ID: 920380892

View in Genome Browser
Species Human (GRCh38)
Location 1:205534014-205534036
Sequence GACCCCAGGCTACCCCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920380892_920380900 22 Left 920380892 1:205534014-205534036 CCTCCCAGGGGTAGCCTGGGGTC 0: 1
1: 0
2: 1
3: 20
4: 198
Right 920380900 1:205534059-205534081 GTGTCTGCCCCCCAGCCCTGTGG 0: 1
1: 0
2: 5
3: 42
4: 360
920380892_920380896 0 Left 920380892 1:205534014-205534036 CCTCCCAGGGGTAGCCTGGGGTC 0: 1
1: 0
2: 1
3: 20
4: 198
Right 920380896 1:205534037-205534059 ACATACCAAATTAGAATCCCAGG 0: 1
1: 0
2: 3
3: 31
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920380892 Original CRISPR GACCCCAGGCTACCCCTGGG AGG (reversed) Intergenic
900144435 1:1151693-1151715 CACTCCACGCTCCCCCTGGGTGG - Intergenic
900173921 1:1283804-1283826 GACCCCAGGCCTCCCCTGCAGGG + Intronic
900461779 1:2805239-2805261 GACCCCAGGCTCCACTAGGGAGG - Intergenic
901927797 1:12578006-12578028 GACCCGTGGCTTCCCCTGGAGGG - Intronic
902090848 1:13902058-13902080 GGCCCCAGGCAGCCCCGGGGTGG + Intergenic
903353797 1:22734088-22734110 AAGCCCAGGCTGGCCCTGGGTGG - Intronic
905433374 1:37940657-37940679 GACCCCAGGCTCCCTGGGGGTGG - Intronic
912498381 1:110106040-110106062 GATCACAGGCTTCACCTGGGAGG - Intergenic
915244469 1:154546593-154546615 GACCCAAGACAACCTCTGGGTGG - Intronic
916058411 1:161083402-161083424 GACGCCAGGCTGACACTGGGTGG - Intronic
917599559 1:176560590-176560612 GACCTCAGTCTACTCCTAGGTGG - Intronic
920380892 1:205534014-205534036 GACCCCAGGCTACCCCTGGGAGG - Intergenic
920432522 1:205928022-205928044 GACCACAGGCGACACCGGGGTGG + Exonic
922209248 1:223474914-223474936 GACCCCAGGCTTCTGCTGGGAGG - Intergenic
922501018 1:226096978-226097000 AACCCCAGCCTACCTCTGTGTGG + Intergenic
1062898105 10:1120369-1120391 GACCCCCGGGTGCCCCTCGGAGG - Intronic
1062957873 10:1552172-1552194 GCCCCCAGGATGCCCATGGGGGG + Intronic
1063099225 10:2935015-2935037 GACCCCAGACTGGCGCTGGGTGG - Intergenic
1064249268 10:13694387-13694409 GACCCGAACCAACCCCTGGGTGG - Intronic
1067242579 10:44508966-44508988 AGCCCCAGGCTCCCTCTGGGTGG - Intergenic
1067439624 10:46301302-46301324 GACCCCAGGCTTGCCCTGAGGGG + Intronic
1068149879 10:53118431-53118453 GAAGCCAGGCTAACCTTGGGAGG + Intergenic
1070841465 10:79490739-79490761 GACCCCTGGCTAGCCCTGCCTGG - Intergenic
1071108582 10:82127715-82127737 AACCCCAGTCTGCCCCAGGGTGG + Intronic
1072685258 10:97532904-97532926 GACTCCAGGCTGCCCTTGGTAGG - Intronic
1075909939 10:126115479-126115501 GAACCCAGGCTGCCCCTCGAAGG - Intronic
1076601366 10:131658929-131658951 GAGCCCTGGCTCCCCCTGGATGG - Intergenic
1076758395 10:132587316-132587338 GACCCCCTGCCACCCCTGTGAGG - Intronic
1077025822 11:439447-439469 GACCCCACCCTACTCCTGAGAGG + Intronic
1077171555 11:1168574-1168596 GACCCCAGGCAGCCCCGGGGTGG - Intronic
1077211447 11:1372574-1372596 AATCCCAGGCTACCCCATGGGGG + Intergenic
1077431205 11:2516886-2516908 GACACCAGGCAAACTCTGGGGGG - Intronic
1083595684 11:63917405-63917427 GACCCCTGGCTACTCCTGGGGGG - Intergenic
1083609795 11:63999390-63999412 CGCCTCAGGCTACCCCTGTGAGG - Exonic
1084358967 11:68657339-68657361 GCCCCCAGCCTCCCACTGGGGGG - Intergenic
1086049788 11:82576966-82576988 GCCTCCAGGCCACTCCTGGGTGG - Intergenic
1090106012 11:123854340-123854362 GGCCCCAAGCTTCTCCTGGGTGG - Intergenic
1092230053 12:6771106-6771128 GGCTCCAGGCCACCCCTGGAGGG - Intergenic
1103613340 12:122137398-122137420 GACCCCAGGCTGCCTCCTGGTGG + Intronic
1105818408 13:24057794-24057816 GAGCCCAGCCTTCCCCTTGGAGG + Intronic
1108153448 13:47560586-47560608 GACCCCAGACAACCCATGGTGGG - Intergenic
1119003807 14:70907222-70907244 GACCCCATTCTGCCCCTGGTAGG - Intergenic
1119419505 14:74500091-74500113 GCCCACAGGCTATCACTGGGCGG + Exonic
1121510577 14:94509986-94510008 GCTCCCAGGCTGCACCTGGGAGG - Intronic
1122318701 14:100840564-100840586 GGCCCCACACAACCCCTGGGAGG - Intergenic
1123133459 14:106006905-106006927 GAGTCCAGGCTCCCCCTGGGAGG + Intergenic
1123165202 14:106319583-106319605 GCATCCAGGCTCCCCCTGGGAGG + Intergenic
1202921832 14_KI270723v1_random:34698-34720 GTCCCCAGGCTTCCGCTGGGAGG - Intergenic
1202923084 14_KI270724v1_random:2883-2905 GTCCCCAGGCTTCCGCTGGGAGG + Intergenic
1123676500 15:22714827-22714849 GGCTCCAGGGTACCCCTGGATGG + Intergenic
1124328718 15:28789087-28789109 GGCTCCAGGGTACCCCTGGATGG + Intergenic
1124372257 15:29110505-29110527 GCCCCCAGGCCACCCCATGGTGG - Intronic
1128133965 15:65249303-65249325 TTCCCCAGGCAGCCCCTGGGCGG + Intronic
1128711075 15:69872426-69872448 GACTTCAGACTACCCATGGGAGG - Intergenic
1129508871 15:76105317-76105339 GACCCCAGGCTGTGCCTTGGAGG - Intronic
1130297423 15:82657011-82657033 GGCCCCATGCTCCTCCTGGGTGG + Intergenic
1132669071 16:1095337-1095359 CACCCCAGGCCAGCCTTGGGGGG - Intronic
1134024201 16:10942092-10942114 GGCTCCAGGGTACCCCTGGATGG - Exonic
1136143410 16:28301468-28301490 AACCCCAGACTGCCCCTGGTGGG + Intronic
1136983955 16:35082993-35083015 GTCCCCAGGCCACCCCTGCATGG + Intergenic
1138117826 16:54374402-54374424 GACCACATGCTGCCCCTGGAGGG - Intergenic
1141438070 16:84012231-84012253 AACCCCAGACTACCCAGGGGCGG + Intronic
1141519917 16:84571803-84571825 GACCCCAGCCTGCTCCTGAGTGG + Intronic
1141896321 16:86960954-86960976 CACCCCAGGCCAACCCTGGTGGG + Intergenic
1141935624 16:87236171-87236193 GACCACAGGCAGCCACTGGGAGG + Intronic
1142304413 16:89277639-89277661 GACCCCAGCCGTCCCCGGGGAGG - Intronic
1142418779 16:89957678-89957700 GGCCCCAGGCTGCCCCACGGCGG - Intronic
1143381366 17:6498333-6498355 TTCCCCAGGCTAGCTCTGGGAGG - Intronic
1144825076 17:18101203-18101225 AAACCCAGGCTTCCCCTGAGGGG + Intronic
1146281485 17:31547994-31548016 AATCCCAGGCTTCCCTTGGGAGG - Intergenic
1149597960 17:57875173-57875195 CACCCCAGGCTACAGCAGGGAGG + Intronic
1149657484 17:58318041-58318063 CACCCCAGCCCACCCCTGGGAGG - Intronic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1151311213 17:73293465-73293487 GACCAGAGGCTGCCCCTGGAAGG - Intronic
1151408058 17:73902275-73902297 GAACCCAGGCCACCACCGGGCGG - Intergenic
1151897406 17:76989754-76989776 GACCCCAGGTTACCTGTGTGAGG + Intergenic
1152039258 17:77892466-77892488 GACCCCAGGGGACTCCTGGTGGG + Intergenic
1152380042 17:79937571-79937593 GGCCCCAGCCCACCCCTGCGGGG - Exonic
1152583510 17:81179266-81179288 GACCCCAGGGGACCCAGGGGAGG + Intergenic
1152825705 17:82463489-82463511 AGCCCCAGGCTCACCCTGGGTGG - Intronic
1154169211 18:12038635-12038657 GGCCCCAGGCCGCCCCCGGGCGG + Intergenic
1154386455 18:13897162-13897184 CACACCACGCTACCACTGGGGGG - Intronic
1158571205 18:58598261-58598283 GACACCAGGCTACACCTCAGTGG - Intronic
1158976876 18:62717023-62717045 GCCTCCAGTCTACCCCCGGGAGG + Exonic
1161026562 19:2039896-2039918 GACCCCAGGGGTCCCCTGAGGGG - Intronic
1161036508 19:2087969-2087991 GGCCCCTGGCTCCCACTGGGCGG - Intronic
1161222396 19:3123632-3123654 GTCCCCCGGCTCCCCCAGGGAGG + Exonic
1161457502 19:4376889-4376911 GACCCCGGGCAACCTCTTGGGGG + Intronic
1161488356 19:4547995-4548017 CACCCCAGGCCAGCCGTGGGCGG - Intronic
1161911660 19:7198562-7198584 GACCCCAGGCCTCCCTCGGGAGG + Intronic
1162591666 19:11596329-11596351 GAGCCCAGGCTAGGCCAGGGAGG - Intronic
1163698942 19:18777589-18777611 GATCCCAGCCCAGCCCTGGGCGG - Exonic
1164778606 19:30873919-30873941 GACCCCTAGCTACCCCTGCCTGG - Intergenic
1165008896 19:32828865-32828887 GAGCCCTGGCCTCCCCTGGGAGG + Intronic
1165308856 19:35018818-35018840 GACCCTGGGCCACCCCTGAGTGG + Intronic
1166107354 19:40603932-40603954 GGCCCCAGGCCACCTCTGGGCGG - Intronic
1166561618 19:43736419-43736441 GGCCCCAGGAGACCGCTGGGAGG - Intronic
1167139967 19:47643569-47643591 GACACCAGCCTCCCACTGGGTGG + Intronic
1168315920 19:55484785-55484807 GACCCCGGGCGCCCCGTGGGTGG + Intergenic
925416421 2:3673029-3673051 TCCCCCAGGCTACCCATGGCTGG - Intronic
926629403 2:15123090-15123112 GCTCCCAGGCTACCTCGGGGTGG - Intergenic
926749360 2:16186204-16186226 GACCCCTGGCTGCCTCTGGTGGG + Intergenic
928127189 2:28625119-28625141 GCCCCCAGGCCACCCCTGAAAGG + Intronic
928305830 2:30169705-30169727 GTCCCAAGCCTACACCTGGGAGG + Intergenic
929511617 2:42569172-42569194 CACCCCAGGCTCCCACTGAGTGG - Intronic
929866346 2:45720391-45720413 CTCCCCAAGCTACCCCTGGGAGG - Intronic
931762753 2:65431908-65431930 GCCCCCACGCTGCCCCTGAGGGG + Intronic
934078898 2:88451597-88451619 AACAGAAGGCTACCCCTGGGTGG - Intronic
935736627 2:106111568-106111590 AAACCCAGGCTACCACTGTGTGG + Intronic
936126000 2:109789688-109789710 GAACTCAGGTTTCCCCTGGGGGG - Intergenic
936218693 2:110581780-110581802 GAACTCAGGTTTCCCCTGGGGGG + Intergenic
937237652 2:120440554-120440576 GACCCCAGGCGTAACCTGGGCGG + Intergenic
937907103 2:127057786-127057808 GACCCCAGGCCACCCCCGAGAGG + Intronic
937976177 2:127583349-127583371 CACCCCCGGCTGGCCCTGGGAGG - Intronic
946707515 2:222473069-222473091 TAGGCCAGGCTACCCATGGGAGG - Intronic
947714026 2:232330941-232330963 GACCCCAGGCAGCACCTAGGAGG + Intronic
947733234 2:232442321-232442343 GACCCCAGGCAGCACCTAGGAGG + Intergenic
947876028 2:233468867-233468889 GTCCCCATGCTGCTCCTGGGCGG + Intronic
948040271 2:234896120-234896142 GACCACATGTTAACCCTGGGGGG - Intergenic
948516036 2:238504560-238504582 ATCCCCAGGCCACCCCGGGGTGG - Intergenic
948597921 2:239092361-239092383 GCCCCGAGGCTGCCCCTGTGGGG + Intronic
948811026 2:240478516-240478538 AGCCACAGGCTGCCCCTGGGAGG - Intergenic
949061969 2:241966114-241966136 GACCACAGGCATTCCCTGGGAGG - Intergenic
1172747307 20:37221844-37221866 GACCCAAGTCTGCCCATGGGTGG - Intronic
1174200719 20:48804723-48804745 GACCCGGGGCTACCCATGGGAGG + Intronic
1174357802 20:50010037-50010059 GTCGCCAGGCTAACCCTGCGTGG + Intergenic
1174420386 20:50395587-50395609 GGCCCCAGGCTGGCCCAGGGTGG + Intergenic
1175673599 20:60928327-60928349 GACTCCAGGGTCCCCTTGGGTGG + Intergenic
1175976572 20:62713312-62713334 GGCCCCTGTCTGCCCCTGGGAGG - Intronic
1176069548 20:63218906-63218928 GTCCCCAGGCCAGCTCTGGGGGG + Intergenic
1179723594 21:43329746-43329768 AACCCCAGACGACCCCTGTGAGG + Intergenic
1180209445 21:46286021-46286043 GACCCCTGGCGAGCCCGGGGCGG - Intronic
1181050586 22:20236598-20236620 GACCCTAGGCCAGCTCTGGGGGG + Intergenic
1183256072 22:36763147-36763169 GACCCCCGGCTTTCCCTGTGGGG - Intronic
1183316086 22:37137586-37137608 GTCCCCAGGCCACACCTGGGAGG - Exonic
1183739265 22:39661152-39661174 GACCCCAGTCTCCCACTGGGTGG + Exonic
1184656691 22:45945570-45945592 GACCCCAAGCCACCTCTGGCAGG - Intronic
1184677584 22:46052233-46052255 GACCCCAGAGGACCCCTAGGAGG + Intronic
1184788500 22:46684219-46684241 GTCCCCCCGCTCCCCCTGGGAGG - Intergenic
1185036102 22:48477688-48477710 GACCTCAGGCCAGCCCTGGGAGG + Intergenic
950568504 3:13785972-13785994 GACACCAGGCTTCCCTGGGGCGG + Intergenic
952968562 3:38636621-38636643 GCCCCCAGGCTGCTCCTGGTGGG + Intronic
953651162 3:44806156-44806178 TACCCCACCCTACCACTGGGGGG - Intronic
954371389 3:50171157-50171179 GCCCCCAGTCTGCCCCTGGGTGG - Intronic
954373839 3:50184097-50184119 GACTCCAGGTTACCTCTGGAGGG - Intronic
954461180 3:50627866-50627888 GTGCCCCTGCTACCCCTGGGAGG + Intronic
954871470 3:53770628-53770650 GGACCCAGGCTCCCCCTGTGTGG + Intronic
955754627 3:62215156-62215178 GCCCTCAGGATACCCCTGAGTGG - Intronic
961539721 3:127591153-127591175 GACCCCAGGTCACCCCTGCAGGG - Intronic
964480038 3:157130788-157130810 GACCCCATGCTACCCCCTTGTGG + Intergenic
965300054 3:166997532-166997554 GATCCCTGGCTTCCCCTGGGAGG + Intergenic
966917106 3:184591070-184591092 GACCCCAGAATGGCCCTGGGAGG + Intronic
967648192 3:191952451-191952473 GACCCGTGGCTTCCCGTGGGTGG - Intergenic
968915482 4:3495420-3495442 GACTCCAGGCCACCGCTGTGGGG - Intronic
969564499 4:7970165-7970187 CACCCCAGCCTACCCCTGCCAGG - Intronic
971153440 4:24058135-24058157 GCCCCCAGGCCACCCCTCTGGGG - Intergenic
979387555 4:120087161-120087183 AATCCCAGGCTGCGCCTGGGAGG + Intergenic
986313680 5:6572332-6572354 CACCCCAGGCTTCTCCTGTGCGG - Intergenic
986705990 5:10455381-10455403 GGCCTCAGGCTCCCACTGGGGGG - Intronic
988930334 5:36030741-36030763 AACCACAAGCCACCCCTGGGAGG - Intergenic
989188472 5:38646924-38646946 GGCCCCAGGCTGCCCCAGGCAGG + Intergenic
995066747 5:107870984-107871006 GACCCCAGGCTACCGGTATGAGG - Intronic
998364305 5:141618886-141618908 GGCCCCAGGCTCCCGCCGGGCGG + Exonic
1002167897 5:177359424-177359446 AACCCCAGGCCCACCCTGGGAGG + Intronic
1002518370 5:179775644-179775666 GACCCCAGGCTACATATGGAAGG + Exonic
1004302894 6:14474716-14474738 GTCCTCAGGCAACTCCTGGGTGG - Intergenic
1004307682 6:14515781-14515803 GCTCCAAGGCAACCCCTGGGAGG + Intergenic
1006063434 6:31442598-31442620 GACCCCAGGCTTCCCGGGGCTGG - Intergenic
1007383898 6:41507678-41507700 AACCACAGGCTATCCCTGGTAGG + Intergenic
1013374760 6:109503823-109503845 GACCGCAGGCCACCCCGGGAGGG - Intronic
1016143518 6:140643081-140643103 GGCCCCAGTCTACCAATGGGAGG - Intergenic
1017012234 6:150070499-150070521 GAGCCCAGGTTAGTCCTGGGAGG + Intergenic
1017737715 6:157380254-157380276 GACCCGCGGCAACGCCTGGGAGG + Intergenic
1018059526 6:160079407-160079429 GGCCCTAGGCTTTCCCTGGGGGG - Intronic
1018279681 6:162172258-162172280 GACCCCAAGCTACCCAGGGATGG + Intronic
1019558656 7:1645168-1645190 CACCCCAGGACACCCCTGGGTGG + Intergenic
1024097024 7:45990320-45990342 GTCCCCAGGGCACTCCTGGGAGG + Intergenic
1026374562 7:69737600-69737622 GTCCCCAGTCTGCTCCTGGGAGG + Intronic
1026534577 7:71229303-71229325 GGACCCAGGATTCCCCTGGGAGG + Intronic
1029423471 7:100483568-100483590 GGCCCCAGGCTGCCGCTGGGGGG + Intergenic
1031084890 7:117292560-117292582 GACCCCAGGTTATTCCTGGATGG - Intronic
1032513725 7:132491960-132491982 CACCCCAGGCTGCCCTTGGAAGG - Intronic
1032849434 7:135781736-135781758 GACCCCAGGCATCCTCAGGGAGG + Intergenic
1034265076 7:149776857-149776879 GTCCCCAGGCCTCCCCAGGGTGG + Intergenic
1034649123 7:152675831-152675853 GACTCCAGGCTGCCCAGGGGCGG + Intronic
1034746663 7:153529328-153529350 GATCTCAGGCTTCCCCTTGGCGG + Intergenic
1037718368 8:21419143-21419165 GACCCCAGGGTACCCCAGGCGGG + Intergenic
1037754743 8:21703457-21703479 CACCACAGGCTCTCCCTGGGTGG + Intronic
1038151130 8:24942802-24942824 GACCCCAGGATGCCCCCCGGGGG - Intergenic
1039351947 8:36772808-36772830 GTCCCCAGGCTCACCTTGGGTGG + Intergenic
1040315528 8:46258905-46258927 GCCCCCAGGCTTTCCCTGGTGGG + Intergenic
1040595291 8:48832299-48832321 GACCCCAGGAGGACCCTGGGAGG - Intergenic
1049225501 8:141448779-141448801 GCTCCCCTGCTACCCCTGGGTGG + Intergenic
1049256304 8:141615739-141615761 GACCCTAGGGCACCCCTGAGTGG + Intergenic
1049804511 8:144532826-144532848 CACTCCAGGCTACCCATGGCTGG + Intronic
1050599446 9:7235484-7235506 GACCCGAGGCTACTGCTGCGAGG - Intergenic
1053066265 9:35071825-35071847 GACCCCGGGCTCCGCCTCGGTGG + Intronic
1055847732 9:80587635-80587657 GACCACAGCCTAACACTGGGAGG + Intergenic
1056751161 9:89352309-89352331 GAGCCAAGGGTATCCCTGGGTGG - Intronic
1056975583 9:91250150-91250172 GACTCCAGGCTCGCCCTGGCAGG - Intronic
1057303857 9:93901479-93901501 GACCCCAGCATGCTCCTGGGTGG - Intergenic
1057851259 9:98568490-98568512 GGCCCCAGCCTTCCCCTGAGTGG - Intronic
1059403858 9:114087900-114087922 GAGGCCAGGGTCCCCCTGGGTGG + Intronic
1059425709 9:114219783-114219805 GACTCCAGGAAACCCCTGGAGGG - Exonic
1059755451 9:117289237-117289259 GACCCAAGGCTACCACCGTGTGG - Intronic
1060794493 9:126504796-126504818 GACCCGAGGATGCCCCTGGTGGG + Exonic
1060819322 9:126652249-126652271 GCCCCCAGGCAGCCCCTGTGTGG + Intronic
1061211097 9:129193929-129193951 AACCCCCAGCTGCCCCTGGGAGG - Intergenic
1062265213 9:135683760-135683782 CACCCCAGGCCAGCCCTGAGGGG + Intergenic
1062274599 9:135724835-135724857 GAGCCCAGGCTCTGCCTGGGCGG - Intronic
1203773883 EBV:62276-62298 GACCAACCGCTACCCCTGGGCGG - Intergenic
1203738766 Un_GL000216v2:161210-161232 GGCCCCGGGCTTCCACTGGGAGG - Intergenic
1186352150 X:8750932-8750954 GACCCCAGGAGGCCCCTGGGTGG + Intergenic
1190031525 X:46977824-46977846 GACTGCAGGCTGCCTCTGGGAGG + Intronic
1190456425 X:50632459-50632481 TCCCCCAGGCTACTTCTGGGAGG - Intronic
1190643557 X:52503815-52503837 AAACCCAGGCTACCCCTGTTGGG - Intergenic
1192225093 X:69222298-69222320 GAGCCCAGGCAGCCACTGGGTGG - Intergenic
1197156113 X:123272203-123272225 GGCCCCAGGCTCCCCATAGGAGG - Intronic
1198482314 X:137052423-137052445 GCCCGCGGGCCACCCCTGGGCGG - Intergenic
1201867799 Y:18673363-18673385 GTTACCCGGCTACCCCTGGGAGG + Intergenic