ID: 920390202

View in Genome Browser
Species Human (GRCh38)
Location 1:205595309-205595331
Sequence CACGTGGTGAACCCTCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 325}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920390196_920390202 17 Left 920390196 1:205595269-205595291 CCTGATGGCACAAAAACTGTTCT 0: 1
1: 0
2: 0
3: 8
4: 131
Right 920390202 1:205595309-205595331 CACGTGGTGAACCCTCTGCCTGG 0: 1
1: 0
2: 4
3: 26
4: 325
920390195_920390202 18 Left 920390195 1:205595268-205595290 CCCTGATGGCACAAAAACTGTTC 0: 1
1: 0
2: 1
3: 11
4: 135
Right 920390202 1:205595309-205595331 CACGTGGTGAACCCTCTGCCTGG 0: 1
1: 0
2: 4
3: 26
4: 325
920390199_920390202 -9 Left 920390199 1:205595295-205595317 CCTCCCTACTTTGGCACGTGGTG 0: 1
1: 0
2: 0
3: 10
4: 77
Right 920390202 1:205595309-205595331 CACGTGGTGAACCCTCTGCCTGG 0: 1
1: 0
2: 4
3: 26
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920390202 Original CRISPR CACGTGGTGAACCCTCTGCC TGG Intronic
900544704 1:3222190-3222212 CACGTGGGCAGCCCTCTGGCTGG - Intronic
901369784 1:8787206-8787228 CACCTGATGTTCCCTCTGCCTGG + Intronic
901787465 1:11634255-11634277 CACGAGCTGAGCCCTCTGCCTGG - Intergenic
902205615 1:14866139-14866161 CACCTGCTGTTCCCTCTGCCTGG + Intronic
902303574 1:15520553-15520575 CAAGAGGTGAGCCCTCTGTCAGG + Intronic
902402109 1:16163708-16163730 CACGTACTGTCCCCTCTGCCTGG + Intergenic
903376493 1:22869693-22869715 CACATGCTGTTCCCTCTGCCTGG + Intronic
903682303 1:25105092-25105114 CACATGCTGTTCCCTCTGCCTGG + Intergenic
903772536 1:25772901-25772923 CACTTGCTGTCCCCTCTGCCTGG + Intronic
903789436 1:25882424-25882446 CACTTGGTGTTCCTTCTGCCTGG + Intergenic
903833717 1:26189680-26189702 CCCGAGCTGACCCCTCTGCCTGG + Exonic
904381568 1:30114749-30114771 GACGTCGTGATCCATCTGCCTGG - Intergenic
904917757 1:33982698-33982720 CACCTGCTGCTCCCTCTGCCAGG - Intronic
905295659 1:36952909-36952931 CACGTGCTGTTCCCTCTACCTGG - Intronic
905445962 1:38028673-38028695 CACCTCAAGAACCCTCTGCCAGG - Intergenic
905451744 1:38061460-38061482 CACTTGCTGTTCCCTCTGCCAGG - Intergenic
905546849 1:38807063-38807085 CACATGCTGTTCCCTCTGCCTGG - Intergenic
905905476 1:41615379-41615401 CACCTGGAGAACCCTCAGCCTGG + Intronic
906791402 1:48661335-48661357 CACCTGCTGCTCCCTCTGCCTGG - Intronic
907114441 1:51956626-51956648 CTCATGCTGCACCCTCTGCCTGG + Intronic
907384055 1:54114359-54114381 CACCTGATGTTCCCTCTGCCAGG + Intergenic
907885661 1:58590447-58590469 CACGTGTTGTTCCCTCTGCCTGG - Intergenic
909351540 1:74659200-74659222 CATGTGGTAATCCCTCTTCCTGG - Intronic
910367597 1:86483265-86483287 CAGGTGTGGAAGCCTCTGCCTGG + Intronic
916952060 1:169790554-169790576 CACTTGCTGGACCCTCTCCCTGG + Intronic
917508708 1:175651309-175651331 AACATGCTGAACCCTCTGCCTGG - Intronic
919516574 1:198532751-198532773 CACTTGCTGTTCCCTCTGCCTGG - Intronic
920390202 1:205595309-205595331 CACGTGGTGAACCCTCTGCCTGG + Intronic
920975350 1:210780691-210780713 CTCATGCTGATCCCTCTGCCTGG - Intronic
921887659 1:220322654-220322676 CACGTGCTGTTCCCTCTTCCTGG + Intergenic
922540978 1:226419350-226419372 CACGTGCAGAGCGCTCTGCCTGG + Intergenic
922699027 1:227747423-227747445 GACAGTGTGAACCCTCTGCCTGG + Intronic
1062952492 10:1515378-1515400 CAGGTGGGAAACCCTCTGCCTGG + Intronic
1066353434 10:34658887-34658909 CACGTGGTGAACTCTGTGAATGG - Intronic
1066791466 10:39069152-39069174 CACGTGGTAAACCCTCTTTTTGG + Intergenic
1067794816 10:49313295-49313317 CTCATGGTGTTCCCTCTGCCTGG - Intronic
1070345750 10:75540263-75540285 CACTTGCTGTTCCCTCTGCCAGG - Intronic
1070829560 10:79410102-79410124 CACTTGCTGTTCCCTCTGCCAGG + Intronic
1070853364 10:79585316-79585338 CACCTGCTGTTCCCTCTGCCTGG + Intergenic
1074009669 10:109465162-109465184 CACATGCTGTGCCCTCTGCCTGG - Intergenic
1074699833 10:116083249-116083271 CAGGGGGTGAACCCCCTTCCCGG + Intronic
1075067415 10:119298806-119298828 CACATGCTGTTCCCTCTGCCAGG + Intronic
1078447373 11:11414467-11414489 CATGTGCTGTTCCCTCTGCCTGG + Intronic
1079122732 11:17696845-17696867 CACCTGCTGTTCCCTCTGCCTGG + Intergenic
1081634809 11:44714062-44714084 CACCTGCTGCTCCCTCTGCCTGG - Intergenic
1081796039 11:45820636-45820658 CACCTGCTGATCCCTCTTCCTGG - Intergenic
1081867357 11:46367063-46367085 CAAGTGGGGAACCCTCAGCCAGG - Intronic
1083546656 11:63553847-63553869 CAGGTGCTGATCCCACTGCCAGG + Intronic
1083876872 11:65528908-65528930 CACGTGCTGTCGCCTCTGCCTGG - Intronic
1083935059 11:65865722-65865744 CCCATGCTGACCCCTCTGCCTGG + Intronic
1084317102 11:68351912-68351934 CACTGGCTGATCCCTCTGCCTGG - Intronic
1084642193 11:70432649-70432671 CACGTGGTGAAGCCGCTGTCAGG + Intronic
1085083819 11:73653696-73653718 CACATGCTGATCCCTCTGCCTGG - Intronic
1089133754 11:116233012-116233034 CACATGCTGTTCCCTCTGCCTGG + Intergenic
1089753742 11:120670555-120670577 CACCTGCTGTGCCCTCTGCCTGG + Intronic
1089976393 11:122735737-122735759 CACATGCTGGGCCCTCTGCCTGG - Intronic
1091652721 12:2321781-2321803 CACGAGCTGTTCCCTCTGCCTGG - Intronic
1091989092 12:4940168-4940190 CACTTGCTGTGCCCTCTGCCTGG - Intergenic
1093456075 12:19366284-19366306 AATGTGTTGATCCCTCTGCCAGG - Intronic
1093820688 12:23614207-23614229 CACGTGATGTTCCTTCTGCCTGG - Intronic
1093929106 12:24937289-24937311 CACTTGCTGATGCCTCTGCCTGG - Intronic
1095170300 12:39026963-39026985 CACCTTTTGATCCCTCTGCCTGG - Intergenic
1095593715 12:43935900-43935922 CTCATGCTGAACCCTCTGCCTGG - Intronic
1099143372 12:79008227-79008249 CACATGCTGAATCCTCTGCTTGG - Intronic
1099257628 12:80333839-80333861 CACTTGCTGGTCCCTCTGCCTGG - Intronic
1099593688 12:84629040-84629062 CACGTGCTGTCCCCTCTGCTTGG - Intergenic
1099603462 12:84770970-84770992 CATGTGTTGCTCCCTCTGCCTGG - Intergenic
1100895048 12:99172113-99172135 CACATGCTGTTCCCTCTGCCTGG - Intronic
1101049024 12:100841645-100841667 CACTTGCTGTTCCCTCTGCCTGG - Intronic
1101360372 12:104020763-104020785 CACTTGCTGTTCCCTCTGCCTGG - Intronic
1101421404 12:104554313-104554335 CACATGCTGTTCCCTCTGCCTGG - Intronic
1102010812 12:109617290-109617312 CATGGGGTGAAGTCTCTGCCTGG - Intergenic
1102198522 12:111041707-111041729 CACTGGGTGTTCCCTCTGCCTGG - Intronic
1102248610 12:111370495-111370517 CACTTGCTGTTCCCTCTGCCTGG - Intergenic
1102705759 12:114879046-114879068 CATGTGCTGTTCCCTCTGCCGGG + Intergenic
1103004976 12:117413882-117413904 CACATGCTGTTCCCTCTGCCTGG + Intronic
1103405962 12:120675456-120675478 CACATGCTGTTCCCTCTGCCTGG + Intergenic
1103484427 12:121273505-121273527 CAAGTGCTGAACCCAGTGCCTGG + Intronic
1103570767 12:121843350-121843372 CCCTTGCTGATCCCTCTGCCAGG + Intronic
1104051329 12:125195799-125195821 CACCTGCTGTTCCCTCTGCCTGG - Intronic
1104051636 12:125198556-125198578 CATGTGCTGACCCCTCAGCCAGG + Intronic
1104241174 12:126991156-126991178 CACATGCTGTTCCCTCTGCCTGG + Intergenic
1104657180 12:130581994-130582016 CACCTGCTGCTCCCTCTGCCTGG + Intronic
1104971865 12:132534445-132534467 CACCTGTCGCACCCTCTGCCAGG + Intronic
1104988020 12:132608260-132608282 CACGTGGGGAGGCCACTGCCGGG - Intronic
1106406664 13:29480569-29480591 CACTTGCTGTGCCCTCTGCCTGG + Intronic
1107324494 13:39226579-39226601 CACGTGCTCCTCCCTCTGCCTGG + Intergenic
1107493435 13:40901313-40901335 GAGGTGAGGAACCCTCTGCCTGG + Intergenic
1109510547 13:63367222-63367244 CAGCTGGTGAAGCCCCTGCCTGG + Intergenic
1111898168 13:94167657-94167679 CACGTGCTGTTCCTTCTGCCTGG - Intronic
1112005401 13:95249401-95249423 CCCATGGGGAACCCACTGCCTGG + Intronic
1112439518 13:99415861-99415883 CACGCGGTGAACCCTGAGGCTGG - Intergenic
1118264524 14:64282062-64282084 GACGTGATGAACACTGTGCCTGG - Intronic
1118355292 14:65008652-65008674 CACATGCTGTTCCCTCTGCCTGG - Intronic
1120707118 14:87756559-87756581 CACATGGTGTCCCTTCTGCCTGG - Intergenic
1120801141 14:88690065-88690087 CACTTGCTGCTCCCTCTGCCTGG - Intronic
1121089043 14:91168574-91168596 CACGTGCTGCTTCCTCTGCCTGG + Intronic
1121111233 14:91314530-91314552 CACATGCTGATCCCTCTGCCTGG + Intronic
1121199121 14:92102831-92102853 CAGGTTTTGAAACCTCTGCCTGG - Intronic
1121665331 14:95667584-95667606 CACGTGGTGAGGCCCCTGCTGGG + Intergenic
1122243705 14:100385921-100385943 CATGTACAGAACCCTCTGCCAGG + Intronic
1122256916 14:100485124-100485146 CACCTGCTGCTCCCTCTGCCTGG + Intronic
1122269608 14:100562677-100562699 CACCTGCTGCTCCCTCTGCCTGG + Intronic
1123976055 15:25555706-25555728 CTCATGGTGCACCCTCTGCCCGG - Intergenic
1125644401 15:41259912-41259934 AACGTGGTGAAACCTTAGCCAGG - Intronic
1126137103 15:45402871-45402893 CACGTGGTGGTCGCTCCGCCAGG + Exonic
1126547046 15:49885236-49885258 CACTGGCTGTACCCTCTGCCTGG + Intronic
1128318232 15:66674799-66674821 CATATGTTGACCCCTCTGCCTGG + Intronic
1128369865 15:67032784-67032806 CACTTGCTGTTCCCTCTGCCTGG + Intergenic
1128909777 15:71503194-71503216 CACGTGCTGTTCCCGCTGCCTGG - Intronic
1129599554 15:76990451-76990473 CACATGATCACCCCTCTGCCTGG - Intergenic
1129816704 15:78561729-78561751 CACATGCTGTTCCCTCTGCCTGG - Intergenic
1129991177 15:79964889-79964911 CACTTGCTGCTCCCTCTGCCTGG - Intronic
1130681266 15:85998926-85998948 CACGTGCTCATTCCTCTGCCAGG - Intergenic
1131442693 15:92470903-92470925 CACTTGTTGCGCCCTCTGCCTGG + Intergenic
1132501520 16:286558-286580 CCCGTGGTGCACCCACTGCAAGG + Exonic
1133357419 16:5146915-5146937 CACATGCTGTTCCCTCTGCCTGG + Intergenic
1136252149 16:29012394-29012416 CACTTGCTGTTCCCTCTGCCTGG + Intergenic
1136406619 16:30051875-30051897 CAGTTGCTGATCCCTCTGCCTGG - Intronic
1137974433 16:53019265-53019287 CATGTGCTGACCCCTCAGCCTGG + Intergenic
1138275419 16:55730657-55730679 TATGTGGTGTTCCCTCTGCCTGG + Intergenic
1138280666 16:55770285-55770307 CATGTGCTGTTCCCTCTGCCTGG + Intergenic
1138287820 16:55823338-55823360 CATGTGCTGTTCCCTCTGCCTGG - Intronic
1138455431 16:57117982-57118004 CACTTGCTGTTCCCTCTGCCTGG + Intronic
1138557996 16:57784123-57784145 CACCTGGTGGAGGCTCTGCCTGG - Intronic
1138575732 16:57906314-57906336 CACGTGGTGGACTCTCAGCAAGG + Intronic
1139328370 16:66169048-66169070 CACATGCTAAGCCCTCTGCCAGG + Intergenic
1139424312 16:66869713-66869735 CACATGGGGTACCCTGTGCCAGG + Intronic
1139701088 16:68708439-68708461 CACTTGCTGTGCCCTCTGCCTGG + Intronic
1139878500 16:70165303-70165325 CATGTGGAGAACCCAGTGCCGGG + Intergenic
1140359064 16:74329512-74329534 CATGTGGAGAACCCAGTGCCGGG - Intergenic
1140374012 16:74430189-74430211 CATGTGGAGAACCCAGTGCCGGG - Intergenic
1140412949 16:74752490-74752512 CACCTGCTGTTCCCTCTGCCTGG + Intronic
1140832554 16:78765206-78765228 CTCGTGCTGGATCCTCTGCCAGG - Intronic
1141376435 16:83535169-83535191 CACATGCTGTGCCCTCTGCCTGG - Intronic
1142476677 17:193144-193166 CACGTGCTGTTCCCCCTGCCTGG - Intergenic
1142743810 17:1945086-1945108 CACGTGCTGTTCCCTCTGCCTGG + Intronic
1142744673 17:1949921-1949943 CACCTGCTGTGCCCTCTGCCTGG - Intronic
1144213041 17:13031391-13031413 CACGTGGTAAGCCCTATGCTAGG + Intergenic
1144713708 17:17420121-17420143 CACATGCTCATCCCTCTGCCTGG - Intergenic
1144763624 17:17721434-17721456 CACTTGTTGATCCATCTGCCTGG - Intronic
1145165763 17:20612575-20612597 CAGGTGGCGAACCCACGGCCAGG + Intergenic
1145974953 17:28978546-28978568 CACATGCTGGTCCCTCTGCCTGG - Intronic
1146642498 17:34551763-34551785 CACGTGCCATACCCTCTGCCTGG + Intergenic
1146924666 17:36736066-36736088 CATGGGCTGACCCCTCTGCCAGG - Intergenic
1148086518 17:44996893-44996915 CACGGGCTGTTCCCTCTGCCTGG - Intergenic
1150722819 17:67628085-67628107 CACATGGTGAAACCCCAGCCGGG - Intronic
1151246431 17:72798567-72798589 AACGTGGTGAAACCCCTGCATGG - Intronic
1153243831 18:3054431-3054453 CACTTGCTGTGCCCTCTGCCTGG + Intergenic
1156345008 18:36249204-36249226 CACTTGCTGTTCCCTCTGCCTGG + Intronic
1157858448 18:51121417-51121439 CACTTGGTGCCTCCTCTGCCTGG - Intergenic
1158618540 18:59010074-59010096 CACAAGGTCAACCCTCTGCCAGG - Intergenic
1159941225 18:74410584-74410606 CACGTGGGGAACAAACTGCCTGG - Intergenic
1160059486 18:75516290-75516312 CACTTGCTGTTCCCTCTGCCGGG - Intergenic
1161207581 19:3049404-3049426 CACATGCTGTTCCCTCTGCCTGG - Intergenic
1161273081 19:3401047-3401069 CACGGGCTGTGCCCTCTGCCTGG - Intronic
1161482746 19:4518957-4518979 CACGGGCTGTGCCCTCTGCCTGG + Intergenic
1161590381 19:5126749-5126771 CCCGTGCTGAACCCGCAGCCGGG - Intronic
1161605233 19:5211140-5211162 CACATGTGGCACCCTCTGCCAGG + Intronic
1161623225 19:5310146-5310168 CACGGGCTGTGCCCTCTGCCTGG + Intronic
1162292597 19:9791311-9791333 CAAGAGGTGAGCCCTCTGTCAGG - Intronic
1162360706 19:10218521-10218543 CACCTGCTGTTCCCTCTGCCTGG - Intronic
1162450226 19:10749908-10749930 CAGGGGGTGTTCCCTCTGCCAGG - Intronic
1162477437 19:10908968-10908990 GAGGTCGTGCACCCTCTGCCTGG - Intronic
1162856506 19:13472592-13472614 CACATGCTGTTCCCTCTGCCTGG + Intronic
1163479187 19:17544579-17544601 CACATGCTGTGCCCTCTGCCTGG - Intronic
1163573987 19:18099728-18099750 CACGTGCTGTGGCCTCTGCCCGG - Intronic
1163578566 19:18124564-18124586 CACATGCTGTTCCCTCTGCCTGG - Intronic
1163588458 19:18176830-18176852 CACAGGCTGATCCCTCTGCCAGG - Intronic
1164446568 19:28322726-28322748 CACATGGTCAGCACTCTGCCAGG - Intergenic
1164716384 19:30393649-30393671 CACTTGCTGTTCCCTCTGCCTGG - Intronic
1164871168 19:31644774-31644796 CACGTGGTGAACCCGCTACGAGG + Intergenic
1165344797 19:35238219-35238241 CACATGGTCATCCCTCTGCCTGG - Intergenic
1165900970 19:39169206-39169228 CACGGGCTGGCCCCTCTGCCAGG - Intronic
1165995779 19:39842944-39842966 CACGTGCTGTTCCCACTGCCTGG + Intronic
1166006916 19:39914400-39914422 CACTTGCTGTTCCCTCTGCCTGG + Intronic
1166083801 19:40461861-40461883 CACGTGCTGTGCCCTCTGCCTGG + Intronic
1166657468 19:44622819-44622841 TACTTGGTGTTCCCTCTGCCTGG + Intronic
1166719719 19:44990092-44990114 CACGTGGTGAGCCCTGTCCATGG + Intronic
926917816 2:17909723-17909745 CAGTGGCTGAACCCTCTGCCTGG - Intronic
929451043 2:42037542-42037564 CACTTGATGCTCCCTCTGCCTGG - Intergenic
930850847 2:55958617-55958639 GAAGAGGTGAGCCCTCTGCCTGG - Intergenic
931789537 2:65652336-65652358 CATGTGCTGTATCCTCTGCCTGG + Intergenic
933699440 2:85244084-85244106 CACCTGCTGTTCCCTCTGCCTGG - Intronic
933767545 2:85720369-85720391 CATGTGTTGTTCCCTCTGCCTGG - Intergenic
933996652 2:87675015-87675037 CATGTGGTCAAGCCTGTGCCAGG - Intergenic
935790943 2:106589587-106589609 CACTTGCTTTACCCTCTGCCTGG - Intergenic
936297199 2:111275895-111275917 CATGTGGTCAAGCCTGTGCCAGG + Intergenic
936512486 2:113159387-113159409 CACTTGCTGTTCCCTCTGCCTGG - Intronic
937236039 2:120432453-120432475 CACCTGCTGTTCCCTCTGCCTGG + Intergenic
937299767 2:120832112-120832134 CAGATGGTGCACCCTGTGCCAGG - Intronic
937337938 2:121073101-121073123 CACATGCTGTTCCCTCTGCCAGG + Intergenic
940720865 2:157280333-157280355 CTCTGGGTGAAACCTCTGCCTGG - Intronic
943797363 2:192013316-192013338 CACTTGCTGTTCCCTCTGCCTGG + Intronic
945495271 2:210500884-210500906 CTCATGGAGAACCCTCTGCTAGG - Intronic
945939050 2:215930126-215930148 CACTTGCTGTTCCCTCTGCCTGG + Intergenic
947329115 2:229009679-229009701 CACATGTTGTCCCCTCTGCCTGG - Intronic
947698915 2:232216437-232216459 CACTTGGTGTCCCCTGTGCCTGG + Intronic
1168845403 20:941122-941144 CACTTGCTGTTCCCTCTGCCAGG - Intergenic
1169206697 20:3744829-3744851 CACATGCTGTTCCCTCTGCCTGG + Intronic
1169788146 20:9382589-9382611 CACTTGATGATCCTTCTGCCTGG + Intronic
1169965808 20:11215985-11216007 CACCTGCTGTAGCCTCTGCCTGG + Intergenic
1171129285 20:22634136-22634158 CACATGCTGTTCCCTCTGCCTGG - Intergenic
1172038681 20:32028728-32028750 CACCTGCTGGTCCCTCTGCCTGG - Intronic
1172187443 20:33039949-33039971 CACATGCTGGAACCTCTGCCTGG - Intronic
1172192099 20:33068388-33068410 CACTTGCTGCTCCCTCTGCCTGG - Intronic
1172281547 20:33711367-33711389 CACGTGCTGAGCCCTCTGCCTGG - Intronic
1172529441 20:35619627-35619649 CAGGTGGTGATCCAACTGCCGGG + Exonic
1172621596 20:36321241-36321263 CACGTGCTGTTCCCTCTGCCAGG - Intronic
1172845762 20:37929222-37929244 CACCTGCTGATTCCTCTGCCTGG - Intronic
1172847982 20:37941374-37941396 CGCGTGCTGGGCCCTCTGCCTGG - Intronic
1172883332 20:38215656-38215678 CACGTGCTGTTCCCTCAGCCTGG - Intronic
1173185947 20:40840407-40840429 CACGTGCTGTTCCCTCTGCCAGG - Intergenic
1173288640 20:41694944-41694966 CACTTGCTGATCCCTCTGCCTGG - Intergenic
1173298409 20:41779562-41779584 CACGTGCTGTTCCCTTTGCCTGG + Intergenic
1173905678 20:46626857-46626879 CACCTGCTGTTCCCTCTGCCTGG + Intronic
1174273953 20:49390011-49390033 CACTTGCTGTTCCCTCTGCCTGG - Intronic
1174503022 20:50999523-50999545 CACTTGCTGTACCCTCTGCCTGG - Intergenic
1174592754 20:51659070-51659092 CACTTGCTGTGCCCTCTGCCTGG + Intronic
1175116916 20:56689313-56689335 CACGTGCTATTCCCTCTGCCAGG - Intergenic
1175283582 20:57821439-57821461 CACCTGCTGTCCCCTCTGCCTGG + Intergenic
1175498052 20:59428821-59428843 CCCCTGTTGTACCCTCTGCCTGG - Intergenic
1178676929 21:34638970-34638992 CAAGATGTGAAGCCTCTGCCTGG - Intergenic
1179923545 21:44520494-44520516 CACGTGCTCAGCCCTCTGGCAGG - Intronic
1181148632 22:20866707-20866729 CACAAGCTGCACCCTCTGCCTGG + Intronic
1181763181 22:25072087-25072109 CACATGCTGTTCCCTCTGCCTGG - Intronic
1181807332 22:25383111-25383133 CACTGGCTGATCCCTCTGCCTGG + Intronic
1182089977 22:27587833-27587855 CATGTGCTGTTCCCTCTGCCAGG + Intergenic
1182091365 22:27597129-27597151 CACATGCTGTTCCCTCTGCCTGG + Intergenic
1182103122 22:27671290-27671312 CACATGCTGTTCCCTCTGCCGGG + Intergenic
1182127307 22:27825397-27825419 CACATGCTGTTCCCTCTGCCTGG + Intergenic
1182425086 22:30267440-30267462 CCCATCGTGCACCCTCTGCCAGG + Intergenic
1183023034 22:35042741-35042763 CACTTGCTGTTCCCTCTGCCAGG - Intergenic
1183080401 22:35452237-35452259 CACCTGTGGAACCCCCTGCCTGG + Intergenic
1183327405 22:37201939-37201961 CACGTGCAGATACCTCTGCCTGG + Intergenic
1183352576 22:37342431-37342453 CACAGGATGATCCCTCTGCCTGG - Intergenic
1184196420 22:42932223-42932245 CACATGCTGTTCCCTCTGCCAGG + Intronic
1184424639 22:44402362-44402384 CACATGCTGTTCCCTCTGCCAGG - Intergenic
1184763179 22:46557168-46557190 CACGTGCTGTTCCCTCTGCCTGG - Intergenic
1185345438 22:50308573-50308595 GAGGTGGTGAACCGTCTGCAGGG + Intergenic
950073194 3:10168827-10168849 CAGGTGCTGTTCCCTCTGCCTGG + Intronic
950666319 3:14497471-14497493 CACGTGCTGTTTCCTCTGCCAGG - Intronic
950905113 3:16530872-16530894 CACATGCTGGTCCCTCTGCCAGG - Intergenic
955905615 3:63804493-63804515 CACATGCTGCTCCCTCTGCCTGG + Intergenic
956221248 3:66906188-66906210 CACATGCTGTTCCCTCTGCCTGG + Intergenic
956718253 3:72097185-72097207 CACTTGCTGTTCCCTCTGCCTGG - Intergenic
957061989 3:75489744-75489766 CACATGCTGTTCCCTCTGCCTGG + Intergenic
959437469 3:106334388-106334410 CAAGTGGTTAGCACTCTGCCAGG + Intergenic
959462533 3:106644197-106644219 CACCTGGTGGATCCTGTGCCAGG - Intergenic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
961291414 3:125849657-125849679 CACATGCTGTTCCCTCTGCCTGG - Intergenic
961372253 3:126438768-126438790 CACGCGGTGAGCACTCTCCCAGG + Intronic
961648737 3:128407022-128407044 CACGTGTTGTTCCCTCTGCCTGG - Intronic
961744752 3:129057388-129057410 CACTTGCTGTTCCCTCTGCCTGG - Intergenic
962626884 3:137234527-137234549 CACGTTGAGAACCTTCTGCAAGG + Intergenic
962878725 3:139556028-139556050 CAGGTGCTGTTCCCTCTGCCTGG - Intergenic
962902525 3:139773835-139773857 CACATGTTGTTCCCTCTGCCTGG - Intergenic
963071743 3:141310500-141310522 AAAGTTGTGAACCCTCTTCCTGG - Intergenic
965666067 3:171094655-171094677 CACATGCTGTTCCCTCTGCCTGG + Intronic
966647191 3:182259748-182259770 CACGTGGAGGGCCCTCGGCCAGG + Intergenic
969005883 4:4019835-4019857 CACATGCTGTTCCCTCTGCCTGG + Intergenic
969293146 4:6253237-6253259 CACTTGCTGTTCCCTCTGCCTGG - Intergenic
969342426 4:6550479-6550501 CACGTGCTGTTTCCTCTGCCGGG + Intronic
969345239 4:6565737-6565759 CACGTGCTGACCCTCCTGCCTGG - Intergenic
969807066 4:9617455-9617477 CACATGCTGTTCCCTCTGCCTGG - Intergenic
972381765 4:38526165-38526187 CACTTGATGTACCTTCTGCCAGG - Intergenic
973777182 4:54254448-54254470 GACATGGTGGACCCACTGCCAGG - Intronic
975579771 4:75895954-75895976 GACGTGCTCTACCCTCTGCCTGG + Intronic
979449613 4:120854860-120854882 CACTTGCTGTACCCTCTGCTTGG - Intronic
983566493 4:169158330-169158352 CTGGTGCTGACCCCTCTGCCTGG - Intronic
983942651 4:173552092-173552114 CATGTGGGAAACCCTCTGCTCGG + Intergenic
984597653 4:181689139-181689161 CACATGCAGAACCCCCTGCCTGG + Intergenic
985779469 5:1862622-1862644 CACGTGGTAAAGGCTCTTCCAGG + Intergenic
987360916 5:17105709-17105731 CACTTGCTGTTCCCTCTGCCTGG - Intronic
989989140 5:50740367-50740389 CATGTTGTGTTCCCTCTGCCTGG - Intronic
991533909 5:67645538-67645560 CACTTGCTGCTCCCTCTGCCTGG - Intergenic
995247119 5:109946840-109946862 CACATGCTAAAGCCTCTGCCTGG + Intergenic
995397514 5:111702957-111702979 CTCCTGGTAGACCCTCTGCCTGG - Intronic
996395057 5:123005303-123005325 CACTTGCTGTTCCCTCTGCCAGG + Intronic
996704903 5:126487631-126487653 CATGTGGTGAATACTCTGTCAGG - Intronic
997675210 5:135707575-135707597 CACCTGCTGTTCCCTCTGCCTGG + Intergenic
998082827 5:139291180-139291202 CACATTCTGATCCCTCTGCCTGG + Intronic
998396095 5:141819121-141819143 CACTTGCTGTGCCCTCTGCCTGG + Intergenic
998458532 5:142292431-142292453 CACATGCTGCTCCCTCTGCCTGG - Intergenic
1001197002 5:169682351-169682373 CACCTGCTGTGCCCTCTGCCTGG - Intronic
1001634448 5:173199645-173199667 CATGTGCTGCTCCCTCTGCCGGG - Intergenic
1001883873 5:175270895-175270917 CACATGCTGTACCCTCTGCCTGG - Intergenic
1002028428 5:176411414-176411436 CAGGTGCTGTTCCCTCTGCCTGG + Intronic
1002403406 5:179007715-179007737 CACTTGCTGTCCCCTCTGCCTGG - Intergenic
1002440634 5:179262612-179262634 CATGTGCTGTTCCCTCTGCCTGG + Intronic
1003474063 6:6465223-6465245 ACCCTGGTGAACCCACTGCCTGG + Intergenic
1004187726 6:13435301-13435323 CACATGCTGTACCCTCTGCCGGG + Intronic
1004963289 6:20817578-20817600 CAGGTTGTGAACAGTCTGCCAGG - Intronic
1005356784 6:24991939-24991961 CACGTGGTGAACTCTCTCTGTGG - Intronic
1006444220 6:34069830-34069852 CACATGCTGCTCCCTCTGCCAGG + Intronic
1006471324 6:34230772-34230794 CACTTGCTGTGCCCTCTGCCTGG - Intergenic
1006535370 6:34695645-34695667 CCCCAGATGAACCCTCTGCCAGG + Intronic
1006585413 6:35107427-35107449 CACGTGGGGCACCACCTGCCAGG + Intergenic
1006793768 6:36719755-36719777 CACCTGCTGTTCCCTCTGCCTGG - Intronic
1007305498 6:40900845-40900867 CTCGTGCTGTGCCCTCTGCCAGG - Intergenic
1007416072 6:41691958-41691980 CACTTGCTGTTCCCTCTGCCTGG + Intronic
1007452119 6:41948018-41948040 CACGTGCTGTTCCATCTGCCTGG + Intronic
1009250464 6:61292162-61292184 AAAGTGGTGAGCCTTCTGCCTGG - Intergenic
1011211408 6:84959883-84959905 CACATGGTGAAGGCTCTGCGTGG + Intergenic
1012496967 6:99844285-99844307 CACTTGCTGAACCCTCTGCCAGG - Intergenic
1012985121 6:105867402-105867424 CATGTGCTGGCCCCTCTGCCGGG - Intergenic
1013071306 6:106731819-106731841 CACGTGCTGCTCCCTCTGCCTGG + Intergenic
1014677362 6:124383568-124383590 CACGTGCTGTTCCCTCAGCCTGG + Intronic
1015012999 6:128374951-128374973 CACTTGCTGATCCCTATGCCTGG + Intronic
1017057884 6:150454253-150454275 CACCTGGTGGCCCTTCTGCCTGG + Intergenic
1017489329 6:154930869-154930891 CACATTGTGAACGCTCTGTCTGG + Intronic
1018765337 6:166928503-166928525 CACGTGTTGAACACAATGCCTGG + Intronic
1019569671 7:1705014-1705036 CACTTGCTGTGCCCTCTGCCTGG - Intronic
1022341169 7:29469565-29469587 CATGTGCTGTACCCTCTGCCTGG + Intronic
1023348582 7:39296613-39296635 CTGGTGGTGTTCCCTCTGCCTGG + Intronic
1023815539 7:43946843-43946865 CAGGCCGTGGACCCTCTGCCAGG - Intronic
1023909643 7:44544262-44544284 CACCTGGGGCAGCCTCTGCCAGG - Intergenic
1024474680 7:49798184-49798206 CACGTGGGGAACCATCAGCTTGG + Intronic
1026447623 7:70499349-70499371 CATGTGCTGTTCCCTCTGCCTGG - Intronic
1026737872 7:72960391-72960413 CATGGGGTGAACTCCCTGCCCGG - Intronic
1026788907 7:73319192-73319214 CATGGGGTGAACTCCCTGCCCGG - Intronic
1027105862 7:75404677-75404699 CATGGGGTGAACTCCCTGCCCGG + Intronic
1030372832 7:108719795-108719817 CACATGGTGTTTCCTCTGCCTGG + Intergenic
1032448100 7:132001969-132001991 CACATGCTGCTCCCTCTGCCTGG - Intergenic
1035818306 8:2564024-2564046 GACGTGGTGGACCTTCTGGCTGG + Intergenic
1039360776 8:36874516-36874538 CACGTGGTGGCACCTGTGCCTGG - Intronic
1044384860 8:91575851-91575873 CACGTTGTGCTCCTTCTGCCAGG - Intergenic
1044808372 8:96032156-96032178 CACGTGCTGCTCCCTCTGTCTGG - Intergenic
1046686794 8:117236795-117236817 CACTTGGTGTACCCTCTGCCTGG - Intergenic
1046743118 8:117849089-117849111 CACTTGCTGTGCCCTCTGCCTGG + Intronic
1047189736 8:122667213-122667235 CATTTGCTGAACCCTCTGACTGG + Intergenic
1047363337 8:124189905-124189927 CACGTGCTGTTCCATCTGCCTGG - Intergenic
1053303011 9:36965020-36965042 CACTTGCTGTCCCCTCTGCCAGG + Intronic
1053453018 9:38209186-38209208 CACCTGGTATGCCCTCTGCCTGG + Intergenic
1057185940 9:93057836-93057858 CACCTGCTGTTCCCTCTGCCAGG + Intergenic
1057239871 9:93399167-93399189 CCTGTGGTGAGCCTTCTGCCAGG + Intergenic
1057454623 9:95197119-95197141 AAAGTTGTGAACCCTCTTCCAGG + Intronic
1057517245 9:95732241-95732263 CATGTGCTGTGCCCTCTGCCAGG - Intergenic
1057786553 9:98092399-98092421 CACTTGCTGTGCCCTCTGCCTGG + Intronic
1058095198 9:100852309-100852331 CATGTGCTGCTCCCTCTGCCTGG + Intergenic
1058814649 9:108672071-108672093 CATGTGGTGGACACTGTGCCAGG + Intergenic
1060294786 9:122336061-122336083 CACGTGGTGTTCCCTCTGCCTGG + Intergenic
1060511976 9:124240919-124240941 CACGTAGTGCTCCCTTTGCCTGG - Intergenic
1060975597 9:127763094-127763116 CACTTGCTGTTCCCTCTGCCTGG + Intronic
1061482873 9:130905802-130905824 CACATGCTGTTCCCTCTGCCAGG + Intronic
1061601850 9:131675402-131675424 CACATGGTGAACCCTGTGGACGG - Intronic
1061676699 9:132221241-132221263 CACATGCTGTTCCCTCTGCCTGG - Intronic
1062371077 9:136239051-136239073 CACGAGGTGAAGGCCCTGCCAGG - Intronic
1187452552 X:19411719-19411741 CACTTGCTGTTCCCTCTGCCTGG - Intronic
1189744570 X:44156982-44157004 CCCTTGGTTATCCCTCTGCCTGG - Intronic
1190212056 X:48456825-48456847 CACCTGTTGCTCCCTCTGCCTGG + Intergenic
1193956007 X:87863610-87863632 CACATGATGTTCCCTCTGCCTGG + Intergenic
1197228638 X:123979137-123979159 TACTTGTTGATCCCTCTGCCTGG + Intronic
1197922935 X:131614692-131614714 CACTTGCTGTTCCCTCTGCCTGG + Intergenic
1200205035 X:154309565-154309587 CCCGTGGTGACCCCTCTGGAAGG + Intronic
1200232724 X:154452227-154452249 GACTTGGTGTTCCCTCTGCCTGG - Intergenic