ID: 920397824

View in Genome Browser
Species Human (GRCh38)
Location 1:205659581-205659603
Sequence CTCCAGGCTTAGGGCCTGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 284}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920397819_920397824 -7 Left 920397819 1:205659565-205659587 CCATTAGGGAAGGGAGCTCCAGG 0: 1
1: 0
2: 4
3: 16
4: 194
Right 920397824 1:205659581-205659603 CTCCAGGCTTAGGGCCTGGCAGG 0: 1
1: 0
2: 2
3: 26
4: 284
920397816_920397824 2 Left 920397816 1:205659556-205659578 CCCACGTGTCCATTAGGGAAGGG 0: 1
1: 0
2: 1
3: 5
4: 84
Right 920397824 1:205659581-205659603 CTCCAGGCTTAGGGCCTGGCAGG 0: 1
1: 0
2: 2
3: 26
4: 284
920397818_920397824 1 Left 920397818 1:205659557-205659579 CCACGTGTCCATTAGGGAAGGGA 0: 1
1: 0
2: 0
3: 6
4: 95
Right 920397824 1:205659581-205659603 CTCCAGGCTTAGGGCCTGGCAGG 0: 1
1: 0
2: 2
3: 26
4: 284
920397812_920397824 8 Left 920397812 1:205659550-205659572 CCAGCACCCACGTGTCCATTAGG 0: 1
1: 0
2: 0
3: 5
4: 82
Right 920397824 1:205659581-205659603 CTCCAGGCTTAGGGCCTGGCAGG 0: 1
1: 0
2: 2
3: 26
4: 284
920397811_920397824 11 Left 920397811 1:205659547-205659569 CCTCCAGCACCCACGTGTCCATT 0: 1
1: 0
2: 1
3: 9
4: 207
Right 920397824 1:205659581-205659603 CTCCAGGCTTAGGGCCTGGCAGG 0: 1
1: 0
2: 2
3: 26
4: 284
920397810_920397824 17 Left 920397810 1:205659541-205659563 CCACTGCCTCCAGCACCCACGTG 0: 1
1: 0
2: 1
3: 63
4: 809
Right 920397824 1:205659581-205659603 CTCCAGGCTTAGGGCCTGGCAGG 0: 1
1: 0
2: 2
3: 26
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920397824 Original CRISPR CTCCAGGCTTAGGGCCTGGC AGG Exonic
900115137 1:1025081-1025103 CTCCTGGCTGAGGGCCGGCCAGG + Intronic
900284937 1:1894540-1894562 CTCCAGGGATGGGCCCTGGCTGG - Intergenic
900289441 1:1917685-1917707 TTCCAGGCTGAGGGCCTGCTGGG + Exonic
900292578 1:1929781-1929803 CCCCAGGCTGCTGGCCTGGCCGG - Intronic
900349893 1:2229380-2229402 CTCCAGGCCCAGCGCCAGGCTGG - Exonic
900980286 1:6042462-6042484 TGCCAGGCTTAGGGCCCTGCAGG + Intronic
901240896 1:7692640-7692662 CACCAGGCCTGGGGCCTGGCTGG - Intronic
901261630 1:7875802-7875824 CCCCAGGCTCAGGGACTGGTGGG - Intergenic
901646817 1:10721202-10721224 CTCCAGACAGAGGGGCTGGCTGG + Intronic
901810625 1:11765254-11765276 CTCTGGGCGCAGGGCCTGGCAGG - Intronic
902512134 1:16972313-16972335 AGCCAGGCTGAGGACCTGGCTGG + Intronic
902551041 1:17219797-17219819 CTCCAGGCCCAGGGGCTGGAGGG + Intronic
903047555 1:20575825-20575847 CTCCATGCTGAGGGACTTGCCGG - Intergenic
903787638 1:25871925-25871947 CTCCAGGCTCACTACCTGGCTGG - Intergenic
904208129 1:28868166-28868188 ATCCAGGCTTGGGGGCTGCCTGG - Intergenic
904614844 1:31744139-31744161 CTGCAGGGTTAGGTCCTGCCTGG - Intronic
905339195 1:37266672-37266694 CGCCTGGCTTAGTGCTTGGCTGG - Intergenic
907373190 1:54016131-54016153 TTCCAGGCAGAGGGCGTGGCAGG + Intronic
910357513 1:86377288-86377310 CTCCAGCCTTATGGCCTGCAGGG + Intronic
912710529 1:111946533-111946555 CTCCAGCCCCAGGGCCTGCCAGG + Intronic
914251686 1:145927175-145927197 CTCCAGTCTTAGTGCCTTCCCGG + Intergenic
919487240 1:198159269-198159291 CGCCAGGCTGAGGGCCAGCCTGG + Intronic
919514891 1:198510845-198510867 TTCCAGGCTTGGGTCCTGGATGG - Intergenic
919839309 1:201597640-201597662 CACCAGGCTGAGGGCCAAGCTGG + Intergenic
920397824 1:205659581-205659603 CTCCAGGCTTAGGGCCTGGCAGG + Exonic
922043051 1:221915861-221915883 CTTGAGGCTTATGCCCTGGCTGG - Intergenic
922863364 1:228838101-228838123 CTGGAGTCTTTGGGCCTGGCAGG - Intergenic
922881685 1:228985884-228985906 CTCCAGGCTCTGGGTCTGGCGGG - Intergenic
1063591509 10:7400044-7400066 CTCCAGGCTAAGGGGCAGGCAGG + Intronic
1063954807 10:11255973-11255995 CTCCAGGCTGTGGGCCAGGCTGG + Intronic
1063976719 10:11423529-11423551 CTCCAGGGCTAGGGCTGGGCAGG - Intergenic
1064294713 10:14068185-14068207 TTCCAGGCTCAGAGCCAGGCTGG + Intronic
1064425484 10:15225832-15225854 CTCCATGCTTAGGGGCAGGTGGG - Intronic
1064690675 10:17915123-17915145 CTCCAGGCTGCTGGCCTGCCCGG - Intergenic
1066583514 10:36907026-36907048 TACCAGGCTAAGGCCCTGGCTGG + Intergenic
1067497721 10:46774752-46774774 GTCCAGGCTCCGGGGCTGGCCGG + Intergenic
1067596929 10:47565662-47565684 GTCCAGGCTCCGGGGCTGGCCGG - Intergenic
1069900294 10:71702973-71702995 CTGCAGGCTTAGGGAATGGAAGG - Intronic
1071275895 10:84054725-84054747 TCCCAGGCCTAGAGCCTGGCAGG + Intergenic
1074327817 10:112469988-112470010 CTCCAGGCTGAGAGCCATGCGGG + Intronic
1075063017 10:119269907-119269929 CCCCAGGCTTTGGAGCTGGCTGG - Intronic
1075094217 10:119460610-119460632 CCCCAGGCTCCAGGCCTGGCTGG - Intergenic
1075736743 10:124669012-124669034 CCCCAGGCCAGGGGCCTGGCTGG - Intronic
1075892044 10:125960458-125960480 GCCCACGCTCAGGGCCTGGCAGG - Intronic
1076220399 10:128729167-128729189 CTCCAGGCTGATGACCTGGATGG - Intergenic
1076378786 10:130011132-130011154 CCCCAGGCCTAGGGGCTGGAGGG - Intergenic
1076438850 10:130465353-130465375 CTCGAGGCTCAGGGCCTGAGTGG + Intergenic
1076571989 10:131439127-131439149 TACCAGGCCTGGGGCCTGGCAGG - Intergenic
1076744644 10:132506707-132506729 CTCCAGGCTCTGCACCTGGCAGG + Intergenic
1077109100 11:854295-854317 CTGTATGGTTAGGGCCTGGCTGG + Intronic
1077207480 11:1351937-1351959 GTCCAGGCATGGGGCCTGGGAGG - Intergenic
1077207578 11:1352178-1352200 GTCCAGGCATGGGGCCTGGGAGG - Intergenic
1077207753 11:1352596-1352618 GTCCAGGCATGGGGCCTGGGAGG - Intergenic
1077302470 11:1853674-1853696 CGCCAGGCTTGGGGCCCAGCAGG + Intronic
1077322606 11:1949028-1949050 CTCCAGGCTTGGGGCCTGAAGGG - Intronic
1078132079 11:8621274-8621296 CTCCAGACCTGGGGCCTGGGTGG + Exonic
1078355272 11:10627984-10628006 CTCCAGGCAGAGGGGATGGCGGG + Exonic
1078586061 11:12590279-12590301 CTCTAAGCATAGTGCCTGGCAGG - Intergenic
1079130849 11:17746167-17746189 CTCCAGGCTCAGGGGATGGAGGG - Intronic
1080641990 11:34163651-34163673 CTCCAGGCCATGGGCTTGGCAGG - Intronic
1081739596 11:45429208-45429230 CTCAAGGCTCAGGGAGTGGCAGG - Intergenic
1083442905 11:62688559-62688581 GTCCAGGCAGAGGGCATGGCAGG - Intronic
1084128928 11:67118932-67118954 TTCCAGGGCTCGGGCCTGGCTGG - Intergenic
1084412545 11:69013011-69013033 CTGCAGGGTGAGGGCCAGGCAGG - Intronic
1084464089 11:69312248-69312270 CTCCAGGCTGAGGCACTAGCAGG + Intronic
1084809693 11:71604624-71604646 CTCCTGTCTTGGGGCCTTGCAGG - Intergenic
1085903728 11:80734145-80734167 TACCAGGCTAAGGCCCTGGCTGG - Intergenic
1089018279 11:115185414-115185436 GTCAAGGCTGTGGGCCTGGCAGG + Intronic
1089329577 11:117680286-117680308 CACCAGGCTTGGGGGCTGGAAGG - Intronic
1089534406 11:119151798-119151820 CTCCAGCCCAAGGGCCTGGCTGG + Intronic
1090042459 11:123302705-123302727 CTTAAGCCTTAGGGCATGGCTGG + Intergenic
1090640651 11:128726416-128726438 GTCCAGCCTTGGGGCCAGGCAGG - Intronic
1090876888 11:130798201-130798223 CTCAAGGCTTGAGGCCTGGGTGG + Intergenic
1091090683 11:132768766-132768788 CTCCTTGCTGGGGGCCTGGCTGG - Intronic
1202805623 11_KI270721v1_random:4341-4363 CTCCAGGCTTGGGGCCTGAAGGG - Intergenic
1091474159 12:754586-754608 CTCCTGGTTTAGAGTCTGGCAGG + Intronic
1092038316 12:5361027-5361049 CGTCAGGCTGAGGGGCTGGCTGG + Intergenic
1092698375 12:11199544-11199566 CTCCAGCCTCAGGGCCTTGGAGG + Intergenic
1094309970 12:29069503-29069525 CTCCAGCCTGATGGCCTGCCTGG - Intergenic
1095341677 12:41096993-41097015 TTCCAGGGTTAGGGCAGGGCAGG + Intergenic
1096071768 12:48779570-48779592 CCCTAGGCCTAGGGCCTGGCAGG - Intronic
1096403302 12:51324582-51324604 TTCCAGGCTTAGAGCCTACCTGG - Intronic
1096514301 12:52147755-52147777 CTCCCTGGTTAGGGCCTGGAGGG + Intergenic
1099722055 12:86376281-86376303 CTCCAGGCTTTGAGCCTGCTGGG - Intronic
1100447951 12:94678543-94678565 CTCCAGGCCTAGGGCGCGGCGGG - Intergenic
1102514516 12:113437329-113437351 TTCCTGGCATAGGGCATGGCAGG + Intronic
1102543756 12:113640073-113640095 CCCCAGACTCTGGGCCTGGCTGG + Intergenic
1102584729 12:113914986-113915008 CTCCCGGCTGTGGGCCTGGAAGG + Exonic
1102591566 12:113960129-113960151 CTCCAGGCTCTGGGTTTGGCCGG + Exonic
1103864709 12:124042729-124042751 CTCCTGGCCTAGAGACTGGCAGG + Intronic
1104859764 12:131917965-131917987 CTCTGGGCCTGGGGCCTGGCTGG + Intronic
1104860314 12:131920021-131920043 CCGCAGGCTCAGGCCCTGGCAGG - Exonic
1104979314 12:132566694-132566716 CACCAGGCCTAGAGCTTGGCCGG + Intronic
1107086293 13:36431427-36431449 CTCCGGGCTGGGGGCCGGGCGGG - Intergenic
1109221065 13:59641475-59641497 TTCCAGGCTCAGGGAGTGGCTGG - Intergenic
1110596809 13:77328590-77328612 CTCCAGGGTTAGGGGCTGCCTGG - Intergenic
1118274395 14:64372836-64372858 CCCCAGTGTTAGGGCCTGGTGGG - Intergenic
1118362050 14:65064942-65064964 CTCCAGGCCCAGGCCCTGACTGG + Intronic
1119480915 14:74957001-74957023 CTCCAGGCTTAGGGCCGGCCAGG - Intergenic
1121025007 14:90609149-90609171 CACCAGGCAGAGAGCCTGGCTGG - Intronic
1121228809 14:92341375-92341397 CTCCAGGCTGAAGGCCTTTCGGG - Intronic
1121522301 14:94594478-94594500 CTCCAGGCAGAGGGACTGGCTGG + Intronic
1121832396 14:97063510-97063532 CCCCAGGCCCAGGGCCAGGCTGG - Intergenic
1122122444 14:99561696-99561718 CTCCAGGCTGGGGCCCTGGGTGG - Intronic
1122428426 14:101624819-101624841 CTCCAGGGATGGGGCCTGGAGGG + Intergenic
1122549197 14:102540586-102540608 CTGGAGGCTTCGGGCCTGGAAGG + Intergenic
1122777996 14:104131296-104131318 ATCCAGGCTGCGGGCCTTGCAGG + Intergenic
1202836424 14_GL000009v2_random:80488-80510 CTCAAGGGTTAGGTGCTGGCAGG - Intergenic
1124341780 15:28894538-28894560 CTCCAGGCAAAGGGCCAGCCTGG + Intronic
1127798556 15:62458253-62458275 CTCCATGCTAAGGGTCAGGCGGG + Intronic
1127975323 15:63992873-63992895 GCCCAGGCTATGGGCCTGGCTGG - Intronic
1128312810 15:66642032-66642054 CTCAGGGCTTAGGGCCTGGAGGG - Intronic
1128449931 15:67799660-67799682 CTGCAGGCTTAGAGCCTGCCTGG + Intronic
1129606104 15:77025731-77025753 CTCCAGGCTTTGGGGCTTGAGGG + Intronic
1130059940 15:80562212-80562234 TTACAGGCATGGGGCCTGGCTGG + Intronic
1131143429 15:89996591-89996613 CTGCAAGCTTAGGGCCTCACTGG + Intergenic
1132677116 16:1125408-1125430 CTCCAGGCTCAGGGGGTGGTAGG - Intergenic
1133246320 16:4451170-4451192 CTCCTGGCTCAGGGCAGGGCAGG + Intronic
1133247282 16:4457465-4457487 CGCCAGGCATAGAGCGTGGCTGG - Intergenic
1133282984 16:4677535-4677557 CTCCAGGCTCTGGGCCAGGACGG - Exonic
1135540330 16:23324936-23324958 CTCCTGGCATGGGGCCTGGTGGG + Intronic
1136113091 16:28077317-28077339 CTCCAGGCGTGGGTCCTGACTGG - Intergenic
1136223899 16:28846106-28846128 CTCCAAGCTTCGGTCCCGGCAGG - Exonic
1136369212 16:29825551-29825573 GCCCAGGTTTAGGGCATGGCAGG + Intronic
1136685810 16:31994368-31994390 CTCCAGGCCGAGGGCCCTGCTGG - Intergenic
1136786423 16:32937901-32937923 CTCCAGGCCGAGGGCCCTGCTGG - Intergenic
1136883349 16:33915894-33915916 CTCCAGGCCGAGGGCCCTGCTGG + Intergenic
1138537852 16:57669161-57669183 CTCCTGTCTCAGGGCCTTGCAGG + Intronic
1138589763 16:57993385-57993407 CTAGAGGCTGAGGGCCTGGTGGG + Intergenic
1139515825 16:67451850-67451872 CTCCAGTTTCATGGCCTGGCAGG + Intronic
1139650078 16:68357826-68357848 GTCCAGTCTCAGGTCCTGGCAGG - Exonic
1140196882 16:72862311-72862333 CAGCAGGCTTAGGGCCTGGTTGG - Intronic
1140565499 16:76036726-76036748 CTTCAGGCTTACCTCCTGGCTGG + Intergenic
1141143172 16:81510547-81510569 ATCCTGGCTTTGTGCCTGGCTGG - Intronic
1141623358 16:85248812-85248834 GTCCAGGCTGAGGTCCTGGGAGG + Intergenic
1142251685 16:88994648-88994670 AGCCAGGTTTGGGGCCTGGCTGG + Intergenic
1203088657 16_KI270728v1_random:1199567-1199589 CTCCAGGCCGAGGGCCCTGCTGG - Intergenic
1144738111 17:17566211-17566233 GTGCAGGCCTGGGGCCTGGCAGG + Intronic
1146655493 17:34632378-34632400 CTCCAGGGTGAGGGCCTCTCAGG - Intronic
1147429995 17:40364944-40364966 CTCCAGACTGAGGGTCTGTCTGG - Intergenic
1147699932 17:42387742-42387764 CTGCAGCCTTACGGGCTGGCTGG - Intronic
1148151005 17:45396412-45396434 CTCCAGCCTGCGGTCCTGGCAGG + Intronic
1148153216 17:45408677-45408699 TTCCAGGCTGAGGGAATGGCTGG - Intronic
1148160456 17:45447068-45447090 CTCCTGGCATAGGGCCTGGCAGG + Intronic
1148241827 17:46004218-46004240 CTGCAGGCTTGGGGCCAGGGAGG + Intronic
1150788821 17:68183996-68184018 CTCCTGGCACAGGGCCTGGCAGG + Intergenic
1150820533 17:68430877-68430899 CTGCAGGATTAGGTCCTGGTGGG + Intronic
1151605050 17:75130706-75130728 CTCCAGGCCTCTGGCCTGCCCGG - Intronic
1152713197 17:81885192-81885214 CTCCGGGCACAGGGCCTTGCAGG - Intergenic
1152743829 17:82030297-82030319 CCCCAGCCTTCGTGCCTGGCAGG + Exonic
1152889973 17:82874666-82874688 CTCCAGGCATCCGGCCGGGCGGG + Intronic
1153305082 18:3623866-3623888 CTCCAGCCTTAGGATGTGGCCGG + Intronic
1155367535 18:25063558-25063580 GTCCACCCTCAGGGCCTGGCTGG - Intronic
1157782755 18:50454584-50454606 CACAAAGCTGAGGGCCTGGCTGG + Intergenic
1158231159 18:55256965-55256987 TTCCAGGTATAGGACCTGGCTGG + Intronic
1158400470 18:57116925-57116947 ATCCAGGCCTGAGGCCTGGCTGG - Intergenic
1160475845 18:79186994-79187016 CTCCAGCTTTAGGGCTTGGGTGG + Intronic
1160726336 19:619380-619402 CCCAAGGCCTAGGGCCTAGCAGG + Intronic
1160785315 19:897674-897696 CTGCGGGCTTAGGGCCAGCCAGG - Intronic
1162007656 19:7790267-7790289 CTCCATGCTTAGGGATGGGCAGG + Intergenic
1162338071 19:10073814-10073836 CTACAGGCTAAGGCTCTGGCAGG + Intergenic
1162567366 19:11451709-11451731 CTCCAGGGAGGGGGCCTGGCTGG + Exonic
1163034625 19:14563676-14563698 GTCCAGGCGGAGGGACTGGCGGG - Exonic
1163290923 19:16378454-16378476 CTCCTTGCTCAGAGCCTGGCTGG + Intronic
1163534964 19:17871867-17871889 CTCCAGACCTAGGGGCGGGCAGG - Intergenic
1163943430 19:20515338-20515360 TCCCTGGCTTAGGGACTGGCAGG + Intergenic
1164694609 19:30233948-30233970 CACCAGGCTTGGGGGCTGGTAGG + Intronic
1166394179 19:42426717-42426739 CTCCTGGCCCAGGCCCTGGCTGG + Exonic
1167159424 19:47757301-47757323 CGCAGGGCTTATGGCCTGGCCGG + Intergenic
1167159436 19:47757346-47757368 CACAGGGCTTATGGCCTGGCCGG + Intergenic
1167470013 19:49670367-49670389 CTCCATGGCTAGGGCCAGGCGGG - Exonic
1167493600 19:49805672-49805694 CTTCAGGGTGAGGGCCTGGGGGG - Exonic
1202636215 1_KI270706v1_random:46877-46899 CTCAAGGGTTAGGTGCTGGCAGG + Intergenic
925057228 2:864699-864721 CCCCAGGCTTTGGAGCTGGCTGG - Intergenic
925259966 2:2520581-2520603 CTGCAGGCTGAGCGCCTGCCGGG - Intergenic
925978106 2:9155244-9155266 CTCCAGGGCTAGGGCCAGCCTGG - Intergenic
926143893 2:10385211-10385233 CTCCAGGCCCAGGGGCTGGGAGG - Intronic
926384954 2:12326897-12326919 CTCCAGGCAGAGGGAATGGCAGG + Intergenic
927092083 2:19719803-19719825 CTCAAGGCTTTGGGCCAGACAGG + Intergenic
927201333 2:20579723-20579745 CTCCAGGACCAGGGCCTGGCTGG + Intronic
927245761 2:20956087-20956109 GTCCAGGCTGGGGGACTGGCAGG + Intergenic
927694782 2:25232311-25232333 CTCCAGGGTGAGGGCCCGACGGG - Exonic
927946402 2:27137586-27137608 CTCCACGACTGGGGCCTGGCCGG + Exonic
931693993 2:64858692-64858714 ATCCAGGGTGAGGGCCTGGTGGG + Intergenic
932400646 2:71478919-71478941 CTCCAGGCTCTGAACCTGGCAGG + Intronic
932740840 2:74290113-74290135 TTCCAGACTTAGGGAATGGCAGG - Intronic
934719009 2:96559995-96560017 CTCCAGGCTTGGTGCTAGGCAGG + Intergenic
936398900 2:112151070-112151092 CTCCAGGCAGAGGGCCCAGCCGG + Intronic
936981418 2:118268863-118268885 CTCCAGACTGAGGGCATGTCAGG + Intergenic
942102912 2:172603716-172603738 CTCCAGGGTTAGATCCAGGCAGG + Intronic
943354655 2:186836973-186836995 TTCCAAGCTTAGAGCCTTGCTGG - Intronic
943805474 2:192120088-192120110 GTCAAGGCTCAGGGCTTGGCTGG + Intronic
946365660 2:219247513-219247535 CTGCAGGGTCAGAGCCTGGCGGG - Exonic
946823056 2:223649499-223649521 CACCAGGCATAGTGCATGGCCGG - Intergenic
947800462 2:232926463-232926485 CTCCAGGAATATGGCCTGGAAGG - Intronic
947898658 2:233700070-233700092 CTCCAGGCTGGGGGCCTTGCTGG - Intronic
948851661 2:240711316-240711338 CTCCTGGCTGGGGGCCTGGCGGG + Intergenic
948883812 2:240873256-240873278 ATCCAGGCGTGGGGACTGGCAGG + Intronic
1169082202 20:2804595-2804617 CTGCAGGCTAAGGGCCTCGAGGG - Intergenic
1169194659 20:3676719-3676741 CCCCAGGCTAAGGGAATGGCAGG - Intronic
1169275193 20:4228971-4228993 CTACAGGTTGAGGGCCTGGGAGG - Intronic
1170642217 20:18164443-18164465 CATCAGGCTTAGAGCCTGGGGGG - Intronic
1172211490 20:33201821-33201843 CTCCAAGCTTGGGGCCTCTCTGG + Intergenic
1173454622 20:43192199-43192221 TTCCAGGCAGAGGGACTGGCCGG - Intergenic
1173654747 20:44691858-44691880 GTTCAGGCTGAGGGCCTGACTGG + Intergenic
1173907347 20:46638619-46638641 CTGGAGGCAGAGGGCCTGGCAGG - Intronic
1174598299 20:51702525-51702547 AGCCAAGCCTAGGGCCTGGCTGG - Intronic
1175758973 20:61548301-61548323 CTCCAGGCTGAGGCTCGGGCAGG + Intronic
1175802322 20:61807879-61807901 CAGCAGGCTGTGGGCCTGGCGGG + Intronic
1176272106 20:64240620-64240642 CTCCAGGCTTGGGGCCGTGGTGG + Exonic
1178396619 21:32248901-32248923 TTCAAGGCTTAGGGCTTTGCAGG + Intergenic
1178494633 21:33076359-33076381 CTCCAGGTACAGGGCCTGTCAGG - Intergenic
1179101228 21:38357095-38357117 CTCCCAGATAAGGGCCTGGCAGG - Intergenic
1179185056 21:39079278-39079300 CTCAGGTCTTGGGGCCTGGCAGG + Intergenic
1179517724 21:41920196-41920218 CTCCTGGATTTGGGCCTGGCCGG + Intronic
1180676045 22:17587246-17587268 CTCCGCACTCAGGGCCTGGCTGG + Exonic
1181366025 22:22377631-22377653 CTCCAGCCTGAGGACCTGGCTGG + Intergenic
1181437015 22:22917026-22917048 CTCCAGGCTTTGGGACTAGGGGG + Intergenic
1183421474 22:37714029-37714051 CTCCATGCTAAGGGCTTGGTGGG + Intronic
1183427596 22:37747691-37747713 CACCCGGCTGAGGGCCGGGCAGG - Intronic
1184019152 22:41808967-41808989 CTCCAGGCTTGGGTCCAGGGAGG - Exonic
1184644671 22:45889481-45889503 CTCCAGCCTCGGGGCCAGGCTGG + Intergenic
1184668345 22:46000261-46000283 GTACGGGCTGAGGGCCTGGCAGG - Intergenic
1184765520 22:46570149-46570171 CCCCTAGCCTAGGGCCTGGCGGG + Intergenic
1184783026 22:46658562-46658584 CCCCAGGCCTGGGGGCTGGCAGG - Intronic
1185079584 22:48702308-48702330 CTGCTGGCCCAGGGCCTGGCTGG + Intronic
1185297483 22:50061530-50061552 TTCCATGCTTGGGGCCAGGCTGG + Exonic
950050586 3:9986057-9986079 TTCCAGGCGTCGGGCCTGGTGGG - Intronic
950179729 3:10902695-10902717 CTCCATGCTTTGAGCCTTGCAGG - Intronic
950411941 3:12844317-12844339 CTCCATGCCCAGGGCCTGGCTGG + Intronic
950431868 3:12955492-12955514 CACCAGGCAGAGGCCCTGGCTGG - Intronic
953866241 3:46585517-46585539 CTCCTGGCTTAGTGTCTGTCTGG - Intronic
954422545 3:50426267-50426289 CACAAGGCCTAGGGCCAGGCTGG + Intronic
954608993 3:51934333-51934355 CTCCTAGCACAGGGCCTGGCAGG - Intronic
954631913 3:52052383-52052405 CTCCAGACTCAGGGACTGACAGG + Intronic
955094791 3:55786763-55786785 CTCCAGGTTTTGGCCATGGCTGG + Intronic
961681903 3:128604989-128605011 CTCCAGGCATAGGGCCACGAAGG - Intergenic
963189245 3:142451055-142451077 CTCCAGGAAAATGGCCTGGCTGG + Intronic
966855332 3:184189752-184189774 ATCCAGGTGTGGGGCCTGGCAGG + Exonic
967964610 3:194951201-194951223 CTCCAGGCTGAGCACCTGGGTGG - Intergenic
969403101 4:6970129-6970151 CTCTAGGCTTCGGCCCTGACTGG - Intronic
969473866 4:7409670-7409692 CTGCAGGCTCAGTGCCAGGCAGG + Intronic
971174316 4:24266191-24266213 CTGCTGGCTTGTGGCCTGGCTGG + Intergenic
982067907 4:151670995-151671017 CTCCAGGCACAGGGCCTAGAGGG + Exonic
982086916 4:151844934-151844956 CTCCCGCCTTAGGTCCTGGCTGG - Intergenic
1202763529 4_GL000008v2_random:132744-132766 CTCAAGGGTTAGGTGCTGGCAGG + Intergenic
985778393 5:1857162-1857184 CTCCAGGGCCAGGGCCAGGCAGG - Intergenic
986753529 5:10812226-10812248 CTCCAGCCTGAGGCACTGGCGGG - Intergenic
986892895 5:12331062-12331084 CTCCACTCTTAGAGCCTGGCTGG + Intergenic
988836343 5:35036159-35036181 CTCCAGACTCAGGGACTGGAAGG + Intronic
990454676 5:55973537-55973559 CTGCAGGCTGAGGGCTTTGCTGG - Intronic
992150157 5:73894921-73894943 TTCCAGGCGTAGGGAATGGCCGG + Intronic
993590566 5:89790372-89790394 CTCCAGCCTTGTGGCTTGGCAGG + Intergenic
997254380 5:132417194-132417216 TTTCAGGCTCAGGCCCTGGCTGG - Intronic
998129363 5:139643531-139643553 CTTCAGGCTTTGGGTCGGGCAGG + Intergenic
999430443 5:151521206-151521228 CTCCATGCTTAGAGTCAGGCGGG + Intronic
1001253161 5:170164159-170164181 CTCAAGTCTTAAGGCCTTGCAGG - Intergenic
1001261556 5:170233542-170233564 CTGCGGGCTGAGGGCCTGGGCGG + Exonic
1002132525 5:177090393-177090415 CTCCAGGCTGGGAGCCAGGCAGG - Exonic
1006030108 6:31171885-31171907 CTCCAGCCCTAGGCCCTGGGTGG + Intronic
1006627411 6:35407074-35407096 CTCCAGGATTTGGTCCTGACAGG + Intronic
1007720339 6:43881397-43881419 TACAAGGCTTTGGGCCTGGCTGG - Intergenic
1011762843 6:90586960-90586982 CTCCAGGCTGAGGGTCGGTCCGG - Exonic
1016354689 6:143205214-143205236 CTCCAGCCTTAGTTCATGGCTGG - Intronic
1017959475 6:159209248-159209270 CTCCAGGCTTCTGGGCTGGGGGG + Intronic
1018933829 6:168260536-168260558 CTTCAGGCTTAGGTCCTGGGGGG + Intergenic
1018994353 6:168699934-168699956 ATCCAGGCTGGGCGCCTGGCAGG - Intergenic
1019303798 7:322786-322808 CCCCAGGCCTGGGGCCTTGCTGG + Intergenic
1019538159 7:1539430-1539452 TCCCAGGCTGAGGGCGTGGCAGG + Intronic
1020005924 7:4783777-4783799 CTCCACGCCCAGGGCCCGGCAGG + Exonic
1024201974 7:47117227-47117249 CTCCAGGTGTAAGGCCTGGGGGG - Intergenic
1024633771 7:51269854-51269876 CTCCAGACTGAGGACGTGGCAGG + Intronic
1025301069 7:57820005-57820027 CCGCAGGCTCAGGGCTTGGCTGG + Intergenic
1025941387 7:66078186-66078208 CTCCTGGCTGAGGGGCAGGCTGG + Intronic
1026602931 7:71791601-71791623 TTCTAGGCTTAGTGCCTGGGTGG + Intronic
1026904127 7:74053169-74053191 CTGCAGGCTTAGTGCCTGGTGGG + Exonic
1026995394 7:74612637-74612659 CTCCAGGCCTTTTGCCTGGCTGG + Intergenic
1027258343 7:76445543-76445565 CTCCAGGCTTGGGGTCCGACGGG + Intergenic
1027280507 7:76606475-76606497 CTCCAGGCTTGGGGTCCGACGGG - Intergenic
1028161957 7:87496242-87496264 CTTCAGGCTCAGGTCCTGCCTGG + Intergenic
1029107684 7:98191868-98191890 CTCGAAGCTCAGGCCCTGGCTGG - Exonic
1029954242 7:104620879-104620901 CTCCAGCCTTACGGCCTTGAAGG - Intronic
1032463959 7:132131909-132131931 CTCCAGGCCTTGGGCCTGCTGGG + Intronic
1032513950 7:132493280-132493302 CCCCAGGCCTAGGGCATGGCTGG - Intronic
1038046438 8:23769125-23769147 CTCCAGGCATGGGGTGTGGCAGG - Intergenic
1039494298 8:37969151-37969173 CTCCAGGGCTATGCCCTGGCAGG + Intergenic
1039790186 8:40869453-40869475 ATCCAGCCATAGTGCCTGGCAGG - Intronic
1039891192 8:41686633-41686655 CTCCTGGCTCAGGGACTTGCTGG - Intronic
1041620614 8:59963850-59963872 CCACAGTCTCAGGGCCTGGCAGG - Intergenic
1043516767 8:81001860-81001882 CTCCAGGCGTCTGGCCTGTCTGG + Intronic
1046497370 8:115033206-115033228 CTCCAGGCTAGGCGACTGGCTGG - Intergenic
1047209095 8:122826321-122826343 TGCCAGGCTGAGGGCATGGCAGG - Intronic
1049418007 8:142504332-142504354 CTCCAGGCCCTGGTCCTGGCTGG - Intronic
1049658919 8:143811066-143811088 CTGCAGGCTGCGGGCCGGGCGGG + Exonic
1049671760 8:143873129-143873151 CTCCTGGCCTGGGGCCTGGGGGG + Exonic
1057049950 9:91915972-91915994 TTCCTGGCTTAGGCTCTGGCAGG + Intronic
1057207720 9:93183763-93183785 CACCAGGCTTAGCCCCAGGCTGG + Intergenic
1058576956 9:106414055-106414077 ATGCAGGCTTTGGGCCTGTCAGG + Intergenic
1061114921 9:128604029-128604051 CTCCTAGCCTGGGGCCTGGCAGG - Intronic
1061247141 9:129406312-129406334 CCTCAGGCTGAGGGCCTTGCGGG + Intergenic
1061747852 9:132753321-132753343 CTGCAGGATGTGGGCCTGGCTGG + Intronic
1062338212 9:136081821-136081843 CACCAGGCTGAGGGCAAGGCGGG + Intronic
1062517763 9:136944694-136944716 CTCGTGGCGTCGGGCCTGGCGGG - Intronic
1203544284 Un_KI270743v1:117617-117639 CTCAAGGGTTAGGTGCTGGCAGG + Intergenic
1185775004 X:2794801-2794823 CTCCAGGCTGGGGGACTGGATGG + Intronic
1186739858 X:12505831-12505853 CTACAGGATAAGGGCTTGGCAGG - Intronic
1189337585 X:40179651-40179673 CCCCACGCTTAGGCCCAGGCTGG - Intergenic
1197710417 X:129662655-129662677 GGCCAGGCTTAGGACCTAGCTGG - Intergenic
1199855163 X:151753713-151753735 CTGCAGGCACAGGGCATGGCAGG + Intergenic
1200096831 X:153668536-153668558 CTCCAGGCTTTGGGCCCCACAGG - Intergenic
1200108051 X:153725278-153725300 CTCCAGGCCCCGGCCCTGGCGGG + Exonic
1200122856 X:153799353-153799375 CTCCAGGCGTGGTGCCAGGCCGG - Intergenic
1201147565 Y:11073205-11073227 CTCCATGTTGAGGGCGTGGCGGG - Intergenic