAGCAGGTGGGGGGTGGAGG + Intergenic
1142187004 16:88699380-88699402 GGGGAGCAGGAGGAGGGCGCAGG - Intronic
1203050778 16_KI270728v1_random:873314-873336 GGGGAGCAGGACAAGGCTGCTGG - Intergenic
1142499147 17:322673-322695 GGGCAGCAGGCTGAGGGAGGCGG + Intronic
1143365051 17:6401970-6401992 GAGCAGGAGGAGGAGGGAGTGGG + Intronic
1143775244 17:9195092-9195114 GGGGAAAAGGACGAGGGGGTGGG - Intronic
1143796829 17:9343741-9343763 AGGGAGCAGGAGGAGGGGGTGGG - Intronic
1144730436 17:17522911-17522933 GGGCAGAGGGAGGAGGGTGAGGG - Intronic
1144833294 17:18143608-18143630 TGGGAGCAGGAGGTGGGTGTGGG + Exonic
1145268060 17:21389981-21390003 AGGCAGGAGGAGGAGGGTCTGGG - Intronic
1145751751 17:27360099-27360121 GGGGAAGAGGATGAGGGTGTCGG + Intergenic
1146127932 17:30243693-30243715 AGGCAGTAGGAGGAGGGAGTTGG + Intergenic
1146562749 17:33885170-33885192 GGACAGCAGGACCTGGATGTGGG - Intronic
1147743120 17:42679835-42679857 CAGCAGCAGGGCGAGGCTGTAGG + Exonic
1147773907 17:42887013-42887035 AGGCAGCAGGAAGAGGGAGATGG + Intergenic
1147784790 17:42971732-42971754 GGGCAGGAGCAGGAGTGTGTGGG + Intronic
1147948761 17:44095493-44095515 GGGCAGGAGGGAGAGGCTGTGGG + Intronic
1148484064 17:47979272-47979294 GGGGAGGATGACGAGGATGTTGG + Intronic
1148742109 17:49898744-49898766 TGGCATCAGGTCAAGGGTGTGGG - Intergenic
1150307198 17:64095812-64095834 AGGCAGCAGGTCTAGGGTGCAGG - Intronic
1151283339 17:73092530-73092552 GGCCATCAGGACAAGAGTGTGGG - Intronic
1151969690 17:77451297-77451319 GGGGAGCAGGAGGAGGGGGCAGG - Intronic
1152253818 17:79225932-79225954 GGGAAGCAGGATGGGGGTGTGGG + Intronic
1152360141 17:79829142-79829164 GAGGAGCAGGAGGAGGGAGTTGG + Intergenic
1152716369 17:81902559-81902581 CGGCGGCAGGACGTGGGTGGGGG + Intronic
1152797150 17:82314107-82314129 AGGCAGCTGGATGAGGCTGTGGG + Intergenic
1153699419 18:7677821-7677843 AGGCAACAGGACAAGGGAGTGGG - Intronic
1155506779 18:26541154-26541176 GGGCAGCAGGAAGATGGTGCAGG - Intronic
1156556690 18:38076437-38076459 GGGCTGCAGGAAGAGTGTGGAGG + Intergenic
1156972760 18:43176895-43176917 GGGCAGCAGGACTAGGGAATGGG + Intergenic
1157565348 18:48675748-48675770 GGGCAGCAGCACGGGGCTGCAGG + Intronic
1158707657 18:59807852-59807874 GGGCAGCAGGTCGAGGGCTGTGG - Intergenic
1160239260 18:77111496-77111518 GGGCAGCAGCAGAAGGCTGTGGG + Intronic
1160508843 18:79442141-79442163 GGGCAGCGGGCCGAGGCGGTGGG + Intronic
1160749781 19:728279-728301 GGGCAGCAGGGTCAGGGTGGAGG + Intronic
1160930200 19:1566815-1566837 GGGCGGCAGGCCCCGGGTGTGGG - Intronic
1161795938 19:6386928-6386950 GGGCAGGGGGACGAGGCTGGGGG - Intronic
1161992199 19:7690357-7690379 GGGCAGCATGGCGAGGGTGGGGG - Intronic
1162583696 19:11546284-11546306 GCCCAGCAGGAGGAGGGTGACGG - Intronic
1162918140 19:13885172-13885194 GAGAAGGAGGAGGAGGGTGTGGG + Intronic
1163678825 19:18669202-18669224 GGGCAGCAGGACGGGGGCGCAGG - Exonic
1163745345 19:19043428-19043450 GGGCAGGAGGAGGGGAGTGTGGG - Intronic
1163861397 19:19744775-19744797 GGGCGGCAGGATGAGGGGCTCGG + Intergenic
1164855278 19:31516357-31516379 GGGCAGCAGGCAGTGGGTGCAGG + Intergenic
1164871440 19:31647582-31647604 GAGCAGGAGGAAGAGGGTGGGGG + Intergenic
1166213967 19:41323888-41323910 GGGGAGCAGGAGCCGGGTGTGGG - Exonic
1166226550 19:41399270-41399292 GGGCTGCAGGAGCAAGGTGTGGG + Intronic
1166317135 19:41995625-41995647 CGGCAGCAGGCCTGGGGTGTGGG - Intronic
1167091842 19:47349604-47349626 GGACTGAAAGACGAGGGTGTTGG + Intronic
1167748673 19:51367427-51367449 GGACAGCGGGAAGAGGGTGGAGG - Intronic
1168267511 19:55230741-55230763 GGGCAGCAGGGCGGGGGGGTGGG - Intronic
1168721753 19:58558297-58558319 GGGCAGCAGCAAGAAGGCGTCGG - Exonic
925045000 2:766462-766484 AGGCAACAGGACCATGGTGTTGG + Intergenic
925091108 2:1156669-1156691 GGGCAGAAGGACGAGGGACCAGG + Intronic
926172188 2:10559341-10559363 GGGCAGCAGGATGGGGGTGTGGG - Intergenic
926208275 2:10849407-10849429 GAGCAGGAGGAAGAGGGTGGGGG + Intronic
927096667 2:19752454-19752476 GGAAAGCAGGACATGGGTGTAGG - Intergenic
927155681 2:20219905-20219927 GGGCAGCATGGCGCGGGTGGTGG - Intronic
927517261 2:23679770-23679792 GGGCAGAGGGCAGAGGGTGTGGG + Intronic
928606200 2:32947106-32947128 TGGGAGCAGGAGGAGGGCGTGGG - Exonic
929436439 2:41932282-41932304 AGGCAGCAGGAGTGGGGTGTTGG - Intergenic
929668878 2:43853837-43853859 GGACACTAGGAGGAGGGTGTGGG - Intronic
931269273 2:60687567-60687589 GGACAACTGGACGAGGCTGTGGG + Intergenic
932122319 2:69113183-69113205 GGACAGCAGGACTAGGGGGAAGG - Intronic
933918332 2:87019012-87019034 GGGCTGCAGGCAGAGGGAGTGGG + Intronic
934004664 2:87750901-87750923 GGGCTGCAGGCAGAGGGAGTGGG - Intronic
934955495 2:98614323-98614345 GGGGATCAGGAAGAGGGAGTGGG + Intronic
935196583 2:100820030-100820052 GGGGAGGAGGAGGAGGGTGGGGG + Intergenic
935361683 2:102251019-102251041 GGGCAGAAGGACGAGTAGGTGGG + Intergenic
935767621 2:106384934-106384956 GGGCCGCAGGCAGAGGGAGTGGG - Intergenic
937169417 2:119850607-119850629 GGGCAGAAGAAGGAGGGAGTGGG + Intronic
937264034 2:120604935-120604957 GGACAGCAGGGCCAGGGTCTGGG + Intergenic
938069948 2:128303059-128303081 GGGCAGCAGGTCGGATGTGTGGG - Intronic
938169411 2:129061580-129061602 GGCCAGCAGGGCAATGGTGTGGG - Intergenic
941580780 2:167293417-167293439 GGGCATCCCGACGAAGGTGTTGG + Intergenic
942959342 2:181811343-181811365 GGGCAGGAGGAGGGGGGAGTAGG + Intergenic
943039987 2:182793016-182793038 GGGCAGCAGCAGGAGAGTTTCGG + Exonic
943786137 2:191880876-191880898 GGACTGCAGGAGGAGGATGTGGG + Intergenic
944595737 2:201258846-201258868 GGGCAGGAGGGCAAGGGTGGGGG - Intronic
946059243 2:216927478-216927500 AGGAAGCAGGAGGAGGGTGAGGG + Intergenic
946131458 2:217610087-217610109 GGGCTGCAGGAAGAGGCTGCAGG + Intronic
946199064 2:218060603-218060625 TGCCAGCAGGACCAGGTTGTAGG + Intronic
946209431 2:218135598-218135620 TGCCAGCAGGACCAGGTTGTAGG - Exonic
946213300 2:218164420-218164442 TGCCAGCAGGACCAGGTTGTAGG + Exonic
946418292 2:219551490-219551512 GGGCAGCGGCAGGAGGGTGAGGG - Intronic
947744677 2:232501451-232501473 TGGCAGCAGGCCGAAGGTGGTGG - Intergenic
947997512 2:234541174-234541196 GGGGAGTAGGATGAGGATGTTGG + Intergenic
948902027 2:240960909-240960931 GGGCAGCAGGGGGAGGGGGAGGG + Intronic
948902310 2:240962934-240962956 GGGCAGTGGGAGGAGGGTCTTGG - Intronic
948919189 2:241053363-241053385 GGCCAGGATGAGGAGGGTGTGGG - Intronic
949037487 2:241822503-241822525 GGGCTCCAGGACGCAGGTGTGGG + Intergenic
1168830833 20:844514-844536 GGGCAGGAGGGAGGGGGTGTGGG + Intronic
1168993348 20:2113485-2113507 GGGCAGCAGGCCTAGGGAGAGGG + Intronic
1169962096 20:11172192-11172214 GGGCAGCAGGAAAAGAGTTTGGG - Intergenic
1171782705 20:29435516-29435538 TGGCAGAAGGATGAGGGAGTGGG + Intergenic
1172133697 20:32673288-32673310 GGGGAGCAGGAGGAGGCTGCTGG - Intergenic
1172877917 20:38177285-38177307 GGGCAGCAGGAGGAGGTGGGTGG + Intergenic
1173613943 20:44390624-44390646 TAGCAGCAGGAGGAGGATGTCGG + Intronic
1173929905 20:46809922-46809944 TGGCAGCAGGAATAGCGTGTGGG + Intergenic
1174087366 20:48018746-48018768 GGGCAGGAGGACTGGGGCGTGGG - Intergenic
1174128922 20:48328224-48328246 GGGCAGGAGGACTGGGGCGTGGG + Intergenic
1175223572 20:57431978-57432000 GGGCAGCGGGTCGGGGGTGGGGG + Intergenic
1175415353 20:58797223-58797245 GGGCCGCAGGGCGAGGCTGTGGG + Intergenic
1175540296 20:59743905-59743927 GGGCAGCAGGAGGTGAGTGGAGG - Intronic
1175745202 20:61451699-61451721 GGGAAGGAGGAGGAGGGGGTAGG + Intronic
1175919672 20:62444794-62444816 GGGCAGGAGAAGGAGGGTGGAGG + Intergenic
1175970693 20:62685240-62685262 GGGCAGGAGGAGGGGGGTGGTGG + Intronic
1176134337 20:63514652-63514674 TGGCAGCAGGAAGAGAGTGAAGG + Intergenic
1176246098 20:64097855-64097877 CGTCAGCAGGACCAGAGTGTCGG - Exonic
1176285081 21:5015224-5015246 GGGCAGCTGGGAGAGGCTGTGGG - Intergenic
1179437852 21:41374437-41374459 GGGCGGCAGGAGTAGGGTCTGGG + Intronic
1179507294 21:41850286-41850308 GGGCACCAGGAGGAAAGTGTGGG - Intronic
1179592047 21:42415329-42415351 GGGGAGCAGCATGAGTGTGTAGG - Intronic
1179872100 21:44248251-44248273 GGGCAGCTGGGAGAGGCTGTGGG + Intronic
1179907667 21:44432595-44432617 GGGCAGGAGGACCCGGGTGCAGG - Intronic
1179922227 21:44513534-44513556 GGGCAGCAGGGCCAGGCTCTGGG - Intronic
1180315207 22:11271939-11271961 GGCCAGCTGGAGGAGGGTGGCGG + Intergenic
1180460871 22:15563540-15563562 GGGCAGCAGGAGGGGGGTCCCGG - Intergenic
1180885553 22:19240873-19240895 GGGCAGCAGCAGGAGGAGGTTGG + Intronic
1180983106 22:19888624-19888646 GCGCCTGAGGACGAGGGTGTGGG + Intronic
1181054601 22:20254750-20254772 GGGCAGCAGGACAAGTGCTTGGG + Intronic
1181397002 22:22629818-22629840 GGGCAGAGGGAGGAGGGGGTGGG + Intergenic
1181499747 22:23309177-23309199 GGGCAGAGGGAGGAGGGGGTGGG + Intronic
1181955658 22:26586279-26586301 GGGCAACAGGGCGAGATTGTAGG - Intronic
1182123603 22:27801443-27801465 GGGCAGCGAGACGAGGGGTTGGG + Exonic
1182486730 22:30643565-30643587 AGCCAGCAGGAGCAGGGTGTGGG + Intronic
1182566909 22:31206859-31206881 GGGTGGCAGGAGGAGGGTGGAGG - Exonic
1182675436 22:32035677-32035699 GGGCAACAGGAAGAATGTGTTGG - Intergenic
1183529307 22:38344234-38344256 GGGCAGGAGGAAGAGGGAGAGGG + Intronic
1183551083 22:38485958-38485980 GGGGAGGAGGAGGAGGGTATTGG + Exonic
1183683721 22:39350060-39350082 CGGCTGCCGGACCAGGGTGTAGG - Exonic
1184039704 22:41935558-41935580 GGGCAGAAGGAAGAGGCTGGAGG - Intergenic
1184264623 22:43340348-43340370 GGGCAGGAGGTAGAGAGTGTCGG - Intronic
1184265440 22:43343540-43343562 GGGCGGCAGGTGGGGGGTGTGGG + Intergenic
1184582273 22:45425818-45425840 GGGCAGCAGGAGTCGGGTGGAGG - Intronic
1184738381 22:46412344-46412366 GGGCCCCAGGACTTGGGTGTTGG - Intronic
1185047854 22:48537875-48537897 GGGGATCAGGCTGAGGGTGTAGG + Intronic
1185272464 22:49935537-49935559 GGGCAGGGGGATGAGGGTCTGGG + Intergenic
1185288063 22:50011121-50011143 GGGAAGCTGGAGGTGGGTGTAGG - Intronic
950342166 3:12257324-12257346 GGGCAGGAGGAAGAGAGTGAAGG + Intergenic
950782283 3:15402294-15402316 GGGCAGCAGGGCTAGGGAATGGG + Intronic
952341929 3:32454378-32454400 GGAGAGCAGGAAGAGGGTGCAGG - Exonic
954385930 3:50243843-50243865 GGACAGCAGGCAGACGGTGTGGG + Intronic
954432387 3:50477808-50477830 AGGCAGCAGGCCCAGGGAGTTGG - Intronic
954435506 3:50493806-50493828 AGGGAGCCGGAGGAGGGTGTTGG + Intronic
954656602 3:52197897-52197919 GGGAGGCAGCACGAGGGTGCAGG + Intergenic
954674517 3:52308468-52308490 AGGCAGCAGGACCAGGGGATGGG + Intergenic
954879013 3:53821425-53821447 GGGCAGCCGGAGGAGGGAGAAGG + Intronic
957196282 3:77072364-77072386 GGGCGGCAGGAGGAGGGTTTGGG - Intronic
957220052 3:77370516-77370538 TGGCAGCAGGTCGAGTGTATTGG + Intronic
958460093 3:94383597-94383619 AAGCAGCAGGAGGAGGCTGTGGG - Intergenic
958473919 3:94556252-94556274 GGGAAGGAGGAAGGGGGTGTGGG + Intergenic
960595468 3:119404127-119404149 GGGCAGCAGGATGAGGGATAGGG + Intronic
960947825 3:122978938-122978960 GGGCAGGAGGACGAGCATGAAGG - Intronic
961194916 3:124993527-124993549 CTGCAGCAGGACGTGGGAGTGGG + Intronic
966888515 3:184389745-184389767 GGGCAGCAGGAGTGGAGTGTCGG - Exonic
967099051 3:186200926-186200948 GGGCAGCTGGAAGGGGGTGTTGG + Intronic
968120562 3:196123033-196123055 GGGCAGCAGGGAGATGGTGAGGG - Intergenic
968450027 4:671209-671231 GGGCTGCAGGAAGGGGGTGCTGG + Intergenic
968490680 4:889122-889144 AGGCAGCAGGAGCAGGGAGTGGG + Intronic
968548261 4:1209692-1209714 GGGTAGCAGGAGGTGGGTGGGGG - Intergenic
968901120 4:3432458-3432480 GGGCTGCAGGGCCGGGGTGTGGG - Intronic
969129658 4:4982220-4982242 GGGGAGGAGGTGGAGGGTGTGGG - Intergenic
969219742 4:5751958-5751980 GGGCAGCAACAGGAGGGTTTGGG + Intronic
969452588 4:7283359-7283381 GGGGAGCAGAAGGTGGGTGTTGG + Intronic
969723092 4:8904137-8904159 AAGCAGCAGGTCGAGGGTGGAGG - Intergenic
969726121 4:8919519-8919541 GGGCAGCAGGCCGGGTGTGGTGG - Intergenic
970019678 4:11553928-11553950 GGACAGCAGGAAGGGAGTGTGGG - Intergenic
971452020 4:26809430-26809452 GGGCAGGAGAAAGAGGTTGTTGG + Intergenic
973209391 4:47599095-47599117 AGGCAGCATGATGTGGGTGTGGG - Intronic
973673650 4:53241749-53241771 GTGCAGCAGGAGGAGGGGGAGGG - Intronic
974836744 4:67260451-67260473 TTGCAGCAGCACGAGGGTGTGGG - Intergenic
976550467 4:86389168-86389190 GGGCAGGAGCAAGAGGGTGGGGG - Intronic
978382069 4:108139560-108139582 GGCCAGCAGGGCCAGGGTGGAGG - Intronic
979278067 4:118835727-118835749 GGGGAGCAGGAGGTGGGCGTGGG - Intronic
979558252 4:122075545-122075567 GGGTGGCAGGAGGAGGGTGGAGG + Intergenic
981063744 4:140458815-140458837 GAGTGGCAGGAAGAGGGTGTAGG + Intronic
981259929 4:142707568-142707590 GAGCAGGAGGAAGAGGGTGAAGG - Intronic
981938221 4:150256181-150256203 GGGCAGCGGGAGGAGGGTGGGGG - Exonic
985433084 4:189900313-189900335 GGGCAGGAGGAGGACGGTGCTGG - Intergenic
986981988 5:13458431-13458453 GTACAGCAGGACAAGGGTGATGG - Intergenic
987064996 5:14281308-14281330 GAGCAGGAGGAAGAGGGTGGAGG + Intronic
987114552 5:14715600-14715622 GGGAAGCAGGACAAGGGCCTGGG - Intronic
987862257 5:23503953-23503975 GAGCAGGAGGAAGAGGGTGAAGG - Intergenic
989380883 5:40808450-40808472 GGGCAGCAGCACAAGGTTGGAGG - Intergenic
989563229 5:42874822-42874844 GGGCAGTAGGATGAGGGAGGGGG + Intronic
990628048 5:57636334-57636356 GGGCAGAAGGACGCAGGTGTGGG + Intergenic
991001233 5:61785053-61785075 GGGCGGTAGGAGGAGGGTGAGGG - Intergenic
991281474 5:64919493-64919515 GGGGAGTAGGATGAGGGTGTAGG - Intronic
991435958 5:66597001-66597023 GAGGAGCAGGACGAGGAGGTGGG + Exonic
992757517 5:79922321-79922343 GAGCAGCAGGACGAGAGAGAAGG - Intergenic
997315497 5:132931181-132931203 GGGCAGGAGGATGGGGGAGTGGG + Intronic
997587146 5:135050228-135050250 GGGCAGGAGGGCGAGGGGCTAGG + Intronic
997765879 5:136502494-136502516 GTGAAGCAGGATGAGGGTGTAGG + Intergenic
997883674 5:137612360-137612382 GGGCAAGAGGACAAGGTTGTTGG + Intergenic
998039429 5:138943181-138943203 GGGCAGCTGGACAAGGATGTGGG - Intergenic
998148073 5:139741564-139741586 GGGGAGCAGCAAGGGGGTGTTGG + Intergenic
999127752 5:149259008-149259030 GGGCAGAAGGAGGAGGGTTAAGG - Exonic
999244589 5:150147231-150147253 GGGCAGCAGCAGGATGGTGGAGG - Intronic
1001534083 5:172486423-172486445 GGGCAGAAGGACAAGAGCGTTGG + Intergenic
1001595619 5:172896898-172896920 AGGCCCCAGGACAAGGGTGTGGG - Intronic
1002068089 5:176662531-176662553 GGGCAGGAGGACGAGGGCCATGG + Intergenic
1002289262 5:178188597-178188619 GGGCAGCAGGATTAGGATGTCGG + Intergenic
1002437819 5:179242926-179242948 GTGCAGCAGGGCGAGAGTGCTGG + Intronic
1002711122 5:181195535-181195557 GGACGCCAGGACGCGGGTGTTGG + Exonic
1002910707 6:1489040-1489062 GGGCAGTAGGAAGAGAGTGAAGG - Intergenic
1003051128 6:2782179-2782201 GGCCAGCAGGGTGAGGGAGTGGG + Intronic
1003631368 6:7790663-7790685 GGACAGCAGGTTGATGGTGTTGG + Intronic
1003838435 6:10095342-10095364 TGGCAGCTGGAAGAGGATGTGGG + Intronic
1005851686 6:29827861-29827883 GAGCAGCAGGAAGAGGGTTCGGG - Exonic
1005859066 6:29887768-29887790 GAGCAGCAGGAGGAGGGTTCGGG - Intergenic
1005864223 6:29926474-29926496 GAGCAGCAGGAGGAGGGTTCGGG - Intergenic
1005875290 6:30006613-30006635 GAGCAGCAGGAGGAGGGTTCGGG - Intergenic
1005905528 6:30259641-30259663 GAGCAGCAGGAGGAGGGTTCGGG - Intergenic
1006515683 6:34544399-34544421 GGGCAGCAGGAGGTGGCTGGGGG + Exonic
1007230107 6:40342356-40342378 GGGCAGCAGGAAGGGGAGGTGGG - Intergenic
1007596107 6:43052400-43052422 CGGCAGCTGGAGGAGTGTGTGGG - Exonic
1007705071 6:43785557-43785579 GGGGAGCAGGAAGAGGATGAGGG - Exonic
1007825256 6:44595235-44595257 GGTCAGCAGGACAATGGTGTAGG - Intergenic
1008530874 6:52457282-52457304 GGTCAGAAGGACAAAGGTGTGGG + Intronic
1015626325 6:135183042-135183064 TGGCAGCAGGAGGAGGGAGTCGG + Intronic
1017978025 6:159375168-159375190 GAGCAGCTCCACGAGGGTGTGGG - Intergenic
1018128454 6:160705062-160705084 GGGCCGCAGGCAGAGGGGGTGGG - Intronic
1018343395 6:162876306-162876328 GGACAGCAGGAAGAGAGTGATGG - Intronic
1018902599 6:168058930-168058952 GGGCAGGTGGACGTGGGTGGAGG - Intronic
1019536804 7:1533597-1533619 GGGCACCAGGATCAGGGTGAGGG + Intronic
1019769816 7:2876606-2876628 GGGCAGCAGGAGGATGGAGTGGG + Intergenic
1020012682 7:4815302-4815324 GGCCAGCAGGTTGAGGGTGCAGG + Exonic
1022443582 7:30452472-30452494 GGCCAGCAAGACCAGGGGGTGGG + Exonic
1022506805 7:30912636-30912658 GGGCTGCAGGAGGAGGGAGCTGG - Intronic
1022675626 7:32495986-32496008 GGGCAGAAGGAAGAGGTTGTGGG - Intronic
1023878678 7:44306713-44306735 AGTGAGCAGGAGGAGGGTGTGGG + Intronic
1023878685 7:44306733-44306755 GGGCAGGAGGAGGAGGGTGTGGG + Intronic
1024288555 7:47782304-47782326 TGGCAACAGGACAAGGATGTTGG + Intronic
1024424243 7:49207312-49207334 GGGCAGCAGGAAGAGCATGTAGG + Intergenic
1024535115 7:50423975-50423997 AGGCAGGAGGACGAGGCTGAAGG + Intergenic
1026675575 7:72425399-72425421 GGGCAGGAGGCCGAGCGTGGTGG - Intronic
1026716089 7:72790525-72790547 GGACTGGAGGAGGAGGGTGTGGG - Intronic
1026978932 7:74515485-74515507 GTGCAGCGGGGCGAGGGTGGAGG + Exonic
1029200353 7:98835257-98835279 GGGAAGGAGGAAGAGGGGGTAGG - Intergenic
1029505731 7:100963054-100963076 GAGCAGCAGGAGGAGCCTGTGGG + Intronic
1030880788 7:114876485-114876507 GGGAAGCAGGGTGAGGGAGTGGG - Intergenic
1032457062 7:132081205-132081227 AGGCAGCAGGATCAGGATGTGGG - Intergenic
1032470814 7:132177624-132177646 AGGGAGCAGAAGGAGGGTGTTGG + Intronic
1032748019 7:134807577-134807599 GGGGAGCATGAAGAGGGTGGAGG + Intronic
1032855199 7:135828221-135828243 GGGCAGCCGGATGATGGTGTGGG + Intergenic
1042696140 8:71556856-71556878 GGCCAGCAGGGCGCGGGTGGGGG - Intronic
1043052807 8:75404358-75404380 GGCCAGCAGGGTGAGGGTGGGGG - Intergenic
1043486283 8:80702095-80702117 GGGCAGCATGATGAGGGTCCTGG + Intronic
1044346429 8:91109699-91109721 GGCCAGCAGTAAGAGGTTGTGGG + Intronic
1044916037 8:97113311-97113333 CAGCAGCAGGAGAAGGGTGTGGG + Intronic
1048593301 8:135841576-135841598 GGGCAGCCGCAGGCGGGTGTAGG - Intergenic
1049346784 8:142143530-142143552 TGGCAGGAGGGTGAGGGTGTGGG - Intergenic
1049411137 8:142474509-142474531 GGGCAGCAGCACCAGGGGGCCGG - Intronic
1049433065 8:142574211-142574233 GGGCAGAAGGCAGAGGGTGGTGG - Intergenic
1049586584 8:143435265-143435287 GGGCAGCAGGAGCAGGGTGGGGG - Intergenic
1051146278 9:14030926-14030948 AGGCAGCAGGACTAGGGGGTTGG + Intergenic
1056598210 9:88025263-88025285 GGGCAGTAGGAGGAGGGGGCAGG + Intergenic
1058683260 9:107458318-107458340 TGGCAGCAGGATGTGGGTGCTGG + Intergenic
1058704580 9:107627879-107627901 AGGCTGCAAGAGGAGGGTGTGGG + Intergenic
1058718466 9:107742518-107742540 GTGCAGCAGGAAGAGGGTGCTGG - Intergenic
1059347236 9:113637310-113637332 GGGCAGAAGGAAGAGGGAGTGGG - Intergenic
1059691217 9:116687517-116687539 GGGGGGCAGGACTAGGGTGGGGG + Intronic
1060229881 9:121818712-121818734 GGCCAGCAAGACAAGGGTGGTGG + Intergenic
1060403178 9:123360265-123360287 GGGCAGCAGGTCGAAGGGGAGGG + Intronic
1060533848 9:124367130-124367152 GGGCAGCAGGGCCAGGGAGGAGG + Intronic
1060967511 9:127720205-127720227 GGGCGGCAGGAAGTGGGTGCTGG - Intronic
1061307326 9:129739662-129739684 GGGGAGCTGGGCCAGGGTGTAGG + Exonic
1061407128 9:130398596-130398618 GGGCAGCAAGGCTGGGGTGTGGG - Intronic
1061653842 9:132072570-132072592 GGGAGGGAGGAGGAGGGTGTAGG + Intronic
1061886302 9:133592636-133592658 AGGCTGCAGGACCAGGGTGGTGG - Intergenic
1061928890 9:133822083-133822105 GGGCAGGTGGGCGAGGTTGTTGG - Intronic
1062110525 9:134779786-134779808 GGGAAGCAGGAGGGGTGTGTTGG + Intronic
1062144682 9:134982511-134982533 AGGCACCAGCACGAGGGTGCTGG - Intergenic
1062701199 9:137904670-137904692 GGACAGCAGGAGGAGGGGGGAGG - Intronic
1185452543 X:290547-290569 GGGCAGCAGGACATGCGGGTGGG + Intronic
1186707598 X:12158221-12158243 GGGCTGCAAGATGAGGATGTAGG + Intronic
1187009993 X:15268969-15268991 GAGCAGCAGGGTGAGGGTGAAGG - Intronic
1187290405 X:17947990-17948012 TGGCAGCAGGATTGGGGTGTGGG + Intergenic
1190737260 X:53263852-53263874 GGGAAACAGGACGGGGGTGTGGG - Intronic
1191975087 X:66862714-66862736 AGACAGCATGACTAGGGTGTGGG + Intergenic
1196196803 X:112845299-112845321 GGGCTGGAGGAAGAGGGAGTGGG + Intergenic
1196918101 X:120560385-120560407 AGGCAGAAGGACGAGGTTGAAGG + Exonic
1200063741 X:153495181-153495203 GGACAGCAGGACCAGGGCTTGGG - Intronic
1200141247 X:153904138-153904160 GGGCAGGAGGAAGAGGGTGGGGG + Intronic
1200759878 Y:7028003-7028025 GTGCAGCAGGAAGTGGGTATGGG + Intronic
1200829106 Y:7673363-7673385 GGGCAGCGGGGCCGGGGTGTGGG - Intergenic
1202232774 Y:22672408-22672430 TGGCAGCAGGAGGTGGGAGTCGG - Intergenic
1202310382 Y:23523750-23523772 TGGCAGCAGGAGGTGGGAGTCGG + Intergenic
1202560420 Y:26146844-26146866 TGGCAGCAGGAGGTGGGAGTCGG - Intergenic