ID: 920399498

View in Genome Browser
Species Human (GRCh38)
Location 1:205668316-205668338
Sequence CAGGGAAGGCGGCCCTGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 625
Summary {0: 1, 1: 0, 2: 3, 3: 72, 4: 549}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920399498_920399508 17 Left 920399498 1:205668316-205668338 CCGCTCCAGGGCCGCCTTCCCTG 0: 1
1: 0
2: 3
3: 72
4: 549
Right 920399508 1:205668356-205668378 CCCAGCCTTTCTCAGTTGTCAGG 0: 1
1: 0
2: 0
3: 17
4: 212
920399498_920399504 -8 Left 920399498 1:205668316-205668338 CCGCTCCAGGGCCGCCTTCCCTG 0: 1
1: 0
2: 3
3: 72
4: 549
Right 920399504 1:205668331-205668353 CTTCCCTGGAGCACAAACGGAGG 0: 1
1: 0
2: 0
3: 9
4: 125
920399498_920399511 23 Left 920399498 1:205668316-205668338 CCGCTCCAGGGCCGCCTTCCCTG 0: 1
1: 0
2: 3
3: 72
4: 549
Right 920399511 1:205668362-205668384 CTTTCTCAGTTGTCAGGCTCAGG 0: 1
1: 0
2: 4
3: 110
4: 281
920399498_920399513 27 Left 920399498 1:205668316-205668338 CCGCTCCAGGGCCGCCTTCCCTG 0: 1
1: 0
2: 3
3: 72
4: 549
Right 920399513 1:205668366-205668388 CTCAGTTGTCAGGCTCAGGGAGG 0: 1
1: 0
2: 2
3: 17
4: 161
920399498_920399512 24 Left 920399498 1:205668316-205668338 CCGCTCCAGGGCCGCCTTCCCTG 0: 1
1: 0
2: 3
3: 72
4: 549
Right 920399512 1:205668363-205668385 TTTCTCAGTTGTCAGGCTCAGGG 0: 1
1: 0
2: 1
3: 24
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920399498 Original CRISPR CAGGGAAGGCGGCCCTGGAG CGG (reversed) Intronic
900135444 1:1115484-1115506 CAGGGAGGGGGTCCCTGGGGAGG - Intronic
900366160 1:2312787-2312809 GAGGGCAGGCGGCCCTGGCCTGG - Intergenic
900396658 1:2455804-2455826 CGGGGAGGGAGGCCCTGCAGGGG - Intronic
900573301 1:3370653-3370675 CAGGGCAGGCTTCCCAGGAGAGG + Intronic
900604722 1:3518866-3518888 CAGGGCAGGCCCGCCTGGAGGGG - Intronic
900624048 1:3600133-3600155 CAGGGAAGGCAGCCCGGGCTGGG - Intronic
900674837 1:3878690-3878712 CAGCGAGGCCGGCCCGGGAGAGG - Intronic
900772164 1:4553938-4553960 CAGGGAAGGCAGCCCCAGTGTGG - Intergenic
900952957 1:5868266-5868288 CAGGCCAGGAGGTCCTGGAGTGG + Intronic
901040386 1:6359744-6359766 CTGGGAAAGCAGCCCTGGTGGGG - Intronic
901154805 1:7128369-7128391 CAGGGAAGGCCTCCCTGCTGAGG + Intronic
901201912 1:7471917-7471939 CAGGGAAGTCTGGCCTGGAATGG - Intronic
901204133 1:7484211-7484233 GAGGGAAGGCGGACCTGAGGTGG - Intronic
901612510 1:10510024-10510046 CAGGGAAGGCAGCCCAGGGATGG + Intronic
901632104 1:10653071-10653093 CAGGGAGGGGGGACCTGCAGTGG + Intronic
901872904 1:12148580-12148602 CAAGGAAGGAGGCCCTGGCTGGG - Intergenic
902397132 1:16138505-16138527 CAGGGCAGGGGTCCCTGGTGAGG - Intronic
902722295 1:18311987-18312009 CAGGGAAGGCCTCTCTGGGGAGG - Intronic
902879324 1:19360528-19360550 CAGGTCAGGATGCCCTGGAGGGG + Intronic
903127454 1:21257641-21257663 CAGGGCAGGAGGCCGTGCAGTGG - Intronic
903275054 1:22216286-22216308 CGGGGAAGCTGGCCCTGGTGCGG + Intergenic
904129500 1:28265207-28265229 CAGGGAGGGCTGACTTGGAGGGG + Intronic
904353669 1:29924793-29924815 CAGGGAAGGCTTCCCAGGAGAGG + Intergenic
904494156 1:30877392-30877414 CAAGGAAGGCTTCCCGGGAGAGG - Intronic
904673725 1:32184626-32184648 CAGGGAAGGTGCCCGCGGAGGGG - Intronic
904702887 1:32368589-32368611 CAGGGAAGGGGCACCTGAAGAGG + Intronic
904772147 1:32886467-32886489 CAGGGAAGGCGGCGCTGCTGCGG - Exonic
904994789 1:34623009-34623031 CAGGGAAGGCTTCCTGGGAGAGG - Intergenic
905794382 1:40807423-40807445 CAGTGGCGGCGGCCCTGGTGTGG + Intronic
905906019 1:41619017-41619039 CTGTGGAGGCTGCCCTGGAGGGG - Intronic
906283924 1:44573487-44573509 CATGGAAAGCAGACCTGGAGTGG + Intronic
907220954 1:52906600-52906622 CAGGGAAGGCTGCTGTGGAGAGG + Exonic
907263445 1:53239018-53239040 CAGGGAAGGCGTCACTGAGGAGG - Intergenic
907309826 1:53532879-53532901 AAGGGAAGGAGTCCCAGGAGGGG - Intronic
907514482 1:54984779-54984801 CAGAGAAGGCTTCCCTGGTGAGG + Intronic
907934571 1:59030878-59030900 CAGGGAAGCCTTCCCTGAAGAGG + Intergenic
907937417 1:59055167-59055189 CAGGGAAGGCTTCTCTGAAGAGG + Intergenic
908370034 1:63472480-63472502 CATGGAAGGAGACCGTGGAGAGG - Intronic
908415999 1:63913919-63913941 TAGGGAAGGCTCCCCGGGAGAGG - Intronic
911439719 1:97910059-97910081 CAGAGAAGGCCTCCCTGTAGAGG - Intronic
911449376 1:98045268-98045290 CAGGGAAGACAGCGCTGAAGAGG + Intergenic
912531175 1:110323825-110323847 CAGGGAAGGCTGCTCTGAGGAGG + Intergenic
912708621 1:111933549-111933571 CAGGGGAGGCTGCTCTGGGGAGG + Intronic
914804766 1:150983884-150983906 GAGGGAAGGCGCTCCAGGAGAGG - Intronic
915083675 1:153369726-153369748 CAGGGAAGGGAGTCCTGGAATGG - Intergenic
915519892 1:156436080-156436102 CAGGGAAGGGGGCCCTAGACGGG + Intergenic
915549831 1:156625493-156625515 CTGGGAAGGCAGGTCTGGAGAGG - Exonic
916676543 1:167068685-167068707 CAGAGAAGGCCGACTTGGAGTGG - Intronic
918210208 1:182343698-182343720 CATGGAATGCTGCCCAGGAGAGG + Intergenic
919685513 1:200479875-200479897 CTGGGAAGATGGCCATGGAGAGG - Intergenic
919845730 1:201641015-201641037 CAGGGAAGGCGGCCTAGAGGAGG + Intronic
920119369 1:203644353-203644375 CAGGGAGGGTGGCCCTGGGAAGG - Intronic
920302478 1:204997434-204997456 CTGGGGAGGCGGGCCAGGAGGGG - Intronic
920398157 1:205661165-205661187 AAGGAAAGGGGCCCCTGGAGGGG + Intronic
920399498 1:205668316-205668338 CAGGGAAGGCGGCCCTGGAGCGG - Intronic
920844087 1:209578873-209578895 CAGGGAAGGATGCTCAGGAGAGG + Intergenic
922706976 1:227795223-227795245 GAGGGAAGGCGGGGCTGGGGGGG - Intergenic
924155995 1:241177225-241177247 CAAGGAAGGCCTCCCTGAAGAGG + Intronic
924422160 1:243919550-243919572 CACAGACGGCGGCCCTGGTGGGG + Intergenic
1063025280 10:2172196-2172218 CAGGGAAGGCTTCCCAGAAGAGG + Intergenic
1063112001 10:3046024-3046046 GGGGGAGGGCAGCCCTGGAGCGG + Intergenic
1063362176 10:5467838-5467860 CAGGGAAGGCTGCCTGGGAAAGG - Intergenic
1063527049 10:6796232-6796254 CAGGGGAGGTGGCCCTGAATGGG - Intergenic
1064251166 10:13707482-13707504 CAGGGAAGGCGGCGGGTGAGGGG + Intronic
1065189453 10:23196634-23196656 CGGGGGAGGGAGCCCTGGAGTGG + Intergenic
1065366838 10:24945104-24945126 CAGGGAAGGCGTCTTTGCAGAGG - Intronic
1067208302 10:44238299-44238321 CTGGGCAGGCAGCCTTGGAGGGG + Intergenic
1067497824 10:46775114-46775136 CAGGGAGGGCGGCCCGAGCGCGG - Intergenic
1067572385 10:47380974-47380996 ATGGGAAGGCTGCCATGGAGTGG - Intronic
1067596825 10:47565300-47565322 CAGGGAGGGCGGCCCGAGCGCGG + Intergenic
1067836800 10:49646447-49646469 GAGGGAAGACTGGCCTGGAGCGG + Intronic
1069828699 10:71269862-71269884 CAGGGAAGGCCTCACTGGAGAGG + Intronic
1070771191 10:79083227-79083249 CAGGGAAGGCTTCTCTGAAGAGG + Intronic
1070916715 10:80159793-80159815 CATGGGAGTGGGCCCTGGAGGGG - Intronic
1071464299 10:85925480-85925502 CAGGGGACACGGCCCTGGGGTGG + Intronic
1071497862 10:86180919-86180941 CAGGGAAGGCTAACCTGGAGGGG + Intronic
1071521264 10:86332628-86332650 CAGGGAAGGAAGCCCCAGAGGGG - Intronic
1072370111 10:94757697-94757719 CAGGAAAACAGGCCCTGGAGTGG - Intronic
1072539024 10:96384450-96384472 CAGGTATGGCTGCCTTGGAGGGG - Intronic
1073380130 10:103072081-103072103 AAGGGAGGGCGGCTCTGGTGTGG + Intronic
1074182521 10:111077087-111077109 CGGGGAAGAAGGCGCTGGAGTGG - Intergenic
1074436487 10:113438700-113438722 AAGGAAAGGCAGCCCTGCAGGGG + Intergenic
1074918583 10:117983343-117983365 CAGGAAAGGCCTCTCTGGAGAGG - Intergenic
1076166581 10:128286971-128286993 CAGGGAGGGCGCCCCTGGCCGGG - Intergenic
1076434825 10:130433141-130433163 CAGAGCAGGCGGGCCAGGAGAGG + Intergenic
1076570041 10:131426519-131426541 CAGGGAAGGCATCCCTGTTGTGG + Intergenic
1076630745 10:131850488-131850510 TGGAGAAGGCGGCCCTGGGGTGG - Intergenic
1076653440 10:132005590-132005612 CAGGGAAGGAGGCTCAGAAGTGG - Intergenic
1076654890 10:132017739-132017761 CAGGGAAGGAGCCCCAGAAGTGG - Intergenic
1076654955 10:132017943-132017965 CAGGGAAGGAGCCCCAGAAGTGG - Intergenic
1076693622 10:132236544-132236566 CCAGGAAGGCAGCCCAGGAGGGG + Intronic
1076736903 10:132463039-132463061 CTGGGAGAGAGGCCCTGGAGTGG + Intergenic
1076859464 10:133133764-133133786 CAGGGCAGGCGGAGCAGGAGGGG + Intergenic
1077336968 11:2009725-2009747 ACGAGAAGGCAGCCCTGGAGAGG - Intergenic
1077533539 11:3108214-3108236 CAGGGGAGGCAGCCCTGCAGAGG + Intronic
1077590929 11:3490492-3490514 CAGGGAAGAAGGCCATGGATTGG + Intergenic
1078042743 11:7883823-7883845 CAGCAGAGGAGGCCCTGGAGAGG + Intergenic
1078266531 11:9759277-9759299 ATGGGAAGTGGGCCCTGGAGCGG + Intergenic
1078470480 11:11582104-11582126 TAGGGAAAGCCTCCCTGGAGAGG + Intronic
1078541999 11:12220382-12220404 CAGAGAACGCGGCCCTGGTGCGG + Exonic
1079327722 11:19508586-19508608 CAGGGAAGGCTTCCCTGAAGAGG - Intronic
1079516259 11:21272782-21272804 CAGGCAAAGAGGGCCTGGAGGGG + Intronic
1080073967 11:28126191-28126213 CAGGGAAGGCATCCCTGAAAAGG - Intronic
1080578004 11:33617548-33617570 CAGGGAAGGCCTCTCTGGGGAGG - Intronic
1081578546 11:44334912-44334934 CTGGAAAAGCGGCCCTGGATGGG - Intergenic
1081700608 11:45150230-45150252 CAGGGAGGGCTTCCCTGAAGAGG - Intronic
1081869433 11:46376618-46376640 CAGGGAAGGCGTCCCAGGAGAGG - Intronic
1081905788 11:46668827-46668849 GAGTGCAGGCTGCCCTGGAGAGG - Exonic
1082001182 11:47394520-47394542 AGAGGAAGGCGGGCCTGGAGCGG + Intergenic
1083596417 11:63920002-63920024 CAGGGAAGCCGGCCCTAGCCAGG + Intergenic
1083653626 11:64218809-64218831 CAGGGAAGGCTTCCCTGAGGAGG - Intronic
1083858312 11:65404816-65404838 CATGGAAGGGGGCCCTGGCCAGG + Intronic
1083894797 11:65614391-65614413 CCGGGTAGGCGGGCCAGGAGAGG + Intronic
1084129412 11:67121260-67121282 AGAGGAAGGCAGCCCTGGAGTGG + Exonic
1084246648 11:67862242-67862264 CAGGGAAGAAGGCCATGGATTGG + Intergenic
1084398569 11:68930794-68930816 CAGCAGAGGAGGCCCTGGAGAGG + Intronic
1084559283 11:69893679-69893701 CAGGGAAGGAGCCCCTGGCCTGG - Intergenic
1084826031 11:71732249-71732271 CAGGGAAGAAGGCCATGGATTGG - Intergenic
1085345829 11:75767733-75767755 CAGGGCTGGGGGCCCTGGAGTGG - Intronic
1085399524 11:76227354-76227376 CTGAGAAGGGGGCCCTTGAGAGG - Intergenic
1085418814 11:76337995-76338017 CAGGAAAGCCTTCCCTGGAGTGG - Intergenic
1085512382 11:77095018-77095040 CAGGGATGCCCACCCTGGAGTGG - Intronic
1088704238 11:112447611-112447633 GTGGAAAGGAGGCCCTGGAGAGG + Intergenic
1089500578 11:118929321-118929343 CGGGGAAGGCGGCAGTGGTGAGG - Intronic
1089589349 11:119530560-119530582 CAGGGTAGGGGGCCCTGCACTGG - Intergenic
1091001090 11:131911196-131911218 CCGGGAAGGTGGCCGAGGAGGGG - Intronic
1202819952 11_KI270721v1_random:64907-64929 ACGAGAAGGCAGCCCTGGAGAGG - Intergenic
1091387459 12:103853-103875 GAGGGGAGGCGGCTCGGGAGGGG + Intronic
1091398571 12:169399-169421 GAGGGAAGGCCTCCCTGCAGGGG - Intronic
1091600692 12:1916001-1916023 AAGGGAAGGCTTCCCTGGGGAGG + Intronic
1091760487 12:3084169-3084191 CAGGGAAGAGGGCCCCGTAGGGG - Intronic
1092053419 12:5489694-5489716 TAGGGAAGCTGGTCCTGGAGAGG + Intronic
1092056607 12:5512810-5512832 CAGAGAAGGCATCCTTGGAGAGG - Intronic
1092081459 12:5719872-5719894 AAGGGAAGGCAGCCCAGAAGGGG - Intronic
1092288221 12:7142279-7142301 CAGGGCAGGGGCTCCTGGAGTGG + Intronic
1096111560 12:49031929-49031951 CAGCCCAGGAGGCCCTGGAGGGG + Exonic
1096198300 12:49663303-49663325 CAGGGAAAGAGGAGCTGGAGAGG + Intronic
1096459536 12:51814578-51814600 CAGGGTAGCCGGGCCTGGAGAGG - Intergenic
1097130300 12:56806461-56806483 AAGGGAGGCCGGCCCTGGACCGG + Intergenic
1097190620 12:57217690-57217712 CAGGGAAAGAGGCCTTGGAGTGG - Intronic
1098823260 12:75260274-75260296 CATAGAAGGCAGCCCTGGATGGG - Intergenic
1098959010 12:76719022-76719044 CAAGGAAGGAGGCACTGAAGAGG + Intergenic
1101583018 12:106060644-106060666 CAGGGAAGGCATCTCTGAAGAGG - Intergenic
1101707402 12:107233266-107233288 CAGGGAATGCCACCCTGGGGAGG - Intergenic
1101755815 12:107619944-107619966 CAGGGAAGGTGGCAGGGGAGGGG - Intronic
1101838003 12:108308540-108308562 CAGTGATGGGAGCCCTGGAGGGG - Intronic
1102198647 12:111042302-111042324 CAGGGAAATCTGCCCTGGACTGG - Intronic
1102248305 12:111368892-111368914 GAGGTAAGGCGGGCCTGGCGGGG - Exonic
1102255963 12:111415168-111415190 CAGGGAGGGAGTCACTGGAGTGG + Intronic
1102580049 12:113880658-113880680 CAGGGAAGGTTTCCCTGGAAAGG - Intronic
1102956711 12:117063641-117063663 CAGTGCAGGGAGCCCTGGAGCGG - Intronic
1103716846 12:122950024-122950046 CAGGGATGCCAGCCCTGGAGTGG - Intronic
1103897487 12:124282965-124282987 CAGGGAAGGCTTCCCTGAGGAGG + Intronic
1104595950 12:130120103-130120125 CAGGGAGGGCGCAGCTGGAGAGG - Intergenic
1104977518 12:132558865-132558887 CAGGGAGGCCGGCTCTGGTGCGG - Intronic
1105019070 12:132804527-132804549 CAGGGAAGGAGGGCGTGGCGGGG + Intronic
1105437474 13:20390935-20390957 CAGGCCAGGCAGCCCTGGAAAGG + Intergenic
1106079459 13:26488223-26488245 CAGGGAAGGAGGCCATATAGAGG + Intergenic
1106145851 13:27049182-27049204 CAGGGAAGGCCTCTCTGAAGAGG - Intergenic
1106599559 13:31175924-31175946 CTGGTAAAGTGGCCCTGGAGGGG + Intergenic
1107011176 13:35673120-35673142 CAGGGACCGAGGACCTGGAGAGG + Intergenic
1108322267 13:49300770-49300792 AAAGGATGGGGGCCCTGGAGAGG - Intergenic
1108690072 13:52851534-52851556 CCGGGGAGGTGGCGCTGGAGAGG + Intergenic
1111274916 13:85935875-85935897 CAGGAGAGGAGTCCCTGGAGAGG - Intergenic
1112159052 13:96849399-96849421 GAGGGAAGGAGGCACTGGAACGG + Intergenic
1112460576 13:99600393-99600415 CAGGGAAGGGGGCTCCGGAGAGG + Intergenic
1113632747 13:111899298-111899320 CAGGGATGGCAGCAGTGGAGGGG - Intergenic
1113632793 13:111899451-111899473 CAGGGACGGTGGCAGTGGAGGGG - Intergenic
1113632835 13:111899594-111899616 CAGGGACGGCGGCAGTGGGGGGG - Intergenic
1113692298 13:112319528-112319550 CAGGGAAGGCTGCTCTGAGGCGG + Intergenic
1113804934 13:113107056-113107078 CAGGGAAGGCCAAGCTGGAGCGG - Intronic
1114402294 14:22420998-22421020 CAGGGAAGGCTTCCCTGAAGAGG - Intergenic
1114499032 14:23154413-23154435 CAGGGAAGCCGGGCCTGTGGGGG + Intronic
1114539214 14:23442574-23442596 CAGGAAAGGGGTCCATGGAGAGG + Intergenic
1114633239 14:24172795-24172817 AAGGGAAGGAGGGCCTGGTGCGG + Intronic
1115754560 14:36518862-36518884 CAGGGAGGGCGGCCCGGCAGCGG - Intronic
1117753466 14:58947969-58947991 CAGGTCAAGCGGCACTGGAGGGG - Intergenic
1118592528 14:67412081-67412103 CGGGGAAGGCGCACCTGGGGTGG - Exonic
1119208418 14:72811890-72811912 CAGGGCACCCAGCCCTGGAGCGG + Intronic
1119267361 14:73270932-73270954 CAGGGTAGGAGGCCTTGGGGTGG + Intronic
1120993622 14:90398331-90398353 GGGGGAAGGCGGCCCCCGAGCGG - Intronic
1121137143 14:91509691-91509713 CCAGGAAAGGGGCCCTGGAGAGG + Exonic
1121220478 14:92281189-92281211 CAGGGCAGGCAGCCCTTGAGAGG - Intergenic
1121781758 14:96626547-96626569 CAAGGAATGCGTCCCTGGAGAGG + Intergenic
1121798339 14:96753945-96753967 CAGGGAAGCATGCCCTTGAGGGG + Intergenic
1122151344 14:99727705-99727727 CAGAGGACACGGCCCTGGAGAGG - Intergenic
1122398273 14:101450702-101450724 CAGGGAACGCGTCCTTGGAGAGG - Intergenic
1122468620 14:101950887-101950909 CAGGGACTGCTGCCCTGGACTGG - Intergenic
1122830497 14:104393351-104393373 CAGGGACGGCGCTCCAGGAGGGG + Intergenic
1122870608 14:104636453-104636475 GAGGGGAAGGGGCCCTGGAGGGG - Intergenic
1122893943 14:104746132-104746154 TAGGCAAGGAGGCCCTGGATGGG + Intronic
1122918845 14:104871345-104871367 GAGGGAAGGGGACCCTGGCGGGG - Intronic
1123039215 14:105483544-105483566 CAGGGAGGTGGGCCCTGGGGAGG + Intergenic
1123112920 14:105881400-105881422 CAGGGCAGGGCGCCCTGGAGGGG + Intergenic
1123117439 14:105901004-105901026 CAGGGTGGGGTGCCCTGGAGGGG + Intergenic
1124220700 15:27847572-27847594 CCGGAAAGGAGGCCCTGGAGAGG + Intronic
1124609832 15:31200923-31200945 GAGGGAAGGCTGTCCTGGAGAGG - Intergenic
1125933904 15:43618325-43618347 CAGGGAATGAGGCCCAGTAGGGG + Exonic
1125947001 15:43717787-43717809 CAGGGAATGAGGCCCAGTAGGGG + Intergenic
1127541024 15:59939082-59939104 CAGGGAAGGAGGCCAAGCAGTGG + Intergenic
1127624953 15:60771274-60771296 CAGGGAAGGCTTCCCTGAGGAGG - Intronic
1127685625 15:61340808-61340830 CAGGGAAGGCGTCTCTAGGGAGG + Intergenic
1128174235 15:65540450-65540472 CAGGGAAGGCTTCCTTGAAGAGG + Intronic
1128997135 15:72305585-72305607 CAGGGAAGGGGACCCTAGGGAGG - Intronic
1129148977 15:73675397-73675419 CAGGGAAGGCCTTCCTGGAAAGG + Intergenic
1129458969 15:75690416-75690438 CAGGGAAGGCAGCCAGAGAGTGG + Exonic
1129724840 15:77896476-77896498 CAGGGAAGGCAGCCAGAGAGTGG - Intergenic
1129888133 15:79052848-79052870 CAGGGAGGGTGGCCATGGAGAGG + Intronic
1130532271 15:84756528-84756550 CAGAGAAGGGGGCCCAGGGGTGG + Intronic
1130912545 15:88281088-88281110 CAGAGAAAGGGGCCATGGAGAGG - Intergenic
1131013918 15:89041926-89041948 CAGGGCAGGAGGGCCTGGAGGGG + Intergenic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1131383420 15:91982901-91982923 CAGGGAAGGCATCCCTGGAGAGG - Intronic
1131813531 15:96199139-96199161 CAGGGAAGGCCTCTCTGGGGAGG - Intergenic
1132206869 15:99992602-99992624 CAGGGCAGGGGGCCATGGGGTGG - Intronic
1132374670 15:101321118-101321140 CAGGTCAGGCAGCCCAGGAGTGG - Intronic
1132589574 16:720804-720826 AAGGGAAGTCTGCCTTGGAGAGG - Intronic
1132689767 16:1177265-1177287 CAGGGGACCCGGCCCTGGAGGGG - Intronic
1132702583 16:1228446-1228468 CAGGGAAGGGGGCTCAGGATGGG + Exonic
1132705744 16:1242422-1242444 CAGGGAAGGGGGCTCAGGATAGG - Exonic
1132840035 16:1974451-1974473 CTGGGAGGGAGGCGCTGGAGCGG - Intronic
1133356305 16:5139525-5139547 CAGGGAAGAAGGCCATGGATCGG + Intergenic
1134451869 16:14368641-14368663 CAGGGAAGGCGTCCCAGGACGGG - Intergenic
1135420587 16:22303209-22303231 CAGGGAAGGCCTCCCTGATGAGG - Intronic
1135635039 16:24068327-24068349 CAGGGAAGGCAGGACTTGAGGGG - Intronic
1135957888 16:26971566-26971588 CAGGGAAGGCCTCTCTGGGGAGG - Intergenic
1136048733 16:27635712-27635734 CATGGATGGCGGGCCTGGCGGGG + Intronic
1136175354 16:28512786-28512808 CTGGGAAGGAGAGCCTGGAGAGG + Intergenic
1136334944 16:29605176-29605198 CAGGGAAGGAGGCACTGGGGGGG + Intergenic
1136392540 16:29974485-29974507 CCGGGAAGCCTCCCCTGGAGGGG - Exonic
1136398872 16:30007125-30007147 CAGGGGAGGGGGCCCTGGGGAGG - Intronic
1137612798 16:49830143-49830165 CAGGGAAGGCCGCGCAGAAGAGG + Intronic
1137710604 16:50564114-50564136 CAAGGAAGGGGGCTCTGGACAGG - Intronic
1138200516 16:55084852-55084874 CAGGAAAGGCCTCCCTGAAGAGG + Intergenic
1139512161 16:67433741-67433763 CAGGCAAGTCTGCCTTGGAGAGG - Intronic
1140442758 16:74999698-74999720 CCGGGAAGGGGCCCCGGGAGCGG - Exonic
1140466900 16:75189873-75189895 CAGGGAAGGGGTCCCAGGTGAGG + Intergenic
1141593312 16:85082729-85082751 CGGGGAGGGCGGCCCTGGGGAGG + Intronic
1141640733 16:85339531-85339553 CAGGGAAGGCGGCAGTGAAAAGG + Intergenic
1142038908 16:87880307-87880329 CAGGGAGGACAGCCCAGGAGAGG + Intergenic
1142287100 16:89175912-89175934 CAGGGAAGGTGGCCATGGTTTGG + Intronic
1142617014 17:1142658-1142680 CAGGGAAGGCTGCCCGGAAGAGG + Intronic
1142811064 17:2395727-2395749 CAGGACAGGCGGCCCTGGAAAGG + Intronic
1143025912 17:3941970-3941992 CAGGGAAGCAGGGCCTGCAGGGG - Intronic
1143211544 17:5191784-5191806 CAGTGATAGCGGCCGTGGAGGGG - Intronic
1143273967 17:5696227-5696249 CAGGGAAGGCAGCCCTGTGAAGG + Intergenic
1143765969 17:9138022-9138044 CAGGGAAGGCTGGGCTGGGGAGG - Intronic
1143830756 17:9648583-9648605 CAGGGAAAGCTTCCCTGGAGAGG + Intronic
1143891455 17:10105650-10105672 TAGGGAAGGCCTCTCTGGAGCGG - Intronic
1144029149 17:11304200-11304222 CAGTGAGAGGGGCCCTGGAGGGG + Intronic
1144583463 17:16473577-16473599 CAGGGAGGGCTGCTCTGCAGAGG + Intronic
1144585836 17:16487160-16487182 CCAGGAAGGTGGCCCTGGAAAGG + Intronic
1145060734 17:19731658-19731680 CAGGGAAGGGAGAACTGGAGAGG - Intergenic
1145246472 17:21273029-21273051 CGGGGAAGGCTGCCCTGGAGAGG + Intergenic
1145765530 17:27456301-27456323 CAGGGAGGGCGGCGCGGGCGCGG + Intergenic
1146173828 17:30652109-30652131 CAGAGAAGGCTTCCCTGGGGAGG - Intergenic
1146347284 17:32068130-32068152 CAGAGAAGGCTTCCCTGGGGAGG - Intergenic
1147336750 17:39730684-39730706 CAGGGAAGGAGGGTCTGGACCGG - Exonic
1147466697 17:40616277-40616299 CAGAGCAGGGGGCCCTGGATTGG - Intergenic
1147744913 17:42689076-42689098 CAGGGAAGAGGGCTTTGGAGGGG - Intronic
1147830779 17:43297154-43297176 CAGGGAAGCCGCACGTGGAGGGG + Intergenic
1147971103 17:44219471-44219493 CAGGGAGGGAGCCGCTGGAGCGG - Intronic
1147991021 17:44333557-44333579 CAGGGAAAGCTGGCCTGGGGCGG + Intergenic
1148722480 17:49763872-49763894 CAGGTGAGCCGGGCCTGGAGCGG - Exonic
1148911801 17:50946935-50946957 CAGGGGAGGAAGGCCTGGAGGGG + Intergenic
1149607578 17:57935809-57935831 CAGTCAAGGGGGCCCAGGAGAGG - Intronic
1149658356 17:58322024-58322046 CAGGGAAGGCCTCCCTGAGGAGG - Intronic
1150227330 17:63531130-63531152 CAGGGAAGCCTGCCTTGGGGTGG - Intronic
1150983401 17:70169148-70169170 CAGGGCAAGCGGCCCAAGAGCGG + Intronic
1151135462 17:71942262-71942284 CAGTGAACACTGCCCTGGAGAGG - Intergenic
1151354322 17:73549581-73549603 CAGGGAAGGCTTCCCGGAAGAGG + Intronic
1151444621 17:74155085-74155107 CAGTGAAGGCGTCTCTGAAGAGG + Intergenic
1151569880 17:74920901-74920923 CAGAGAAGGCGGGACTGGGGCGG + Intronic
1151599780 17:75099102-75099124 CGGGGAAGGCCCCTCTGGAGAGG + Intronic
1152391713 17:80007563-80007585 CAGAGAAGGGGGCCATGGGGAGG + Intronic
1152508725 17:80771111-80771133 CAGGGAAGGAGGTGCTGAAGGGG - Intronic
1152551827 17:81034236-81034258 CTGGGAAGGAGGATCTGGAGAGG - Intergenic
1152596190 17:81238923-81238945 CGGGGAATGCGGCGCTCGAGAGG + Intronic
1152608728 17:81305438-81305460 CAGGGAAAGGGGTTCTGGAGGGG + Intergenic
1152609421 17:81308292-81308314 CAGGGATGGAGGCCGTGGTGGGG + Intergenic
1152762251 17:82114939-82114961 CATGGAGGGCGGCCCTGGGGTGG + Intronic
1153352406 18:4095640-4095662 TAGGGCTGGTGGCCCTGGAGGGG + Intronic
1155340763 18:24812045-24812067 CAGGGAAGGCGTGCCTGAAAGGG + Intergenic
1157578447 18:48759206-48759228 CAGGAAAGGTCACCCTGGAGAGG + Intronic
1158888231 18:61849000-61849022 CAGGGAAGGGGAGCCTGGAGAGG + Intronic
1158928807 18:62300381-62300403 CAAGGAAGGCTTCCCTGAAGAGG - Intronic
1160505404 18:79423788-79423810 GAGGGAAGGCGGCCCAGAGGAGG - Intronic
1160538051 18:79605778-79605800 CAGGGAACGCAGACCTGGCGGGG - Intergenic
1160541819 18:79628091-79628113 CAGGGAAGGCGTCACAGAAGAGG + Intergenic
1160563054 18:79771285-79771307 GAGGGGAGGCCGCCGTGGAGGGG - Intergenic
1160563096 18:79771404-79771426 GAGGGGAGGCCGCCGTGGAGGGG - Intergenic
1161224390 19:3136362-3136384 CAGCCCAGCCGGCCCTGGAGAGG - Exonic
1161315256 19:3614646-3614668 CAGGGGAGGAGGCCCTGATGGGG - Intronic
1161777420 19:6271144-6271166 CAGGGGAGGCTTCCCTGCAGAGG - Intronic
1162024991 19:7888692-7888714 CAGGGCCGGCGCACCTGGAGCGG - Intronic
1162144571 19:8605758-8605780 CAGGGGAGGCGGCACTGTGGGGG - Exonic
1162421979 19:10570770-10570792 CAGGGAGGGCCTCCCTGAAGAGG + Intergenic
1162901465 19:13797340-13797362 CTGGGAAGGGGCCCCAGGAGGGG - Intronic
1162988589 19:14287932-14287954 CAGAGAAGGCTTCCCTGGGGAGG + Intergenic
1163023111 19:14494380-14494402 CAGGCAAGGGGGCCCGGGCGCGG - Intronic
1164656643 19:29926777-29926799 CAGAGAAGGCTTCCCTGGAGAGG + Intronic
1164870662 19:31640439-31640461 CAGGGAAGTGGGCTCTGGAGAGG + Intergenic
1165069702 19:33248300-33248322 AAGGGAAGGCGGGCCAGGAAAGG - Intergenic
1165157187 19:33795945-33795967 CTGGGAGGGCGGCCAGGGAGCGG + Intronic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165358593 19:35319410-35319432 CTGGGGAGGAGGCTCTGGAGTGG - Intronic
1166339999 19:42131794-42131816 CAGGGAAGGCTGCCCTGAGGAGG + Intronic
1166562312 19:43741225-43741247 CAGAAAGGGCTGCCCTGGAGAGG + Intronic
1166651974 19:44581609-44581631 CAGGGAAGGCCTCTCTGAAGAGG - Intergenic
1166685716 19:44794875-44794897 CAGGGAAGGCCTCCCTGAAAAGG - Intronic
1166744931 19:45137072-45137094 CAGGGAAGGGGGCCAGGAAGAGG - Intronic
1166870032 19:45865342-45865364 CAGACAAGGCTTCCCTGGAGTGG + Intronic
1166917050 19:46202574-46202596 CAAGGCAGGCGTCCCTGCAGTGG + Intergenic
1166919591 19:46220245-46220267 CAGGCAAGCCGGGCATGGAGTGG + Intergenic
1167115567 19:47487451-47487473 CAGGGACGGTGGGCCTGGGGAGG - Intergenic
1167406501 19:49312339-49312361 CAGGGAAGGCATCTCTGGTGAGG - Intronic
1167561206 19:50227044-50227066 CAGGTAAGGGGTCCCTGCAGTGG - Intronic
1167563392 19:50240160-50240182 GAGGGAAGGGGGCTTTGGAGAGG + Intronic
926691009 2:15733404-15733426 CAAGGCAGGAGGCCCAGGAGAGG - Intronic
928101134 2:28438010-28438032 CATGGAGGACGGCCCTGGTGGGG - Intergenic
929545213 2:42851194-42851216 CAGGTAAGAGAGCCCTGGAGAGG - Intergenic
929549143 2:42878382-42878404 CAGGGTAGGAGGGTCTGGAGTGG + Intergenic
930587162 2:53280806-53280828 CAGGGAGGGCTTCCCAGGAGTGG + Intergenic
931717168 2:65038306-65038328 CAGGGAAGGCTCCCCTGAGGAGG - Intergenic
932886642 2:75554769-75554791 CAGGGAAGTGGTCCCAGGAGTGG - Intronic
934517538 2:94998261-94998283 CAGGGAGGGCGGCCCTCGGTGGG + Intergenic
934574586 2:95392008-95392030 CAGGGAGGGAGGCCCTGGCAGGG + Intergenic
934716829 2:96549480-96549502 CAGGGAGGGGGGCCCAGCAGGGG + Intronic
934852053 2:97707673-97707695 CAGGGCAGGTGCCCCAGGAGAGG + Intergenic
935133737 2:100280352-100280374 CAGGGAAGCCCGCTCTGGATGGG - Exonic
935171141 2:100612379-100612401 CAGGGAAGGTGGCCGAGGCGTGG + Intergenic
935706529 2:105862027-105862049 CAGGGAAGGCAGCCCTGCCCCGG + Intronic
936019586 2:108984549-108984571 CAAGAAAGGAGGCCCTGGGGTGG - Intronic
936155284 2:110042966-110042988 CTGGGAGGGGGCCCCTGGAGAGG - Intergenic
936189396 2:110328447-110328469 CTGGGAGGGGGCCCCTGGAGAGG + Intergenic
937193940 2:120133337-120133359 CAAGGAAGGAGGCACTGAAGAGG + Intronic
937266198 2:120616059-120616081 CTGAGAAGGGGACCCTGGAGGGG - Intergenic
937477838 2:122230656-122230678 CAGGGAAGGAGTGCCTGGGGAGG - Intergenic
937798137 2:126050001-126050023 CAGTGGAGGCAACCCTGGAGAGG - Intergenic
937932838 2:127219571-127219593 CAGGGAGGGGTCCCCTGGAGGGG - Intronic
937976380 2:127584491-127584513 CAGAGAAGTGGGCCTTGGAGAGG - Intronic
938026776 2:127956209-127956231 GAGGGCAGGCGTGCCTGGAGAGG + Intronic
938716653 2:134027809-134027831 TAGGAAAGGCGCCCCTGCAGGGG - Intergenic
938876087 2:135532132-135532154 CAGGGGATGCGGCCGTGGGGCGG - Intronic
941368801 2:164638623-164638645 CAGAGAAGGCGGGGTTGGAGAGG + Intergenic
941819198 2:169827764-169827786 CCGAGGAGGAGGCCCTGGAGTGG + Exonic
942445219 2:176073014-176073036 CTGGGATGGGGGCTCTGGAGGGG - Intergenic
942539489 2:177001033-177001055 AAGGGAAGGTAACCCTGGAGGGG - Intergenic
942740619 2:179173223-179173245 CAGGGAAGGCCTCTCTGAAGAGG - Intronic
943067754 2:183106370-183106392 CAGGGAAAGAGGCACTGGAAAGG - Intergenic
944300517 2:198119602-198119624 CAGGGAAGGCTTCCCTGGAAAGG - Intronic
946022366 2:216649801-216649823 CAGGCAGGGAGGCTCTGGAGAGG + Intronic
946640705 2:221780634-221780656 GAGGGAAGGGGCCCCTGGAGAGG + Intergenic
947551770 2:231051462-231051484 GAGGGAAGAAGGCCCAGGAGAGG + Intergenic
947771460 2:232673601-232673623 CAGGGAAAGCAGCCCAGGGGAGG - Intronic
948000285 2:234562175-234562197 CATGGAAGGAGACCGTGGAGAGG - Intergenic
948293581 2:236845205-236845227 GTGGAAAGGAGGCCCTGGAGAGG + Intergenic
1168757601 20:327248-327270 CAGAGAAGGCGGGCCGGGCGAGG - Exonic
1168933982 20:1647222-1647244 CAGGGAAGGGGGCCAGGGAGTGG - Intronic
1169152868 20:3304281-3304303 CAGGGAGGGAGGTCGTGGAGAGG - Intronic
1169392554 20:5202395-5202417 CAGGGAAGGCCTCACTGCAGAGG + Intergenic
1170268455 20:14497011-14497033 CAGGGCAAGGAGCCCTGGAGTGG - Intronic
1170268775 20:14500020-14500042 CAGGGAAGGCTTCCCAGAAGAGG + Intronic
1170510152 20:17068076-17068098 CAGGGGCTGAGGCCCTGGAGGGG + Intergenic
1171176162 20:23051792-23051814 CAAGGAATGAGGCCCTGGGGGGG + Intergenic
1171391873 20:24806876-24806898 CAGGGAAGGAGCCACAGGAGAGG + Intergenic
1171489101 20:25504159-25504181 GAGGGAGGGAGGCCCTGGTGAGG - Intronic
1171769846 20:29313900-29313922 GAGGGAAGGAGGCCCTCGGGAGG + Intergenic
1171812570 20:29757050-29757072 GAGGGAAGGAGGCCCTCGGGAGG + Intergenic
1171906671 20:30905237-30905259 GAGGGAAGGAGGCCCTCGGGAGG - Intergenic
1172199093 20:33112891-33112913 CAGGGAAGGCGTCTCTGAGGAGG + Intergenic
1172248595 20:33463248-33463270 CAGGGTAGGGGGGCTTGGAGGGG - Intergenic
1172252600 20:33490267-33490289 GATGGTAGGCGTCCCTGGAGCGG + Intronic
1172493583 20:35361327-35361349 CAGGGAAGGCTTCACTGAAGAGG - Intronic
1172634653 20:36401815-36401837 CAGGGAAGGCCTCCCTGAGGAGG + Intronic
1172692927 20:36803072-36803094 CAGGGAAGGGGGCCGGGGAGCGG - Exonic
1172744229 20:37194214-37194236 GAGAGAAGGTGGCACTGGAGGGG + Intronic
1172885853 20:38230355-38230377 CAGGGAAGGCTTCCCTGAGGAGG - Intronic
1172890142 20:38258580-38258602 CAGGGAAGGCTTTCCTGAAGAGG + Intronic
1173034643 20:39396819-39396841 CAGAGAAGGCCACCCTGGGGAGG - Intergenic
1173435885 20:43031922-43031944 CAGGGAAGAAGGTCATGGAGAGG - Intronic
1173563859 20:44025491-44025513 CAGTGAAGGGGGCCCAGGAAGGG + Intronic
1173628951 20:44495512-44495534 CAGGAAAGGCTGACCTGAAGGGG - Intergenic
1174114045 20:48214729-48214751 CAGGAAAGACGGTCCTGTAGTGG - Intergenic
1174352631 20:49979416-49979438 GAGCGAGGGCGGGCCTGGAGGGG + Intergenic
1174426205 20:50433157-50433179 CAGGGAAGGCTTCCCTGAGGAGG + Intergenic
1175313088 20:58025299-58025321 GAGGGAAGGGGGCGTTGGAGGGG + Intergenic
1175395852 20:58661047-58661069 CTGGGCACGGGGCCCTGGAGAGG + Intronic
1175457803 20:59128411-59128433 CAGGGAAGGCCTCTCTGAAGAGG + Intergenic
1175544832 20:59771482-59771504 CAGGAAAGGCTGCTCTGCAGAGG - Intronic
1175887733 20:62302264-62302286 GAGGGGAGGGGGCCCGGGAGGGG - Intronic
1175949421 20:62575315-62575337 TAGGTACGGAGGCCCTGGAGGGG - Intergenic
1176179275 20:63741884-63741906 CCTGGAAGGAGGCCCTGGTGCGG + Exonic
1176551337 21:8223809-8223831 GAGGGAAGGAGGCCCTCGGGAGG - Intergenic
1176570246 21:8406808-8406830 GAGGGAAGGAGGCCCTCGGGAGG - Intergenic
1176578155 21:8450995-8451017 GAGGGAAGGAGGCCCTCGGGAGG - Intergenic
1178411923 21:32371095-32371117 CCGGGAAGGCCTCCCTGAAGTGG + Intronic
1180340082 22:11611312-11611334 GAGGGAAGGAGGCCCTCGGGAGG - Intergenic
1180800213 22:18628237-18628259 CAGGGAAGGCGCTCCTGGGAGGG + Intergenic
1180851446 22:19023801-19023823 CAGGGAAGGCGCTCCTGGGAGGG + Intergenic
1181037872 22:20178568-20178590 CAGGCAACACGGGCCTGGAGAGG + Intergenic
1181221503 22:21367029-21367051 CAGGGAAGGCGCTCCTGGGAGGG - Intergenic
1181956320 22:26590034-26590056 CACGGTAGGTGGCCCTGGGGCGG - Exonic
1182015774 22:27038555-27038577 CAGGGAAGGCTTCCCTGAGGAGG + Intergenic
1182773001 22:32809389-32809411 CAGGGAAGGCATGTCTGGAGAGG - Intronic
1182773254 22:32811180-32811202 CAGGGAAGGCATGTCTGGAGAGG + Intronic
1183030304 22:35098897-35098919 CAGGGAAGGCCTCCCTGGGAAGG - Intergenic
1183246243 22:36695660-36695682 CAGGGAAGGCTTCCCTGAGGAGG - Intronic
1183253605 22:36746704-36746726 CAGCCGAGGAGGCCCTGGAGAGG + Intergenic
1183310658 22:37107800-37107822 CAGGGAAGGCCTCTCTGGAGAGG - Intronic
1183434407 22:37785082-37785104 CAGGGAAGGCTGCACAGGACAGG + Intergenic
1183505109 22:38204350-38204372 CAAGGAAGGCTTCCCTGGGGAGG + Intronic
1183742086 22:39674403-39674425 CAGGGAAGGCAGCCTAGGAAAGG + Intronic
1184029525 22:41883756-41883778 GAGGCAAGGCAGCCCAGGAGGGG + Intronic
1184247301 22:43242158-43242180 CAGGACAGGCGGGCCTGGTGGGG + Intronic
1184298953 22:43543670-43543692 CAGAGAGGGCTGCCCTGGAGGGG + Intronic
1184671364 22:46013754-46013776 CTGGGAAGGCGGCCGGGGGGAGG - Intergenic
1184768092 22:46582422-46582444 CATGGGAGGCCTCCCTGGAGGGG - Intronic
1184772182 22:46603887-46603909 TAGCAAAGGTGGCCCTGGAGGGG - Intronic
1185213876 22:49587510-49587532 TGGGGAGGGCGGGCCTGGAGGGG - Intronic
1185216076 22:49600678-49600700 CAGGGAACGCAGCCCAGCAGCGG + Intronic
1185222542 22:49636256-49636278 CAGGGTGGGCCGCCCTGGGGAGG + Intronic
1203256360 22_KI270733v1_random:140753-140775 GAGGGAAGGAGGCCCTCGGGAGG - Intergenic
949943545 3:9172848-9172870 CCTGGAAGGAGGCCCTGGTGCGG + Intronic
950150346 3:10681998-10682020 CAGGGAAGGCTGCCCTAAGGAGG + Intronic
950407798 3:12815545-12815567 AAGGGAAGGGGTCCCTGGGGTGG + Intronic
950713501 3:14831023-14831045 CAGGGAAGGCTTCTCTGAAGAGG + Intronic
951136188 3:19107085-19107107 CAGCATAGGAGGCCCTGGAGTGG + Intergenic
953570895 3:44070819-44070841 CAGGGAAGGCTCCCCAGAAGAGG - Intergenic
953785564 3:45908557-45908579 CAGGGAAGGCGTCCCTGAGGAGG + Intronic
954367260 3:50153206-50153228 CAGGGAAGGGGGCCAGGAAGAGG - Intergenic
955439847 3:58943421-58943443 CAGGGAAAGAGGGTCTGGAGTGG + Intronic
956418436 3:69059234-69059256 CAGGGAAGGCCTCCTTGGAGAGG + Intronic
956641130 3:71416625-71416647 CAGGGAAGGCTTCCCTGAGGAGG + Intronic
960374390 3:116880536-116880558 CAGGGAAGGCGGCACTCTGGAGG + Intronic
960680461 3:120242530-120242552 CAGGGAAGGTGTCTCTGAAGAGG + Intronic
961470736 3:127109915-127109937 CAGTAAAGGTGGCACTGGAGAGG + Intergenic
961894763 3:130157980-130158002 CAGGGAAGAAGGCCATGGATTGG + Intergenic
962284609 3:134075587-134075609 CTGGGAAGGCCGCCGTGGATGGG - Intronic
962350289 3:134651251-134651273 CAGGGAGGGAGGCTCTGGACCGG - Intronic
962361935 3:134750070-134750092 CAGGGAAAGCAGCCCAGGAAAGG - Intronic
962618301 3:137150502-137150524 CTGGGAAGGCGTCTCTGGGGAGG + Intergenic
962793919 3:138834770-138834792 CAGGGATGGGGGCGCCGGAGTGG - Intronic
962941523 3:140128826-140128848 AAGGGAAGGTGGATCTGGAGAGG + Intronic
962986943 3:140544756-140544778 CAGGGGAGGGGTCCCAGGAGAGG + Intronic
964550128 3:157876328-157876350 CAGGGAAGGCATCTCTGAAGAGG - Intergenic
966411787 3:179652934-179652956 CCGGGGAGGGGGCGCTGGAGAGG - Exonic
966668948 3:182505665-182505687 GAAGAAAGGCTGCCCTGGAGAGG - Intergenic
968515840 4:1015313-1015335 CAGGGAGTGCAGCCCTGGAGGGG - Intronic
968567152 4:1318994-1319016 GAGGGAAGGCTGCCCAGGAGGGG + Intronic
968626313 4:1628128-1628150 CAGGGAGGGTGGCCCAGGGGAGG + Intronic
968674388 4:1870144-1870166 CAGCGGAGGCGGCGCGGGAGAGG + Intergenic
969564990 4:7972127-7972149 GAGGGAAGGCTCTCCTGGAGGGG - Intronic
969748012 4:9089115-9089137 CAGGGAAGAAGGCCATGGATTGG - Intergenic
970004664 4:11399327-11399349 CAGGGAAGGGGTCCCTGATGAGG + Exonic
971405290 4:26317245-26317267 CAGGGAAGGCCTCCCTGAGGAGG + Intronic
974016896 4:56656188-56656210 CAGGGAGGGAGGCCCGGGTGGGG - Intronic
976226241 4:82797718-82797740 CAGGGACAGGGGCCTTGGAGAGG + Intronic
978503528 4:109433797-109433819 AAGGGAAGGCGGGGCCGGAGAGG - Exonic
984769241 4:183423128-183423150 CAGGGAAAGCTGCCCTCCAGAGG + Intergenic
985722553 5:1497434-1497456 GAGTGGAGCCGGCCCTGGAGAGG + Intronic
985722965 5:1500508-1500530 AGGGAAAGACGGCCCTGGAGGGG + Intronic
987470689 5:18323848-18323870 CAGGAAAGACAGCCCTGGACAGG + Intergenic
987950620 5:24670235-24670257 CAGGGAAGGAGTCCTTGGTGAGG + Intergenic
991949315 5:71932508-71932530 CAAGGGAGGCTGCCATGGAGGGG + Intergenic
997225162 5:132204399-132204421 CAGGCAAAGCGGACCTGGGGAGG - Intronic
998367394 5:141640057-141640079 CAGGGATGCCTGCCATGGAGAGG + Exonic
998530325 5:142878631-142878653 CAGGGAAGGCCTCCCTAAAGAGG + Intronic
998822211 5:146067255-146067277 CGGGGAAGGCAGGCCTGGTGTGG - Intronic
998918187 5:147039164-147039186 CAGGGAAGGCATCTCTGAAGAGG - Intronic
999252895 5:150192978-150193000 CAGGGAACGGGGCATTGGAGGGG + Intronic
999375134 5:151081219-151081241 CAGGGAAGTCGCTCCTAGAGGGG - Intronic
999690706 5:154143697-154143719 CAGGGAAGGCTTCCCAGGGGAGG + Intronic
999840833 5:155424844-155424866 CAGGGAAGGCTTCCCTAAAGAGG + Intergenic
1001143556 5:169164824-169164846 CAGGCAAGGCTGCCCTGCTGGGG + Intronic
1001260653 5:170225601-170225623 CAGGGAGGGCTTCCCTGGAAAGG - Intergenic
1001476820 5:172056438-172056460 CAGGGAAGGCTTCCCAGCAGAGG + Intronic
1001714788 5:173806487-173806509 CAGGAAGAGGGGCCCTGGAGAGG - Intergenic
1001797760 5:174516173-174516195 CAGGGAAGGGGGCTTAGGAGGGG - Intergenic
1001861916 5:175063344-175063366 CAGGAAGGGAGGCCCTGGAGAGG - Intergenic
1002133774 5:177096278-177096300 ACAGGCAGGCGGCCCTGGAGGGG - Exonic
1002164514 5:177336181-177336203 CAGGGAAGGCCGCACTGAGGAGG + Intronic
1002498880 5:179634480-179634502 CGGAGGAGGCGGCCCTGGCGCGG - Intronic
1002502796 5:179658044-179658066 CGGAGGAGGCGGCCCTGGCGCGG + Intergenic
1003032640 6:2615971-2615993 CAGGGAAGGCTGCACTGAGGAGG - Intergenic
1003141808 6:3477979-3478001 GAGGGAAGGCAGCCCAGCAGAGG - Intergenic
1003325313 6:5086051-5086073 CCGGGAAGGCGGCGCTGAAAGGG - Exonic
1003557402 6:7152641-7152663 CAGAGAATGAGGCACTGGAGGGG + Intronic
1003645007 6:7907696-7907718 GAGGGAAGGAGGTCCTGGAGTGG - Intronic
1004645263 6:17554346-17554368 CAGGGAAGGATTCCCAGGAGTGG - Intronic
1006377703 6:33680700-33680722 TAGGCAAGTCGGCCCTGGGGTGG - Intronic
1006389486 6:33750066-33750088 CAGGGAAGGCAGCAGTGAAGTGG - Intergenic
1006505594 6:34486681-34486703 CCCGGAAGGCAGCCCTGCAGGGG - Intronic
1006665666 6:35691240-35691262 CAGGGAAGGCGTCATTGAAGAGG + Intronic
1006809464 6:36810583-36810605 CAGGAAAGGAGGGCCTGGGGAGG + Intronic
1006913467 6:37579216-37579238 CAGGGATGGGGGGTCTGGAGAGG - Intergenic
1006985649 6:38173828-38173850 CAGGGCAGGCAGCACTGGAATGG + Exonic
1006986992 6:38182500-38182522 GTGGGAAGGGGGCCCTGGTGAGG - Intronic
1008514844 6:52309114-52309136 CAGGGAAGGCTTCCCTGTGGAGG + Intergenic
1008920993 6:56843874-56843896 CAGGGTGGGCGGGCCTGGGGAGG - Intronic
1010146338 6:72673635-72673657 CAAGGAAGGAGGACGTGGAGTGG + Intronic
1011652671 6:89521309-89521331 CAGGGAAGGCCTCTCTGGGGAGG + Intronic
1011831871 6:91384003-91384025 CAGGGATGGCCCCACTGGAGAGG - Intergenic
1012992256 6:105938151-105938173 CAGGGAAGGCCTCTCTGGAGAGG - Intergenic
1012997996 6:105992747-105992769 CAGGCAAGGGGGACCTGAAGTGG - Intergenic
1013223977 6:108106427-108106449 GAGGGGAGGCGGCCCTCTAGAGG + Intronic
1013241694 6:108252355-108252377 CAGGGAAGGGTTCCCTGGATAGG + Intronic
1013776700 6:113687025-113687047 CAGGGTTGGAGGCCCTGGATTGG - Intergenic
1015135876 6:129869821-129869843 CAGGGAAGGAGAACTTGGAGAGG + Intergenic
1018219095 6:161560831-161560853 GAAGGAAGGTGGGCCTGGAGAGG - Intronic
1018867756 6:167759013-167759035 CAGGGCAGCAGGCCCTGGAGCGG - Intergenic
1019108726 6:169692223-169692245 CAGGGATGGCTTCCCTGGACTGG - Intronic
1019449095 7:1087195-1087217 CAGGAGAGGCGGCCCTGGTGGGG + Exonic
1019598505 7:1869496-1869518 CTGGGAAGAGGGCCCTGGGGAGG - Intronic
1019883306 7:3882342-3882364 CAGGGAGGGCGACCTTGGATGGG + Intronic
1020324996 7:6967518-6967540 CAGGGAAGAAGGCCATGGATTGG + Intergenic
1022105284 7:27192502-27192524 GAGAGAAGAGGGCCCTGGAGAGG - Intergenic
1022146506 7:27547307-27547329 CAGGGAAGGCCTCTCTGAAGAGG - Intronic
1022202785 7:28133855-28133877 CAGGGAAGGCCCATCTGGAGAGG - Intronic
1022467103 7:30659375-30659397 CAAGGAAGGCTGGCCTGGATGGG - Intronic
1023034785 7:36120786-36120808 CAGGCAAGGAGGATCTGGAGTGG + Intergenic
1024094245 7:45971763-45971785 CAGGGAAGGCCTCTCTGAAGAGG - Intergenic
1024254296 7:47528299-47528321 CAGGGAAGGAGGCACTGAGGGGG + Intronic
1024640533 7:51325137-51325159 CTGGGAAGGAGGCCATGGATTGG - Intergenic
1025072872 7:55916372-55916394 CAGGAAAGATGGCACTGGAGAGG - Intronic
1026548515 7:71346502-71346524 GAGGCAAGGTGGCCTTGGAGAGG + Intronic
1026911399 7:74093699-74093721 CAGGGAGGGGTACCCTGGAGTGG + Intronic
1030049000 7:105521921-105521943 CTGGGAAGGCGGCCCCGCAGTGG - Intronic
1030063152 7:105639118-105639140 CCTGAAAGGCAGCCCTGGAGGGG - Intronic
1031420955 7:121551067-121551089 CAGGGAAGGGGGCCTGGGTGGGG - Intergenic
1032054318 7:128672430-128672452 CAGGGAACCAGGCCCTGGAGTGG + Exonic
1033221434 7:139528811-139528833 CAAGGAAGGAGCCCCTGCAGAGG + Intronic
1033533333 7:142288063-142288085 CAGGGTAGTTGGCCGTGGAGTGG + Intergenic
1033989074 7:147262512-147262534 CAGGGAGGCCGGGCCTGGCGCGG + Intronic
1034989973 7:155542185-155542207 CAGGGAAGGCGGAGCTGGGCAGG + Intergenic
1034989984 7:155542221-155542243 CAGGGAAGGCGGAGCTGGGCAGG + Intergenic
1035046729 7:155972748-155972770 CAGGGAGGAAGGCACTGGAGGGG + Intergenic
1035394037 7:158523960-158523982 GAGTGGAGTCGGCCCTGGAGTGG + Intronic
1035394110 7:158524299-158524321 GAGTGGAGTCGGCCCTGGAGTGG + Intronic
1035567674 8:652146-652168 CAGGGAAGGCGTCGATGGGGTGG - Intronic
1035584569 8:761849-761871 CTGCGGAGGAGGCCCTGGAGAGG + Intergenic
1035687971 8:1539598-1539620 CAGGAAAGTGGGGCCTGGAGAGG - Intronic
1035730077 8:1847998-1848020 GAGGGAAGGTGGCCCGGGAATGG + Intronic
1036371069 8:8163311-8163333 CAGGGAAGGCGTCCATGGATTGG - Intergenic
1036879828 8:12502325-12502347 CAGGGAAGGCGTCCATGGATTGG + Intergenic
1036969565 8:13340094-13340116 CAGGGAAGGAGGTCCTGGGGAGG + Intronic
1037469416 8:19192976-19192998 CAGGGAAGCTGGCCCAGGAGAGG + Intergenic
1037765669 8:21770847-21770869 GAGGGAAGGAGGACCTGGAAGGG - Intronic
1037769634 8:21790737-21790759 CAGGGAGGGCAGGCCTGAAGGGG - Intronic
1038483245 8:27915949-27915971 GAGGGGAGGCAGCCCAGGAGGGG - Intronic
1039936650 8:42051822-42051844 CAGCGGAGTGGGCCCTGGAGCGG + Intronic
1039964083 8:42271406-42271428 CGGGGAAGGCGGGGCTGGGGCGG - Exonic
1044543041 8:93429184-93429206 CAGGGAAGGAGGACATGGTGGGG + Intergenic
1044780492 8:95738879-95738901 CAGGGGAGGCCGCTCTGAAGAGG + Intergenic
1044845119 8:96372837-96372859 TAGGTAGGGAGGCCCTGGAGAGG - Intergenic
1046328321 8:112679352-112679374 CAAGGAAGGCAGAACTGGAGTGG - Intronic
1046545758 8:115648267-115648289 CAGGGCAGGCAGCGCTGGAGAGG + Intronic
1046948702 8:119999820-119999842 CAGTGAAGGAGGCCATAGAGGGG + Intronic
1047104644 8:121719744-121719766 GAGAGGAGGAGGCCCTGGAGTGG + Intergenic
1047358070 8:124141874-124141896 TAGGGAACATGGCCCTGGAGGGG + Intergenic
1049032654 8:140048998-140049020 GAAGGAAGGCGGGCCTGCAGGGG + Intronic
1049174145 8:141181111-141181133 GAGGGACGGCAGCCCTGGGGCGG - Intronic
1049646179 8:143736794-143736816 CAGTGAAGGCGGGGCTGGGGTGG - Intergenic
1049704561 8:144035178-144035200 GAGGGCAGGCGGGCCTGGGGAGG - Intronic
1049766789 8:144358696-144358718 GCGGGAAGCCGGCACTGGAGCGG + Exonic
1050494771 9:6229343-6229365 CATGGGAGGGGGCCCAGGAGGGG + Intronic
1053251024 9:36573911-36573933 CAGGGAAGGCTGCCCAAGAGAGG + Intronic
1053280780 9:36818711-36818733 CAGGACAGGTGGCCCAGGAGTGG - Intergenic
1053293342 9:36896572-36896594 CAGGGAAGGGAGGGCTGGAGAGG - Intronic
1053391780 9:37741123-37741145 CAGGGAAGGCTTCCCAGAAGAGG + Intronic
1055758803 9:79584131-79584153 CAGCGAAGGGAGCCCTGGAAGGG - Intronic
1055790431 9:79917578-79917600 CAGGGAACTCTGCCCTGGAATGG - Intergenic
1056186838 9:84143426-84143448 CAGGGAAGTGGGCCCTGGTGGGG - Intergenic
1056713954 9:89013393-89013415 CAGGTCAGGAGGACCTGGAGTGG - Exonic
1057259137 9:93574686-93574708 CAGGGGAGGCTGCCCTGATGTGG - Intergenic
1057279301 9:93698613-93698635 CAGGGAAGGCAGCCCTGGGCAGG - Intergenic
1057695274 9:97318590-97318612 CAGGAGGGGCGGCCCAGGAGGGG + Intronic
1057840350 9:98481173-98481195 CAGGAAAGCCAGCCCTGGAGAGG - Intronic
1058818604 9:108708596-108708618 CAGGGGAGGGGGCCCTTGTGGGG + Intergenic
1059235866 9:112760282-112760304 AGAGGAAGGGGGCCCTGGAGGGG + Intronic
1059391854 9:114004314-114004336 CAGGAAAGGCGGGGCTGGAGGGG - Intronic
1059691109 9:116687183-116687205 GGGGCAAGGCGGCCCTGCAGGGG - Intronic
1060196682 9:121628586-121628608 CAGGGAAGGCTTCCCGGAAGAGG + Intronic
1060416680 9:123435627-123435649 CAAAGAAGGGGGCCCTGGAAGGG + Intronic
1060482727 9:124026850-124026872 CAGGGAAGGCTTCCCTGAGGAGG + Intronic
1060508789 9:124217218-124217240 CAGGGAAGGCTTCCCAGAAGAGG - Intergenic
1060734196 9:126055877-126055899 AAGGAAAGGCTGGCCTGGAGGGG + Intergenic
1060779606 9:126401752-126401774 GAGGGAAGGCGGGGTTGGAGAGG - Intronic
1060858237 9:126933114-126933136 AAAGGAAGGCGGCGCTGGTGTGG + Intronic
1060985524 9:127817014-127817036 CAGAGAAAGCGGCCCAGAAGGGG - Intronic
1060999232 9:127893511-127893533 CAGGGAAGGCTGCCTTGGGGAGG - Intronic
1061002684 9:127911186-127911208 CAGGGCAGGCAGGCCAGGAGTGG + Intronic
1061010380 9:127951006-127951028 CAGGGAAGGCGCCCTGGTAGAGG + Intronic
1061149803 9:128822251-128822273 CAGGGAAGGCTGCCTGGAAGAGG + Exonic
1061237428 9:129351149-129351171 CGGGGAAGGCGGGGCTGAAGAGG - Intergenic
1061287376 9:129631782-129631804 CAGGGAAGGCATCCCTGAGGAGG - Intronic
1062012126 9:134272943-134272965 CAGGGAGGCCGGCCCTGGGGGGG + Intergenic
1062044048 9:134417082-134417104 CAGGGAAGGCTGTCCTGGCCGGG - Intronic
1062054423 9:134463567-134463589 AAGGGGAGGCGGCCCTGCTGAGG - Intergenic
1062161128 9:135080497-135080519 CAGGGGAGGCAGCCCGGGAATGG - Intronic
1062314761 9:135961214-135961236 CCGGGAAGGCGGGCGGGGAGGGG + Exonic
1062321479 9:135992551-135992573 CCAGGAAGGGGGCCCTGGCGTGG - Intergenic
1062323944 9:136003726-136003748 CTGGGAGAGGGGCCCTGGAGAGG + Intergenic
1062373084 9:136250207-136250229 CAAGGACAGCGGCCCTGGAGGGG - Intergenic
1062380830 9:136285776-136285798 CAGGGAAGGAGCCACTGGAGCGG + Intronic
1062385154 9:136306390-136306412 CAGGGAGGGAGGCTCAGGAGGGG - Intronic
1062449966 9:136611103-136611125 CAGGGGGGGCGGCCGTGGGGGGG + Intergenic
1062684452 9:137803050-137803072 CGGGGAAGGCGGCCCTAGTGTGG + Intronic
1062725765 9:138072660-138072682 CAGGGAAGCAGGCTCTGGGGAGG - Intronic
1203472516 Un_GL000220v1:122453-122475 GAGGGAAGGAGGCCCTCGGGAGG - Intergenic
1203363552 Un_KI270442v1:238067-238089 GAGGGAAGGAGGCCCTCGGGAGG + Intergenic
1185625578 X:1479165-1479187 AAGGGAAGTGGGACCTGGAGGGG - Intronic
1186415461 X:9379844-9379866 CAGGGAAAGCAGCCCTGCAGAGG - Intergenic
1187946610 X:24432276-24432298 TAGGGAAGGCCCCTCTGGAGAGG + Intergenic
1189314045 X:40041242-40041264 CAGGGAAGGCTGCTCTGGGGAGG - Intergenic
1189374959 X:40459605-40459627 CAGGCAAGTCGGCCCTGGGAGGG + Intergenic
1190296495 X:49030536-49030558 CAAGGAAAGCAGCCCTGGAGTGG + Exonic
1190420448 X:50225169-50225191 CAGGGAAGGCCTCTCTGAAGAGG + Intronic
1190701593 X:52993323-52993345 TGGGGAAGGCATCCCTGGAGAGG - Intronic
1193773779 X:85619544-85619566 CAGGGATGGGGGCTATGGAGTGG - Intergenic
1195783172 X:108486227-108486249 CACTGAAGGAGGCACTGGAGAGG - Intronic
1199303822 X:146244282-146244304 CAAGGAAAGAGGCACTGGAGAGG + Intergenic
1201074761 Y:10178771-10178793 GAGGGAAGGAGGCCCTAGGGAGG - Intergenic
1202369961 Y:24189672-24189694 CAGGGAAGGCAGCCAGAGAGTGG + Intergenic
1202500823 Y:25480445-25480467 CAGGGAAGGCAGCCAGAGAGTGG - Intergenic