ID: 920382670

View in Genome Browser
Species Human (GRCh38)
Location 1:205544601-205544623
Sequence TTGAATTAGGATGAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920382670_920382678 -2 Left 920382670 1:205544601-205544623 CCCTCTTCCTCATCCTAATTCAA No data
Right 920382678 1:205544622-205544644 AACAAATCAGAGTTGGGGGCAGG No data
920382670_920382674 -9 Left 920382670 1:205544601-205544623 CCCTCTTCCTCATCCTAATTCAA No data
Right 920382674 1:205544615-205544637 CTAATTCAACAAATCAGAGTTGG No data
920382670_920382676 -7 Left 920382670 1:205544601-205544623 CCCTCTTCCTCATCCTAATTCAA No data
Right 920382676 1:205544617-205544639 AATTCAACAAATCAGAGTTGGGG No data
920382670_920382677 -6 Left 920382670 1:205544601-205544623 CCCTCTTCCTCATCCTAATTCAA No data
Right 920382677 1:205544618-205544640 ATTCAACAAATCAGAGTTGGGGG No data
920382670_920382675 -8 Left 920382670 1:205544601-205544623 CCCTCTTCCTCATCCTAATTCAA No data
Right 920382675 1:205544616-205544638 TAATTCAACAAATCAGAGTTGGG No data
920382670_920382679 24 Left 920382670 1:205544601-205544623 CCCTCTTCCTCATCCTAATTCAA No data
Right 920382679 1:205544648-205544670 CTGCATTTTTGACAAATAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920382670 Original CRISPR TTGAATTAGGATGAGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr