ID: 920385554

View in Genome Browser
Species Human (GRCh38)
Location 1:205568643-205568665
Sequence CTGTATCTCCGGATAAGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 39}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920385554_920385564 16 Left 920385554 1:205568643-205568665 CCTAGCCTTATCCGGAGATACAG 0: 1
1: 0
2: 0
3: 2
4: 39
Right 920385564 1:205568682-205568704 CATCTGCCGGGCTCTAAAATGGG 0: 1
1: 0
2: 0
3: 1
4: 70
920385554_920385563 15 Left 920385554 1:205568643-205568665 CCTAGCCTTATCCGGAGATACAG 0: 1
1: 0
2: 0
3: 2
4: 39
Right 920385563 1:205568681-205568703 CCATCTGCCGGGCTCTAAAATGG 0: 1
1: 0
2: 0
3: 7
4: 73
920385554_920385566 23 Left 920385554 1:205568643-205568665 CCTAGCCTTATCCGGAGATACAG 0: 1
1: 0
2: 0
3: 2
4: 39
Right 920385566 1:205568689-205568711 CGGGCTCTAAAATGGGCGCTCGG 0: 1
1: 0
2: 0
3: 1
4: 49
920385554_920385560 3 Left 920385554 1:205568643-205568665 CCTAGCCTTATCCGGAGATACAG 0: 1
1: 0
2: 0
3: 2
4: 39
Right 920385560 1:205568669-205568691 GTCTCGGGCTCTCCATCTGCCGG 0: 1
1: 0
2: 0
3: 21
4: 544
920385554_920385567 30 Left 920385554 1:205568643-205568665 CCTAGCCTTATCCGGAGATACAG 0: 1
1: 0
2: 0
3: 2
4: 39
Right 920385567 1:205568696-205568718 TAAAATGGGCGCTCGGTCCCTGG 0: 1
1: 0
2: 0
3: 1
4: 31
920385554_920385561 4 Left 920385554 1:205568643-205568665 CCTAGCCTTATCCGGAGATACAG 0: 1
1: 0
2: 0
3: 2
4: 39
Right 920385561 1:205568670-205568692 TCTCGGGCTCTCCATCTGCCGGG 0: 1
1: 0
2: 2
3: 23
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920385554 Original CRISPR CTGTATCTCCGGATAAGGCT AGG (reversed) Intergenic
902243916 1:15106815-15106837 CTGCATCTCCCGATAAACCTTGG + Intronic
905114204 1:35623275-35623297 CTTTATGTCCTGTTAAGGCTGGG + Intronic
911256017 1:95634519-95634541 CTGTATCTCCGTATCAGGTGTGG - Intergenic
920385554 1:205568643-205568665 CTGTATCTCCGGATAAGGCTAGG - Intergenic
924279461 1:242421539-242421561 CCGTATCTCCTGGTCAGGCTTGG - Intronic
1066387597 10:34954344-34954366 CTGTTTCTCCGGCTCTGGCTTGG - Intergenic
1096285736 12:50298483-50298505 CTGTTTCACAGGATAAGGGTGGG - Intergenic
1101489007 12:105194837-105194859 CTGTATGTTCAGATAAGGCGTGG + Intronic
1110230851 13:73165788-73165810 CTGTATCTAAAAATAAGGCTAGG - Intergenic
1115489295 14:33943673-33943695 GTGTACTTCCGGATAAAGCTTGG - Intronic
1118041875 14:61925996-61926018 CTGTATGTCTGGATTATGCTTGG + Intergenic
1121023844 14:90599947-90599969 CTGTTTCTCAAGATAGGGCTTGG + Intronic
1122810478 14:104285258-104285280 CTGCCTCTCCGGCTAAGGCTGGG - Intergenic
1124855188 15:33380783-33380805 CTGGGTCTCCGTGTAAGGCTTGG - Intronic
1129271982 15:74423806-74423828 CTGTCTCTCCTGATATGGCCAGG + Intronic
1131682093 15:94734355-94734377 CTGTATCTTTGGATCAGCCTGGG - Intergenic
1133046346 16:3090396-3090418 CTGCAACTCCGGATTGGGCTCGG + Exonic
1135463135 16:22662350-22662372 CTGTACCTCTGGAAAAGGCAAGG - Intergenic
1141841726 16:86578030-86578052 CGATATCTCCGGTTAAGCCTGGG + Intronic
1142590280 17:1001836-1001858 CTGCATCCCAGGAAAAGGCTGGG - Exonic
1147062254 17:37889934-37889956 CTGAATCTCCAGATGAGGTTAGG + Intergenic
1155620706 18:27775624-27775646 CTGTATCTCCATATAAGACATGG - Intergenic
927336459 2:21930395-21930417 CATTATCTCAGGATATGGCTGGG + Intergenic
935159399 2:100516236-100516258 CTGTTTCTCCGGTTGAAGCTGGG + Intergenic
940043674 2:149387013-149387035 CTGTGTCTCCTGGAAAGGCTGGG + Intronic
1173380819 20:42539183-42539205 CTGTATCTCCAGACTAGGCGTGG + Intronic
977707281 4:100086102-100086124 CTTCATCTCCAGATAAGACTTGG - Intergenic
980983186 4:139671312-139671334 GTGTATCTCTGGAGAAAGCTAGG + Intronic
982916655 4:161219046-161219068 GTGTATCCCTGGATAAGCCTGGG - Intergenic
999070175 5:148736242-148736264 CTGTGTCTCCTGCTAAGGGTGGG - Intergenic
999080253 5:148836863-148836885 CAGTACCTGCTGATAAGGCTTGG + Intergenic
1008539861 6:52537258-52537280 CTGTATATTCGGATAGGGCTTGG - Intronic
1008957415 6:57230917-57230939 CTGTATCTCCTGGTAAAGCCAGG + Intergenic
1024233693 7:47382028-47382050 CTGTATGTCTAGATATGGCTAGG + Intronic
1041761717 8:61374537-61374559 CTGTATCTCTGAAAAAGACTTGG + Intronic
1046536727 8:115523752-115523774 ATGAGTCTCCGGCTAAGGCTTGG + Intronic
1051046272 9:12878255-12878277 CTGTATCTACAGTGAAGGCTGGG + Intergenic
1055472868 9:76631105-76631127 CTGTCCCTCCTGATAAGTCTTGG + Intronic
1189005646 X:36991647-36991669 CTGTATCTCATGAGAATGCTGGG - Intergenic
1192432421 X:71121426-71121448 CTGCTTCTCCGAGTAAGGCTTGG + Exonic
1193654194 X:84178851-84178873 CTGTAACTTTGGATTAGGCTAGG + Intronic
1196329250 X:114450417-114450439 CTTTCCCTCTGGATAAGGCTGGG - Intergenic