ID: 920384180

View in Genome Browser
Species Human (GRCh38)
Location 1:205556421-205556443
Sequence CAGCTGTTCTTGAGTAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920384180_920384190 27 Left 920384180 1:205556421-205556443 CCATGCTTACTCAAGAACAGCTG No data
Right 920384190 1:205556471-205556493 AATGGGGGACCAAAGTGCACTGG No data
920384180_920384191 30 Left 920384180 1:205556421-205556443 CCATGCTTACTCAAGAACAGCTG No data
Right 920384191 1:205556474-205556496 GGGGGACCAAAGTGCACTGGTGG No data
920384180_920384189 12 Left 920384180 1:205556421-205556443 CCATGCTTACTCAAGAACAGCTG No data
Right 920384189 1:205556456-205556478 CTTGCTACATGACTGAATGGGGG No data
920384180_920384186 10 Left 920384180 1:205556421-205556443 CCATGCTTACTCAAGAACAGCTG No data
Right 920384186 1:205556454-205556476 CCCTTGCTACATGACTGAATGGG No data
920384180_920384188 11 Left 920384180 1:205556421-205556443 CCATGCTTACTCAAGAACAGCTG No data
Right 920384188 1:205556455-205556477 CCTTGCTACATGACTGAATGGGG No data
920384180_920384184 9 Left 920384180 1:205556421-205556443 CCATGCTTACTCAAGAACAGCTG No data
Right 920384184 1:205556453-205556475 CCCCTTGCTACATGACTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920384180 Original CRISPR CAGCTGTTCTTGAGTAAGCA TGG (reversed) Intergenic
No off target data available for this crispr