ID: 920386114

View in Genome Browser
Species Human (GRCh38)
Location 1:205570993-205571015
Sequence AGCACTGCTTACCCAACAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 118}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920386109_920386114 1 Left 920386109 1:205570969-205570991 CCTGGGTAGTTTTGTATCTTCCT 0: 1
1: 0
2: 0
3: 16
4: 318
Right 920386114 1:205570993-205571015 AGCACTGCTTACCCAACAGGGGG 0: 1
1: 0
2: 2
3: 6
4: 118
920386104_920386114 20 Left 920386104 1:205570950-205570972 CCCAGCTGGGCCATCTCTTCCTG 0: 1
1: 0
2: 5
3: 26
4: 327
Right 920386114 1:205570993-205571015 AGCACTGCTTACCCAACAGGGGG 0: 1
1: 0
2: 2
3: 6
4: 118
920386103_920386114 23 Left 920386103 1:205570947-205570969 CCACCCAGCTGGGCCATCTCTTC 0: 1
1: 0
2: 6
3: 31
4: 327
Right 920386114 1:205570993-205571015 AGCACTGCTTACCCAACAGGGGG 0: 1
1: 0
2: 2
3: 6
4: 118
920386108_920386114 10 Left 920386108 1:205570960-205570982 CCATCTCTTCCTGGGTAGTTTTG 0: 1
1: 0
2: 1
3: 29
4: 311
Right 920386114 1:205570993-205571015 AGCACTGCTTACCCAACAGGGGG 0: 1
1: 0
2: 2
3: 6
4: 118
920386102_920386114 24 Left 920386102 1:205570946-205570968 CCCACCCAGCTGGGCCATCTCTT 0: 1
1: 0
2: 2
3: 18
4: 206
Right 920386114 1:205570993-205571015 AGCACTGCTTACCCAACAGGGGG 0: 1
1: 0
2: 2
3: 6
4: 118
920386105_920386114 19 Left 920386105 1:205570951-205570973 CCAGCTGGGCCATCTCTTCCTGG 0: 1
1: 0
2: 3
3: 32
4: 335
Right 920386114 1:205570993-205571015 AGCACTGCTTACCCAACAGGGGG 0: 1
1: 0
2: 2
3: 6
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920386114 Original CRISPR AGCACTGCTTACCCAACAGG GGG Intronic
903794668 1:25919702-25919724 AGCATAGATTACCCAACAGTTGG + Intergenic
904788025 1:32997134-32997156 TGCACTGCTTGCCCAGCATGGGG + Intergenic
905150075 1:35920362-35920384 GGCACTGGTTACCCACCAGCGGG - Exonic
906544555 1:46612073-46612095 GGCACTGCTTACCCACCCGAGGG - Intronic
911256670 1:95641075-95641097 AGCACTGCCAACCCATGAGGAGG + Intergenic
912468909 1:109893099-109893121 AGCTCTTCTTACCCAACTGGGGG - Intergenic
918069435 1:181124190-181124212 AGCACAGCTTTCAGAACAGGAGG + Intergenic
919929744 1:202213601-202213623 AGCCCTGCTTCTCCACCAGGAGG + Intronic
920386114 1:205570993-205571015 AGCACTGCTTACCCAACAGGGGG + Intronic
920743188 1:208600631-208600653 AGCACTGGTCACCCTGCAGGGGG - Intergenic
922101561 1:222481579-222481601 ACCTCTGCTTACCAAACAGCTGG + Intergenic
924344481 1:243061696-243061718 ACCTCTGCTTACCAAACAGCTGG + Intergenic
924496451 1:244594996-244595018 AGCACTGCTTTCCCTACCAGAGG + Intronic
1062822912 10:548251-548273 AGCTCTCCTTACCCACCTGGGGG - Intronic
1066731851 10:38443376-38443398 ACCTCTGCTTACCAAACAGCTGG - Intergenic
1069500902 10:68952050-68952072 AGCACAGAGTACCAAACAGGAGG - Intergenic
1070526004 10:77296546-77296568 AGCCATGCTTACCCAAGTGGAGG + Intronic
1073144060 10:101267783-101267805 AGAACTACTTACCCAAGTGGGGG + Intergenic
1075013218 10:118892381-118892403 GCCACTGCTGATCCAACAGGAGG + Intergenic
1078642688 11:13111142-13111164 ATCACTGCTTACCCATCAGGAGG + Intergenic
1079478618 11:20858019-20858041 TGCACAGCTTACCCAATAGCAGG + Intronic
1081874072 11:46397019-46397041 GGCTCTGCCCACCCAACAGGTGG + Exonic
1083019092 11:59488013-59488035 ATCAATGCTTACCCAATAGATGG + Intergenic
1091323317 11:134666659-134666681 AGCTTTCCTTACCCCACAGGAGG - Intergenic
1091816358 12:3441673-3441695 AGCACTGCTGACGCAGCAGATGG + Intronic
1099032134 12:77539687-77539709 AGGACTGCTTAACCAATAGTGGG + Intergenic
1099078379 12:78141806-78141828 GGCAGTGCTGGCCCAACAGGAGG - Intronic
1100192561 12:92208491-92208513 AGCAATGCTTAGTCAACAGCAGG + Intergenic
1102495023 12:113313650-113313672 AGAATTGCTTACCCTAGAGGTGG + Intronic
1105500868 13:20970657-20970679 TGCACTGCTGATCTAACAGGAGG + Intergenic
1105986368 13:25571197-25571219 TGCACAGCTTCCCCAGCAGGCGG - Intronic
1106639016 13:31563415-31563437 GTCACTGCTGATCCAACAGGAGG - Intergenic
1113148685 13:107238232-107238254 ATCACTGCTCACCCAGCATGGGG + Intronic
1114953122 14:27782008-27782030 ACCACCTCTTACCCAGCAGGAGG + Intergenic
1122833710 14:104420741-104420763 GCCACTGCTCACCTAACAGGAGG - Intergenic
1127771457 15:62234441-62234463 AGCCCTGAGTACCCAAGAGGTGG - Intergenic
1128544024 15:68555457-68555479 ACCACTGCTTACCCACCCCGAGG + Intergenic
1128819101 15:70636081-70636103 AGCCCTGGTAACTCAACAGGTGG + Intergenic
1132310353 15:100852996-100853018 AGCCCTGGTTCCCCAACAGATGG + Intergenic
1132349432 15:101129989-101130011 ACCACTGCTTACCCATTATGAGG + Intergenic
1134025958 16:10954099-10954121 ATCACTGCATACCCAGCAGATGG + Intronic
1140234369 16:73145189-73145211 ACCCCTGCTCCCCCAACAGGAGG - Intergenic
1140298623 16:73734127-73734149 AGCACTGCTGATCTGACAGGAGG + Intergenic
1142072514 16:88099019-88099041 ATGCCTGCTTACCCAACATGTGG + Intronic
1143561148 17:7695956-7695978 ACCACTGCTTCCCCAACACGTGG - Intronic
1144713597 17:17419417-17419439 GCCACTGCTGACCCAACAGGAGG - Intergenic
1146496956 17:33331067-33331089 ACCACTGCTGATCTAACAGGAGG - Intronic
1146823273 17:36001493-36001515 AGCCCTGCCTGCCCACCAGGAGG - Exonic
1146825358 17:36017898-36017920 AGCCCTGCCTGCCCACCAGGAGG - Exonic
1150134159 17:62686497-62686519 TGCCCTGCTGATCCAACAGGAGG + Intronic
1158733675 18:60055130-60055152 AGAGCTGCATACCCACCAGGTGG + Intergenic
1166210750 19:41305290-41305312 ACCACTGGGTACTCAACAGGTGG - Intronic
925974607 2:9133046-9133068 GCCACTGCTGACCCGACAGGAGG + Intergenic
926219206 2:10924026-10924048 AGCACTGCTTCCAAAACAGCCGG + Intergenic
929111133 2:38406109-38406131 GCCACTGCTGACCTAACAGGAGG + Intergenic
929265094 2:39909634-39909656 AGCACTGCAGCCCTAACAGGTGG - Intergenic
931499957 2:62855070-62855092 AGCACAGCTTGCCCAAACGGCGG + Intronic
932195739 2:69781660-69781682 AGCATTGTTTACTCAACAGAGGG + Intronic
934925357 2:98378372-98378394 AACAGTGCCTACCCCACAGGTGG + Intronic
935121846 2:100189966-100189988 AGCAGTGCTGTCCCAACAGGTGG + Intergenic
935212243 2:100947942-100947964 AGCACTTCTCAAGCAACAGGAGG + Intronic
937292074 2:120787748-120787770 AGCACCGCTGACCCAGCAGAGGG - Intronic
938641388 2:133284319-133284341 GGAACTCTTTACCCAACAGGAGG + Intronic
939158388 2:138554446-138554468 AGCACTGCTTGCAGAAGAGGAGG + Intronic
943811115 2:192190620-192190642 AGCACTACTTACCCACCAGGAGG + Intronic
945084904 2:206121417-206121439 AGCACTACTTATCCCAGAGGAGG + Intronic
1175906601 20:62382937-62382959 GGCACTGCTTACCTGTCAGGAGG - Intergenic
1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG + Intronic
1176230008 20:64027768-64027790 GGCACAGCTTCCCCATCAGGTGG + Intronic
1178340089 21:31778817-31778839 AGCACCGAGTACCCAGCAGGTGG + Intergenic
1181416987 22:22767363-22767385 AGCTCTGCATTCCCAAAAGGAGG + Intronic
949312356 3:2714132-2714154 AACACTGCCTGGCCAACAGGGGG - Intronic
951455461 3:22887138-22887160 AACACTGCTTACCCCATATGTGG - Intergenic
954753778 3:52828064-52828086 AGCACTGCCTACCCAGGGGGAGG - Intronic
959028838 3:101273646-101273668 TGTACTGCTTCCCCAAAAGGTGG + Exonic
960015276 3:112880527-112880549 AGCACTGCTTATTTAATAGGGGG + Intergenic
965732390 3:171785962-171785984 AACAGTGCTTACCACACAGGAGG + Intronic
966784614 3:183611739-183611761 AACACTTCTTACCCAATAGTTGG + Intergenic
969784261 4:9441597-9441619 TTCACTTCTTACCCCACAGGTGG - Intergenic
970906503 4:21222843-21222865 AATATTGCCTACCCAACAGGAGG + Intronic
973729390 4:53809044-53809066 GCCACTGCTGATCCAACAGGAGG - Intronic
977512972 4:97984738-97984760 AGCGCAGCATCCCCAACAGGGGG - Intronic
978797441 4:112722450-112722472 TTCACTGTTTACCTAACAGGAGG + Intergenic
979258238 4:118626003-118626025 ACCTCTGCTTACCAAACAGCTGG - Intergenic
979330111 4:119414565-119414587 ACCTCTGCTTACCAAACAGCTGG + Intergenic
984578195 4:181475951-181475973 AGAGCTGATTACCCAGCAGGCGG + Intergenic
986467922 5:8045494-8045516 TGCCCAGCTTATCCAACAGGTGG - Intergenic
988112083 5:26834862-26834884 GCCACAGCTGACCCAACAGGAGG - Intergenic
990805810 5:59660307-59660329 AGCTCTGCTTACTAAACATGGGG - Intronic
991462805 5:66877248-66877270 AGCAGTACTTACCTTACAGGTGG - Intronic
992113263 5:73515822-73515844 AATACTGTTTACCCAAAAGGGGG - Intergenic
996951780 5:129135592-129135614 AGCATTGCTCACACAACAAGAGG - Intergenic
997033418 5:130158456-130158478 AGTACTTCTTAGCCAACAAGTGG + Intronic
997667271 5:135641670-135641692 TCCCTTGCTTACCCAACAGGAGG + Intergenic
998813433 5:145988809-145988831 CCCAGTGCTCACCCAACAGGAGG - Intronic
999707167 5:154283905-154283927 AGCAGCGCTTACCCATCAGCTGG - Intronic
1000281589 5:159787065-159787087 TGCAATCCTTACTCAACAGGAGG - Intergenic
1002372119 5:178763178-178763200 TGAACTTCTTGCCCAACAGGAGG - Intergenic
1003159603 6:3623923-3623945 AGGACTGCTTCCCCAACAGCAGG - Intergenic
1003622192 6:7710455-7710477 AGCACTGATTACCCAAGTCGTGG + Intergenic
1010212100 6:73370038-73370060 AGCATTGGAGACCCAACAGGAGG - Intronic
1014943594 6:127471848-127471870 AGGAGTGGTTACCCAACAGTTGG - Intronic
1020203309 7:6096857-6096879 AGCAGTGCTTACGCAGCAGAAGG - Intergenic
1023266889 7:38415988-38416010 ACAGCTGCTTACCCAACATGAGG + Intronic
1023400223 7:39787297-39787319 ACCTCTGCTTACCAAACAGCTGG - Intergenic
1024073151 7:45803048-45803070 ACCTCTGCTTACCAAACAGCTGG - Intergenic
1025132377 7:56382942-56382964 ACCTCTGCTTACCAAACAGCTGG + Intergenic
1027354005 7:77339097-77339119 TGCCATACTTACCCAACAGGAGG - Intronic
1032050538 7:128646742-128646764 ACCTCTGCTTACCAAACAGCTGG - Intergenic
1033774079 7:144587469-144587491 TGCACTGCTAACCCCACAGGTGG + Intronic
1033808875 7:144986365-144986387 GCCACTGCTGATCCAACAGGAGG + Intergenic
1036500077 8:9305702-9305724 AGCACTCCTTACCCCAAAGATGG + Intergenic
1037917917 8:22783947-22783969 AGCACTTCCTGCCCACCAGGAGG + Intronic
1044554136 8:93543754-93543776 AGCACAGCTCACACAAGAGGTGG - Intergenic
1048308113 8:133297441-133297463 ACGACTGCTTGCGCAACAGGCGG - Exonic
1052901737 9:33799308-33799330 GGCTCTGCTTACCCTTCAGGGGG - Intergenic
1053056481 9:34996022-34996044 AGGCTTGCTTACCCAATAGGTGG - Intronic
1058290163 9:103231035-103231057 AGTACTTCATACCCACCAGGTGG + Intergenic
1060213835 9:121726502-121726524 AGCACTGGTAAACCAACACGGGG + Intronic
1062186246 9:135220158-135220180 TTCACCGCTTACCCAAAAGGTGG + Intergenic
1062477481 9:136735975-136735997 AGCAATTCTGACCCACCAGGTGG + Intergenic
1203776801 EBV:77770-77792 ACCTCCGCTCACCCAACAGGTGG - Intergenic
1192317152 X:70062010-70062032 CGCACTGCTTCCTCAACAGTAGG + Intergenic
1199200162 X:145077909-145077931 AGCACTGCTATTTCAACAGGAGG - Intergenic
1199667690 X:150113800-150113822 ATCACTGCTTCCCTGACAGGAGG + Intergenic
1200069568 X:153521271-153521293 AGCACCGCCCACCCAACAGAAGG - Intronic
1201126558 Y:10920422-10920444 TGCACTGATCACCCAAGAGGTGG + Intergenic