ID: 920391087

View in Genome Browser
Species Human (GRCh38)
Location 1:205602268-205602290
Sequence CACAGCTGGCTGACTGGACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920391087_920391094 30 Left 920391087 1:205602268-205602290 CCTGGTCCAGTCAGCCAGCTGTG 0: 1
1: 0
2: 0
3: 24
4: 191
Right 920391094 1:205602321-205602343 TCTGGCTGGAAAGAGAAACGTGG 0: 1
1: 0
2: 4
3: 23
4: 226
920391087_920391093 16 Left 920391087 1:205602268-205602290 CCTGGTCCAGTCAGCCAGCTGTG 0: 1
1: 0
2: 0
3: 24
4: 191
Right 920391093 1:205602307-205602329 CTGAGTGCTGAGAATCTGGCTGG 0: 1
1: 0
2: 2
3: 28
4: 311
920391087_920391092 12 Left 920391087 1:205602268-205602290 CCTGGTCCAGTCAGCCAGCTGTG 0: 1
1: 0
2: 0
3: 24
4: 191
Right 920391092 1:205602303-205602325 ACAGCTGAGTGCTGAGAATCTGG 0: 1
1: 0
2: 2
3: 18
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920391087 Original CRISPR CACAGCTGGCTGACTGGACC AGG (reversed) Exonic
900152146 1:1183348-1183370 TGCAGCTGGCTGGCTGGGCCGGG - Intronic
900224250 1:1525337-1525359 CACAGCCGTCTGCCTGGGCCAGG + Intronic
900334722 1:2156655-2156677 CACAGCTGGCATACTGCACTGGG + Intronic
900777663 1:4596668-4596690 CACAGGTGGCTGACCCCACCGGG - Intergenic
901195337 1:7437025-7437047 CACAGCTGGCAGGCTTGGCCAGG + Intronic
901503460 1:9668793-9668815 CTCGGCTGGCTGACTGGATCTGG + Intronic
902639705 1:17759237-17759259 CCCAGCTTGCTGCCTGGACAGGG - Intronic
902756783 1:18554072-18554094 CAGGGCTTGCTGAATGGACCTGG - Intergenic
905371679 1:37485832-37485854 CACAGCTGGGGCACTGGGCCTGG - Intergenic
905521370 1:38603094-38603116 CTCATCTGGCTGACTGCACAAGG + Intergenic
905930817 1:41786100-41786122 CACAGCCGGCTGCCTGGGCATGG + Intronic
906315427 1:44784131-44784153 TAGAGCTGGCTGGCAGGACCGGG + Exonic
906506314 1:46382457-46382479 CACAGGTGGCTGAGTGGATGGGG - Intergenic
906657398 1:47558603-47558625 CAGGGCTGGCTTACTGGACAGGG + Intergenic
906917406 1:50025800-50025822 ACCAGCTTGCTGACAGGACCAGG + Intergenic
907054301 1:51350689-51350711 CTCAGCCGACTGCCTGGACCTGG + Intergenic
907372934 1:54014585-54014607 CACAGCTGGCTGAATGGCAGAGG + Intronic
907940628 1:59084056-59084078 CATACCAGGCCGACTGGACCTGG + Intergenic
908596341 1:65692535-65692557 GACAGCTGGATGAATGGGCCTGG - Intergenic
913567280 1:120085180-120085202 CACAGTTGGCTGGGTGGTCCAGG - Intergenic
913630852 1:120708366-120708388 CACAGTTGGCTGGGTGGTCCAGG + Intergenic
914288031 1:146245886-146245908 CACAGTTGGCTGGGTGGTCCAGG - Intergenic
914549066 1:148696632-148696654 CACAGTTGGCTGGGTGGTCCAGG - Intergenic
914617616 1:149375087-149375109 CACAGTTGGCTGGGTGGTCCAGG + Intergenic
916170744 1:161999931-161999953 CACAGCTCGCTGAGTGGCCTTGG - Intronic
917792243 1:178506381-178506403 CACAGCTCGCTGGCAGGCCCAGG - Intergenic
919897433 1:202018104-202018126 CACAGCTCGCTGAGGAGACCAGG + Intergenic
920391087 1:205602268-205602290 CACAGCTGGCTGACTGGACCAGG - Exonic
920501408 1:206487723-206487745 GACGGCTGGCTGACTGTACGGGG + Intronic
920645511 1:207800727-207800749 CAAAACTGGCTCACTGGGCCAGG + Intergenic
922729671 1:227942993-227943015 CACAGCTGGCTGCCTGGATGAGG - Intronic
923036552 1:230288587-230288609 CACAGCAGTCAGACTGGATCAGG - Intergenic
923571720 1:235121533-235121555 CACAGCTAGTTGACTGGACATGG - Intronic
924182558 1:241453774-241453796 CACATTTTGCTGATTGGACCTGG - Intergenic
924804569 1:247352160-247352182 CACAGTGGGCTGACTGGCACTGG - Intergenic
1065304713 10:24357218-24357240 CTCAGCTGGCTGCCTGGGCCTGG + Intronic
1067899407 10:50223330-50223352 CACAGCTTGCACACTGGACATGG - Intronic
1070818249 10:79338920-79338942 CACAGAAGGCTGAGGGGACCAGG - Intergenic
1070948939 10:80415422-80415444 GACAGCAGGCTGACTGGGGCAGG - Intronic
1071599858 10:86953817-86953839 CACTCCTGGCAGGCTGGACCAGG - Intronic
1072223954 10:93350724-93350746 AACAGCTGCTTGACTGGACGGGG + Intronic
1072424058 10:95314448-95314470 CACAGCAGGCTGAATGCATCAGG + Exonic
1073103972 10:101021875-101021897 CACCGTTGGCTGCCAGGACCTGG + Exonic
1073187359 10:101624650-101624672 CTCAGTTGGCTGAGTGGTCCAGG - Intronic
1073434061 10:103505653-103505675 AAGAGCTGGCTGGCTGGACATGG - Intronic
1074116912 10:110463063-110463085 CACAGCTGGCGCAGTGGTCCAGG - Intergenic
1075716537 10:124558982-124559004 CACAGCTGGCTTCCTGCACCCGG + Intronic
1075912896 10:126141190-126141212 CACAGCTGGCTGGCTGGTAAGGG - Intronic
1076986146 11:237090-237112 CACAGCGGGCTGCCCGGGCCCGG - Exonic
1077365315 11:2159183-2159205 CTCAGGTGTCTGGCTGGACCTGG + Intronic
1077466094 11:2734431-2734453 CACAGCTGGCTGCGGGGCCCCGG - Intronic
1079117350 11:17648634-17648656 CAAGGCTGGCTGACTTAACCTGG - Intergenic
1079345605 11:19649378-19649400 GACAGAAGGCTGAGTGGACCAGG - Intronic
1083144635 11:60749191-60749213 CAGAGCTGGGAGGCTGGACCCGG - Intergenic
1083928146 11:65821611-65821633 CACACCTGGCTGCCTGGCTCAGG - Intergenic
1085735314 11:79033566-79033588 CACAGCTTGGTGGATGGACCAGG - Intronic
1088761078 11:112929540-112929562 CACTGCTGGCAGACTCGTCCTGG + Intergenic
1089064910 11:115655418-115655440 CAAAGAAGGCAGACTGGACCAGG + Intergenic
1089738376 11:120564846-120564868 GGAAGCGGGCTGACTGGACCCGG + Intronic
1090087045 11:123659463-123659485 CACAGCTGGCTGGCAGGATGAGG - Intergenic
1091401031 12:180809-180831 GACAGCAGGCTGCCTTGACCTGG - Intergenic
1091750666 12:3019592-3019614 CACCGCTGGCTGCCTCCACCAGG - Intronic
1093128429 12:15358535-15358557 CAGAGCTGGCTGTCTGCAGCAGG - Intronic
1093139982 12:15498105-15498127 CAGAGTTGGCTGACTGTAACTGG + Intronic
1094484810 12:30916026-30916048 CACAGATTGTTGACTGCACCAGG - Intergenic
1095050205 12:37547722-37547744 CACAGCTGACTGAGGGGACTGGG - Intergenic
1097004236 12:55903440-55903462 CACAGCGACCTGACGGGACCTGG - Exonic
1098444637 12:70553597-70553619 CACAGCAGGCTGGGTGGACAGGG - Intronic
1100723225 12:97380667-97380689 CACAGCTGGCTGAATGACCTTGG - Intergenic
1100982613 12:100173241-100173263 CACAGCTGTGTGACTGAGCCAGG + Intergenic
1102006929 12:109595124-109595146 CACAGCAAGCTGACTGGCGCAGG + Exonic
1103942939 12:124510745-124510767 CACCTCTGGCTGGCAGGACCTGG - Intronic
1106823149 13:33488985-33489007 CACACCCTGCTGACTGGACTTGG + Intergenic
1110111441 13:71751251-71751273 CACAGCTGGCAGAATTGATCAGG - Intronic
1112346503 13:98594358-98594380 CTCATCTGGCTTAATGGACCAGG - Intergenic
1113307374 13:109093368-109093390 CACCTCTGTCTGACTGGACAGGG - Intronic
1113847730 13:113402178-113402200 CACGGCTGCCTGAGTGGCCCCGG - Intergenic
1114194997 14:20469390-20469412 CACAGTTGGCTCACTGGTCTAGG - Exonic
1121096387 14:91220663-91220685 GAGAGCTGGCTGCCTGGACCGGG - Intronic
1121446624 14:93982918-93982940 AACAGCTGCCTGTCTGGAGCAGG - Intergenic
1122825120 14:104367051-104367073 CACAGCTGGCTCAGGGGCCCAGG + Intergenic
1124202045 15:27686926-27686948 CGCATCTGGCACACTGGACCAGG - Intergenic
1125271117 15:37939842-37939864 CACATTTGGCTAACTGGTCCTGG + Intronic
1126955580 15:53930048-53930070 CTCAGCTGGCCGCCTTGACCTGG + Intergenic
1128661509 15:69504514-69504536 CACAGCTGGGTGACAGGACAAGG + Intergenic
1128687363 15:69696747-69696769 CACAGCAGGCTGTGTGTACCTGG + Intergenic
1131274203 15:90967104-90967126 CACAGCTGGTTGACTGATCAGGG + Exonic
1131327754 15:91465222-91465244 CACAGGTGGCTGACTGGGCATGG - Intergenic
1134287102 16:12871225-12871247 CACAGTTGACTGAGTGGGCCAGG + Intergenic
1134326655 16:13213823-13213845 CCCAGCTGGGTGACCAGACCAGG + Intronic
1136368767 16:29822634-29822656 CAAAGGAGGCTGCCTGGACCTGG + Intronic
1136380984 16:29895485-29895507 AACACCTGGCTGACTTGCCCTGG - Intronic
1136569621 16:31088815-31088837 CACAGGTGGCAGAGTGGCCCGGG - Exonic
1141927012 16:87176748-87176770 CACGGCAGGCTGCCTGGATCAGG - Intronic
1142009678 16:87707469-87707491 CACCGCTGGCTGGCTGCACACGG - Intronic
1142255245 16:89010764-89010786 CACAGCTGGCTGCCCAGAGCCGG - Intergenic
1146726988 17:35164421-35164443 CACAGCTGGCACACTGGTGCTGG + Intronic
1147258954 17:39197596-39197618 CCGAGCTGGGTGGCTGGACCGGG - Exonic
1148496064 17:48054274-48054296 CCCAGCTGACTGACTGGGCTGGG + Intronic
1148788717 17:50161068-50161090 CACAGCTGGATCTCTGGACACGG - Intergenic
1148916632 17:50986159-50986181 AACAGGTGGCAGACTGGATCTGG - Intronic
1149445156 17:56707749-56707771 CACAGCTGGGTGACGTCACCAGG - Intergenic
1149545809 17:57502873-57502895 CACAGCTGGTGGATTGGGCCTGG + Intronic
1149547132 17:57511863-57511885 CACAGCTGTCTGTGTGGGCCTGG - Intronic
1151355326 17:73554775-73554797 CACAGCTGGCTTCCTGGAGAAGG - Intronic
1152911450 17:83007553-83007575 CACAGCTGCCTCCCAGGACCCGG - Intronic
1155253160 18:23970434-23970456 CTCTGCTGCCTGACTGGCCCTGG + Intergenic
1155413265 18:25569257-25569279 AACAGCTGGCAAGCTGGACCTGG + Intergenic
1157204536 18:45687365-45687387 CACAGCTGTCTGCCTGCACAGGG - Intergenic
1157736782 18:50056655-50056677 CACAGGTGACAGACTGGCCCAGG - Intronic
1160256932 18:77255022-77255044 CTCATCTGGCTGAATGGAGCAGG + Intronic
1160757442 19:765091-765113 CACATCTGCCTGCCTGGGCCCGG - Intergenic
1162842159 19:13364487-13364509 CACATCTGGCTGAGTGGAACAGG - Intronic
1165115233 19:33524442-33524464 GACAGCTGGCTGCCTGGAGACGG + Intergenic
1166476225 19:43127262-43127284 CACAGCTGACTGCCTTGACAGGG + Intronic
1167119323 19:47507335-47507357 CACAGATGCCTGATGGGACCTGG + Intronic
1168384041 19:55948124-55948146 CCCAGCTGGCTGTCTCGACCTGG - Exonic
925132689 2:1504573-1504595 CAGAGCTGGGGGACTGGACAAGG - Intronic
925328011 2:3037672-3037694 AACACCAGGCTAACTGGACCTGG - Intergenic
926889859 2:17629690-17629712 CACAGCAGGCCGAGTGGACGAGG - Intronic
927522258 2:23706281-23706303 CACGGCTTCCTGACTGGCCCTGG + Intronic
927524128 2:23721575-23721597 CACAGCTGCCTGGCTGGCCTGGG - Intergenic
927981778 2:27378898-27378920 CACAGCTGGCAGGCTGGGCCTGG + Exonic
928329433 2:30346560-30346582 ATCAGCTGGCTGGCTGGAGCTGG + Intergenic
928385853 2:30867276-30867298 CACATCTGACTGACTGGAACTGG - Intergenic
932187915 2:69714501-69714523 GACAGCAGGCTGGCTGGACTGGG - Intronic
932305104 2:70696340-70696362 CACAGCTGACTCCCTGAACCTGG - Exonic
932573586 2:72950931-72950953 CCGAGCTGGCTGCCTGGGCCTGG - Intronic
935735460 2:106103432-106103454 CACAGCTGGGTGAGTGGAGGAGG + Intronic
936285360 2:111177173-111177195 CAGAGCTTGGTGACTGGACCCGG - Intergenic
937353811 2:121185651-121185673 GACAGCTGCCTGGCTGGATCCGG - Intergenic
938030324 2:127986771-127986793 CACAGATGGGTGAGTAGACCTGG - Exonic
938784425 2:134612072-134612094 CACAGGTGACAGACTGGACTTGG + Intronic
946037983 2:216759215-216759237 CACAGCTACCTGACTTTACCAGG - Intergenic
946237119 2:218330836-218330858 CCCAGCTTGCTGACTGTGCCTGG + Intronic
946854819 2:223941999-223942021 CCCAGGTAGATGACTGGACCAGG - Intronic
948657403 2:239485181-239485203 TGCAGCTTGCTGACTGGCCCTGG + Intergenic
948881142 2:240857769-240857791 CAGAGTTGGCTGACTGGTCCCGG - Intergenic
1169800478 20:9507682-9507704 CGCACCTGGCGGGCTGGACCGGG + Intergenic
1170700414 20:18698630-18698652 CACAGCTGGAGGGCTGGACATGG - Intronic
1174631074 20:51957580-51957602 CTCAGCTTGCTGAGTAGACCTGG + Intergenic
1175190107 20:57206049-57206071 CCGAGCTGTCAGACTGGACCTGG - Intronic
1175217077 20:57396965-57396987 CACAACTGGGTGACAGGACACGG + Intronic
1177964593 21:27712223-27712245 CACTGCTGGCTGTATGGACAAGG - Intergenic
1178040202 21:28632042-28632064 CACAGCAAGCTGACTAGTCCTGG - Intergenic
1179461279 21:41536890-41536912 CACAGCTGGCTGGGTGGGCCGGG + Intergenic
1183456290 22:37924939-37924961 CAGAGGTGGCTGCCTGCACCGGG - Intronic
1185333291 22:50261063-50261085 CACAGCAGGCTGCCTGGAGGAGG + Intronic
954945356 3:54419346-54419368 CAAAACTGGCTGACTGCACAGGG - Intronic
955197206 3:56815921-56815943 CACAGATGACTGACTGGGCTTGG + Intronic
955888747 3:63627991-63628013 AACAGGTGGCTGACTGGATTTGG - Intergenic
960592633 3:119380308-119380330 GACAGCTGGCTGAGTGGACTTGG + Intronic
962674892 3:137748403-137748425 CACAGATGGCTGCCTGAAGCAGG - Intergenic
963015701 3:140821935-140821957 CACAGAGGGCAGACTGCACCTGG + Intergenic
963604652 3:147404287-147404309 CACAAAAGGCTGACAGGACCTGG - Intronic
964543731 3:157809155-157809177 CACAGCTGGCTGTCTGAAGTTGG - Intergenic
965667209 3:171108062-171108084 CACAGCTGGTCGACTGGGCCGGG + Exonic
968090441 3:195895578-195895600 CACAGCTGGCTCACTGGGAGAGG - Intronic
968528142 4:1075057-1075079 CACAGCTGTCAGACAGCACCAGG - Intronic
968896523 4:3407181-3407203 CACAGCTAGGTGACTGCACGTGG - Intronic
970745867 4:19294570-19294592 CAGAGCTGGCTGACAGGAATAGG - Intergenic
978585105 4:110268922-110268944 CACAGGTGGCTGAATGGGGCGGG - Intergenic
979498382 4:121411056-121411078 CACTGCTACCTGACTGGAACAGG - Intergenic
979631355 4:122906508-122906530 GCCAGCATGCTGACTGGACCTGG + Intronic
992123474 5:73617615-73617637 TAAAGGAGGCTGACTGGACCGGG + Intergenic
996944719 5:129053006-129053028 GACAGCTGGCTGACAGAACAAGG + Intergenic
1000369270 5:160519421-160519443 CACAGCTGACAGACTGGCCATGG - Intergenic
1001389425 5:171366814-171366836 CCCAGAAGGCTGCCTGGACCTGG - Intergenic
1007971516 6:46056519-46056541 CACAGCTGGCTGTCATGAGCTGG - Intronic
1007971663 6:46057807-46057829 CACAGCTGGCTGTCATGAACTGG - Intronic
1010285492 6:74073251-74073273 CACAGCTGGCATACTGAACCAGG - Intergenic
1011667797 6:89651835-89651857 CACTGCTGGCTGACTTAACGTGG - Intronic
1017951240 6:159137016-159137038 CCCGGCTGGCTGACTGGCCTGGG + Intergenic
1019262559 7:89663-89685 CACAGCCTGCTGACTGGCCCTGG + Intergenic
1019312095 7:367820-367842 CTCAGCTGGCTGACCGGGCTGGG - Intergenic
1019856315 7:3611943-3611965 CACAGCTACCTGGCTGGAACTGG + Intronic
1019987691 7:4669700-4669722 CAGAGCTGGCTGGATGGACTGGG + Intergenic
1020042243 7:5012918-5012940 GACAGCAGGCTGGCTGGACTGGG - Intronic
1020781306 7:12519464-12519486 GAGAGCTGTCTGACTGGAGCTGG - Intergenic
1021989877 7:26130864-26130886 CACAGCTAGTGGACTGGTCCTGG + Intergenic
1023638996 7:42238834-42238856 CACTTCTGGCTGGGTGGACCCGG - Intergenic
1024042272 7:45564883-45564905 CCAAGCTGGCTGCCTGGACTTGG - Intergenic
1026170672 7:67951262-67951284 GGCAGATGGCTGACTGGACACGG + Intergenic
1026954524 7:74368619-74368641 CACAGCTGCTTCCCTGGACCAGG + Intronic
1033148298 7:138890597-138890619 CACAGCTGGCTGACCGTGCCGGG - Intronic
1033981036 7:147166237-147166259 CACAGCTATCTGAATGGAACTGG + Intronic
1035313795 7:157985819-157985841 CCCACCTGGCTGACGAGACCCGG + Intronic
1035313814 7:157985927-157985949 CCCACCTGGCTGACGAGACCCGG + Intronic
1037865803 8:22441298-22441320 CACGGCTGGCTGACGGCTCCGGG + Exonic
1039248220 8:35632827-35632849 AAGAGATGGCTGACTGGAACAGG - Intronic
1040449058 8:47525812-47525834 CACTGCTGGCTAGTTGGACCTGG + Intronic
1042566478 8:70117151-70117173 CACGGCAGGCTGGCAGGACCAGG - Intronic
1047458386 8:125037903-125037925 GCCAGCTGGCAGTCTGGACCTGG - Intronic
1047998302 8:130357567-130357589 CTCAGCGGCCCGACTGGACCAGG - Intronic
1048416117 8:134229556-134229578 TACTGCTGGCTTACTGAACCAGG + Intergenic
1049324643 8:142015632-142015654 CACAGCAGGCGGCCTGGCCCTGG - Intergenic
1050545269 9:6704170-6704192 GTCAGCTGGCTGACGGGACCAGG - Intergenic
1050676570 9:8062607-8062629 CACTGCTGGCTGCCAGCACCAGG - Intergenic
1055491058 9:76805704-76805726 CACAGCTGGCTAATTTGTCCAGG + Intronic
1056092165 9:83216261-83216283 CAAAGCTGTCTGACATGACCTGG - Intergenic
1057251416 9:93506549-93506571 CACAGCTGGCTCAGTGGATCAGG - Intronic
1057607395 9:96509380-96509402 CAAAGCTGGCTGTCAGGACTTGG - Intronic
1060965274 9:127708913-127708935 CAGAGCTGGCCGACTGCAGCAGG + Intronic
1061585853 9:131567972-131567994 CAGAGCTGGCTCACTGGGCTGGG + Intergenic
1186186281 X:7022929-7022951 CACAGCTGACTGCCTTGACAGGG + Intergenic
1186812739 X:13206312-13206334 CAAAGCTGGCTGGCTTGCCCAGG + Intergenic
1187534603 X:20128777-20128799 CCCAGCTGGCTGGCTGGAAAAGG - Intronic
1188508961 X:30912911-30912933 CACAGCTGCCAGACTGAACATGG + Intronic
1190759608 X:53428483-53428505 TACTGCAGGCTGGCTGGACCAGG - Exonic
1196235385 X:113274105-113274127 CAAAGCTGGCTGCAGGGACCCGG + Intergenic
1197704325 X:129622984-129623006 CACAGCTGCCTGCCAGAACCTGG - Intergenic
1199654332 X:149979834-149979856 CACAGCTGTCTGGCTGAAACGGG - Intergenic
1200237533 X:154475489-154475511 CACAGCTGGACGGCTGGAGCTGG - Intergenic
1200244781 X:154517168-154517190 CCCAGCTGGCTGTATGGACCTGG + Intergenic
1200951256 Y:8902133-8902155 CACAGCAGGCTGTCTGGGCCTGG - Intergenic
1201561800 Y:15325071-15325093 CACAGCTGACTGCCTTGACAGGG + Intergenic