ID: 920389024

View in Genome Browser
Species Human (GRCh38)
Location 1:205587326-205587348
Sequence GTTGAATTTCTAGCAGAGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13376
Summary {0: 1, 1: 1, 2: 2, 3: 280, 4: 13092}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920389021_920389024 0 Left 920389021 1:205587303-205587325 CCAGGTAAGAAAGCATTTCCTTG 0: 1
1: 0
2: 2
3: 28
4: 251
Right 920389024 1:205587326-205587348 GTTGAATTTCTAGCAGAGAGCGG 0: 1
1: 1
2: 2
3: 280
4: 13092
920389018_920389024 19 Left 920389018 1:205587284-205587306 CCCAATGAGGGTACTAAGTCCAG 0: 1
1: 0
2: 0
3: 0
4: 73
Right 920389024 1:205587326-205587348 GTTGAATTTCTAGCAGAGAGCGG 0: 1
1: 1
2: 2
3: 280
4: 13092
920389017_920389024 27 Left 920389017 1:205587276-205587298 CCAAGTAGCCCAATGAGGGTACT 0: 1
1: 0
2: 0
3: 6
4: 44
Right 920389024 1:205587326-205587348 GTTGAATTTCTAGCAGAGAGCGG 0: 1
1: 1
2: 2
3: 280
4: 13092
920389019_920389024 18 Left 920389019 1:205587285-205587307 CCAATGAGGGTACTAAGTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 57
Right 920389024 1:205587326-205587348 GTTGAATTTCTAGCAGAGAGCGG 0: 1
1: 1
2: 2
3: 280
4: 13092

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920389024 Original CRISPR GTTGAATTTCTAGCAGAGAG CGG Intronic
Too many off-targets to display for this crispr