ID: 920392396

View in Genome Browser
Species Human (GRCh38)
Location 1:205616619-205616641
Sequence CCTTCTGTACTGAACAGTCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920392396 Original CRISPR CCTTCTGTACTGAACAGTCA TGG (reversed) Exonic
904434083 1:30483051-30483073 CTTTCTGCACTGCACAGTAATGG + Intergenic
905477944 1:38242111-38242133 CCTTGTGTACAGAACAGCCTGGG - Intergenic
913446248 1:118953843-118953865 CAGTCTGAAATGAACAGTCAAGG + Intronic
917505199 1:175621089-175621111 CCTCCTGCAGTTAACAGTCAAGG - Intronic
918941797 1:191009428-191009450 CATTTTGTACTGAACAGACAGGG - Intergenic
920392396 1:205616619-205616641 CCTTCTGTACTGAACAGTCATGG - Exonic
920994970 1:210981239-210981261 CATGTTGGACTGAACAGTCAGGG + Intronic
922462520 1:225824271-225824293 CCTTCTGGCCTGAAGACTCAAGG + Intronic
924706745 1:246508549-246508571 CCTTTTGTACTTTACACTCATGG - Intergenic
1066036922 10:31500555-31500577 CCTTCTTTACTGACAAATCAAGG - Intronic
1067977560 10:51043110-51043132 ACTTCCTTACTGAGCAGTCATGG + Intronic
1070796762 10:79221457-79221479 CCTTCTGTACTGAGGAGGGAGGG - Intronic
1070856007 10:79608524-79608546 CCTTCTTTAGTGAAAACTCAGGG + Intergenic
1072154870 10:92715109-92715131 CCTGCTCTACTGAGCAGGCAGGG - Intergenic
1076932120 10:133538489-133538511 CCTTCTTTACTGGGCAGACACGG + Intronic
1082041971 11:47693483-47693505 CTTTCTCCACTGAACAGTCTTGG + Intronic
1082863164 11:57874275-57874297 CCTTCTTTGCTGAACATTGAGGG + Intergenic
1083842028 11:65310065-65310087 CCTTCTGTCCAGGACAGTCCAGG + Intergenic
1084990371 11:72917347-72917369 CTTTCTCTATTGAATAGTCATGG + Intronic
1088947139 11:114525624-114525646 CCTTCTGTGCAGCACAGTGAAGG + Intronic
1091346028 11:134854797-134854819 CCTTCAGTACTGAACAGGTCCGG - Intergenic
1095934781 12:47666052-47666074 CCTCCTGTACTAAACATACATGG - Intronic
1097614727 12:61870498-61870520 CCTTCTGTTCTGAACAGAGAAGG - Intronic
1098157452 12:67614417-67614439 CCTTCAGTCCTGAACATTTAAGG + Intergenic
1101412558 12:104481557-104481579 CCTTCTGTAGGGAGCGGTCATGG + Intronic
1101754571 12:107610894-107610916 CCTTGTGTGGTGAACCGTCATGG + Intronic
1101958012 12:109227692-109227714 GCTACTGTACTGAACAGTGCAGG - Intronic
1106010953 13:25822038-25822060 ACATCTGTTCTGCACAGTCATGG + Intronic
1114194705 14:20467128-20467150 CCTTCTGTTTTGAACAGTGTGGG + Intergenic
1114752859 14:25225121-25225143 ACTGCTGTACAGAACAGTCGCGG - Intergenic
1115418453 14:33164874-33164896 CCTTCTGTACTGGTGAGACAGGG + Intronic
1115715576 14:36099338-36099360 CCTTCTGTATTGAATATTCAGGG - Intergenic
1116205566 14:41861559-41861581 CCATCTTTACTGAACTGTCTGGG + Intronic
1118145779 14:63134936-63134958 ACTGCTGTACTGAACTTTCAAGG + Intergenic
1118569126 14:67174814-67174836 ACTTCTCTAATGACCAGTCATGG + Intronic
1122236635 14:100334119-100334141 CCCTCTGTCCTGCAGAGTCAGGG - Exonic
1126513021 15:49501861-49501883 CCTGCTGTCCTGCACAGTCTTGG + Intronic
1129683163 15:77669674-77669696 CCTTGATTACTGAACAGTGATGG - Intronic
1133124256 16:3634895-3634917 ACTCCTGTACTGATCAGTCATGG - Intronic
1138196783 16:55057965-55057987 CCTTCTGAACCGAGCAGTCAAGG + Intergenic
1138740314 16:59300908-59300930 CCTTCTCTACTAATCAGTAAAGG + Intergenic
1141012728 16:80417997-80418019 ACTTCAGAACTGAACAGCCATGG + Intergenic
1141164830 16:81653366-81653388 CCTTCTCTACTCCACAGACACGG - Intronic
1141187364 16:81797530-81797552 CCTTATGAACAGAACAGACAGGG - Intronic
1142179098 16:88658717-88658739 CCCCCTGTAATGAACAGCCAGGG + Exonic
1145823779 17:27861096-27861118 CCTTCTGGATTGACCAATCAGGG - Intronic
1147537460 17:41329872-41329894 CCTTTTGTACTTTACACTCATGG + Intergenic
1150316165 17:64170952-64170974 CTTTCTGTTCTTACCAGTCATGG - Intronic
1150560061 17:66286761-66286783 TCATCTGTACAGAACAGGCAGGG - Intergenic
1152281193 17:79385757-79385779 CCTTCTGTAATGGAGAGTGATGG - Intronic
1152281238 17:79385979-79386001 CCTTCTGTAATGGAGAGTGATGG - Intronic
1153103327 18:1499233-1499255 CCTTCAGTACTGAAGACTCTGGG + Intergenic
1155142629 18:23056526-23056548 CCGCCTGGACTGCACAGTCATGG - Intergenic
1157997018 18:52570824-52570846 CTTTCTGTACTGTACAGTTCAGG + Intronic
927865517 2:26585050-26585072 TCCTGAGTACTGAACAGTCAGGG + Intronic
927972809 2:27316430-27316452 TCTTCTGAAATGAACCGTCAGGG - Intronic
931313555 2:61105208-61105230 CCGTCTGTACTAACCAGGCATGG + Intronic
931792803 2:65680218-65680240 CCTTCTTTATAGAACAGTCCTGG + Intergenic
932778939 2:74548165-74548187 CCTCCTCTGCTGAACAGACATGG - Intronic
935933318 2:108153523-108153545 TCTTCTGTACTCACCAGGCAGGG - Intergenic
937760783 2:125600987-125601009 CCTTCTGTAAAGAAGAGGCAAGG - Intergenic
938681177 2:133691644-133691666 CCTTCTGTACTGAACAGGTGTGG - Intergenic
939098722 2:137868852-137868874 CTCTCTTTACTGAACAGACAGGG - Intergenic
940981488 2:160008428-160008450 CTTTCTGCACTGAACAGTCTTGG - Intronic
1170001336 20:11617968-11617990 CTTCCTGTACTCAACAGTAATGG - Intergenic
1173829185 20:46068630-46068652 CCTTCTCTCCTGAAAAGTTAAGG + Exonic
1176238752 20:64066260-64066282 CCTTCTTGACTGAGCAGTAAGGG + Intronic
1181945232 22:26511825-26511847 CCTTCTGTCCTAAACACTCCTGG - Intronic
952410374 3:33043909-33043931 CCTTCAGTACTTAATAGTAAAGG - Intronic
956097590 3:65733777-65733799 GCTTCTGGACTGAGCAGGCAAGG - Intronic
960863874 3:122181099-122181121 CTTTCTGTTCTTAGCAGTCAGGG + Intergenic
963710943 3:148746852-148746874 ACTTGTGTAGTGAACACTCATGG + Intergenic
967308740 3:188085945-188085967 CCTCCTGTACAGGACAGTGATGG + Intergenic
979268267 4:118729002-118729024 GCATCTGTACTGAAAAGGCATGG + Intronic
980077685 4:128310585-128310607 CCTTCAATAATGAAAAGTCAAGG - Intergenic
980778940 4:137471669-137471691 CACTCTGCACTGTACAGTCATGG - Intergenic
981113398 4:140960695-140960717 CCATCTTTACTCAAGAGTCAGGG - Intronic
982436367 4:155385759-155385781 CCTTTTGTACTTTACACTCATGG + Intergenic
982988586 4:162242529-162242551 CCTCTTCTACTGAAAAGTCAGGG - Intergenic
986224735 5:5801992-5802014 CCTTCTGTGCTGAACCTTCCTGG + Intergenic
986647036 5:9927499-9927521 CCTTCTGTAATGATCATGCATGG + Intergenic
987375695 5:17231860-17231882 CCTTCAACACTGAACAGACATGG - Intronic
988934803 5:36071226-36071248 CCTTCTTTGCTGAGCAGGCATGG - Intronic
990108843 5:52297547-52297569 CCTACTGTACTGAATACTCTAGG + Intergenic
990357416 5:54983385-54983407 CCTGATGTACTGAACAGTGCTGG + Intronic
991071794 5:62491475-62491497 GCTTCTGCACTGGACAGTGAAGG - Intronic
994838586 5:104890999-104891021 CTTTCTATCCTGAACAGTAATGG - Intergenic
996602308 5:125278601-125278623 ACCTATGTACTGAACAGACATGG + Intergenic
996685929 5:126280551-126280573 CGTTCTGTCCTCAACAGCCAAGG + Intergenic
998733955 5:145113493-145113515 ACTAATGAACTGAACAGTCATGG - Intergenic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
1000145529 5:158449760-158449782 CATTGTGTACTGATCAGCCATGG + Intergenic
1002627414 5:180540126-180540148 CCCTCGGAACTGACCAGTCAAGG - Intronic
1003642351 6:7886699-7886721 CATTCTGTAAAGAACTGTCAAGG - Intronic
1005377516 6:25199103-25199125 ACTTCTGTACTGGAGAGGCAGGG - Intergenic
1006922708 6:37637070-37637092 CCTTCTTTACTGCAAAGACAGGG - Exonic
1008742971 6:54632306-54632328 CATACTGCACTGAACACTCAAGG + Intergenic
1009965135 6:70569810-70569832 CCTTCTGTACCCTAAAGTCATGG + Intronic
1019087166 6:169489482-169489504 ACTTCTGCACTGGGCAGTCAAGG + Intronic
1020502748 7:8943784-8943806 CCTCATGTACTGATCACTCAGGG - Intergenic
1021242432 7:18220331-18220353 TCTTCAGTTCTGAATAGTCATGG - Intronic
1021333045 7:19362809-19362831 CCTTCTGTCCTTCACAGGCATGG + Intergenic
1032521320 7:132547633-132547655 CCTACTGTACAGAAGAATCAAGG + Intronic
1033934509 7:146567133-146567155 CCTTCTGTAATAAACAGTATAGG + Intronic
1034719739 7:153280103-153280125 CCTCCTGAACTGCACACTCAGGG - Intergenic
1035428481 7:158798764-158798786 TCTTCTTTTCTGAACAGCCAGGG - Intronic
1035772108 8:2155931-2155953 CCTTCTGCACTGACCACTCATGG + Intronic
1039703169 8:39981601-39981623 CTTTCTGAGCTGAAAAGTCAAGG - Intronic
1041190518 8:55349232-55349254 ACTTCAGTTCTGAACAATCATGG - Intronic
1041360749 8:57051239-57051261 ACTTGTTGACTGAACAGTCAGGG + Intergenic
1041361267 8:57056589-57056611 ACTTGTTGACTGAACAGTCAGGG + Intergenic
1044470735 8:92563505-92563527 CCTTCTGTACTGGACTGTACTGG - Intergenic
1045492525 8:102680992-102681014 ACTTCTTAACTGAACAGTCAGGG - Intergenic
1046168105 8:110466383-110466405 CCTTCTTTATTGAGCAGTCAAGG + Intergenic
1047180423 8:122582562-122582584 CCTGCTGTAGTGAACACTCAAGG + Intergenic
1051711953 9:19940317-19940339 ACTTTTGTACAGAATAGTCAGGG + Intergenic
1057043649 9:91866633-91866655 CTTGCTGCACTGAACAGTAAGGG + Intronic
1058403814 9:104648372-104648394 CCTTCTGTACTAAACTGTGAAGG - Intergenic
1058483674 9:105422200-105422222 CCCTCTGTACTGCACAGAAAGGG + Intronic
1060879058 9:127104977-127104999 CTCTCTGCACGGAACAGTCAGGG - Intronic
1187478444 X:19632813-19632835 CCTTCTGTCCTGAATCATCAAGG - Intronic
1190740020 X:53282512-53282534 CCTTCTGCTCAGAACAGCCAGGG - Intronic
1193333287 X:80259485-80259507 CCTTCTGAACTGAGAAGTGAAGG - Intergenic
1196001050 X:110786502-110786524 CCTTCTGGACTGAAAACTAAAGG - Intronic
1197219316 X:123896392-123896414 CTTTTTCTACTGAACAGTCTAGG + Intronic
1197978589 X:132193021-132193043 TCTTCTGTGCTGAAAAGGCAAGG - Intergenic
1199099193 X:143779161-143779183 CCTTCTGTGCAGCACAGTGAAGG + Intergenic