ID: 920400129

View in Genome Browser
Species Human (GRCh38)
Location 1:205671030-205671052
Sequence AAACAAATGCCAGAGGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 1, 2: 0, 3: 40, 4: 362}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920400127_920400129 -8 Left 920400127 1:205671015-205671037 CCAGCTTTGGAAAGGAAACAAAT 0: 1
1: 0
2: 5
3: 36
4: 356
Right 920400129 1:205671030-205671052 AAACAAATGCCAGAGGAGATTGG 0: 1
1: 1
2: 0
3: 40
4: 362
920400123_920400129 11 Left 920400123 1:205670996-205671018 CCTGTCTGAGAGCTCCAGTCCAG 0: 1
1: 0
2: 2
3: 14
4: 150
Right 920400129 1:205671030-205671052 AAACAAATGCCAGAGGAGATTGG 0: 1
1: 1
2: 0
3: 40
4: 362
920400126_920400129 -3 Left 920400126 1:205671010-205671032 CCAGTCCAGCTTTGGAAAGGAAA 0: 1
1: 0
2: 4
3: 53
4: 220
Right 920400129 1:205671030-205671052 AAACAAATGCCAGAGGAGATTGG 0: 1
1: 1
2: 0
3: 40
4: 362
920400122_920400129 12 Left 920400122 1:205670995-205671017 CCCTGTCTGAGAGCTCCAGTCCA 0: 1
1: 0
2: 1
3: 19
4: 186
Right 920400129 1:205671030-205671052 AAACAAATGCCAGAGGAGATTGG 0: 1
1: 1
2: 0
3: 40
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920400129 Original CRISPR AAACAAATGCCAGAGGAGAT TGG Intronic
904300674 1:29551383-29551405 AACCAAATGCCTGAGGTGAGTGG + Intergenic
904457530 1:30656660-30656682 AACCAAATGCCCGAGGTGAGTGG - Intergenic
905395942 1:37666594-37666616 TCACAAATGCCATATGAGATGGG + Intergenic
907581324 1:55575155-55575177 AAAAAAAGGCAACAGGAGATTGG - Intergenic
908023123 1:59918803-59918825 AAACAAAAGCAATAGGAGACAGG + Intronic
908656071 1:66390153-66390175 AGACAAATGCCTAAGCAGATAGG - Intergenic
909416719 1:75415083-75415105 AAGGAAATGCCAAAGGAGATGGG + Intronic
909444424 1:75732439-75732461 ATACAAATGCTAAAGGAAATAGG - Intronic
909555561 1:76949759-76949781 CAACAAGTCCCAGAGGTGATGGG - Intronic
910603340 1:89055291-89055313 AAAGAATTCCCAGAGGAGAAAGG - Intronic
911096340 1:94058134-94058156 AAACAAATGGCAAAGGGGAGCGG + Intronic
911608537 1:99935766-99935788 AGACAAATGCCTAAGCAGATAGG + Intergenic
912026169 1:105176935-105176957 AAACAAATACCAGAGGCCAGAGG - Intergenic
913169797 1:116221845-116221867 AAACAAAATCCAGAGTAGTTGGG + Intergenic
913500292 1:119466843-119466865 AAAGGGATGCCGGAGGAGATGGG + Intergenic
914694640 1:150066161-150066183 AACCAAGTGACATAGGAGATTGG + Intergenic
915123682 1:153648735-153648757 AAACACATCCATGAGGAGATGGG + Intergenic
915700805 1:157794241-157794263 ACACAAATGACATAGAAGATGGG + Intergenic
915831566 1:159135878-159135900 AAACAAATGCCTGGGGAGCTGGG - Intronic
916233801 1:162565224-162565246 AGACAAATGCAACAGGAGATAGG - Intronic
916243380 1:162661762-162661784 AACCAAATTTCAGAGGAGGTGGG + Intronic
916425165 1:164673424-164673446 AAAAAAATGCCAGAGAGGTTGGG - Intronic
916627135 1:166570462-166570484 AAAGGAATCCCAGAGGAGAGTGG + Intergenic
916769482 1:167894230-167894252 GAACTATTGCCACAGGAGATGGG + Intronic
917470643 1:175323312-175323334 AAACAAATGACAGAAAATATTGG + Exonic
917715068 1:177726742-177726764 AAAAGAATGCCACAGGAGGTTGG + Intergenic
918075012 1:181163834-181163856 AAACAGATGCCAGAAAACATGGG - Intergenic
918773091 1:188589557-188589579 ATACAAATGTCAGAGGAAACTGG - Intergenic
918877180 1:190062998-190063020 AAACAAATGTAAAAGGATATAGG - Intergenic
918952537 1:191158413-191158435 AAACAAATGCCAGCTGGGCTTGG + Intergenic
919030549 1:192236769-192236791 ACAAAAATACCAGAGGAAATTGG + Intergenic
920400129 1:205671030-205671052 AAACAAATGCCAGAGGAGATTGG + Intronic
920731117 1:208486131-208486153 AAACAAATGACAGTGGAAGTGGG + Intergenic
921081048 1:211738648-211738670 AAGCGACTGCCAGAGGGGATGGG + Intergenic
923484400 1:234415215-234415237 CAACAAATGCCTGAGAAGACAGG + Intronic
1064852494 10:19724717-19724739 AAACTTTTGCCAGAGGAAATGGG + Intronic
1064958151 10:20934179-20934201 AAACAAAAGGCAAAGAAGATGGG + Intronic
1065218678 10:23474433-23474455 AAAAAAATGCAAGAGGGGAGGGG - Intergenic
1065985130 10:30943177-30943199 GAACAAATTCAAGAGAAGATGGG + Intronic
1066490370 10:35888382-35888404 AACCAAATGCCTGGGCAGATAGG - Intergenic
1068418822 10:56762716-56762738 AGACAAATACCAAAGCAGATAGG + Intergenic
1069564959 10:69457580-69457602 CAGCAAATGCCAGAGGCAATAGG + Intronic
1070484176 10:76913809-76913831 AAACAACTGCCAGGTCAGATGGG + Intronic
1070645252 10:78197684-78197706 CAACAGATGGCAGAGGTGATGGG + Intergenic
1071343663 10:84670942-84670964 AATCAAATGCCAGACAAGCTGGG + Intergenic
1071651229 10:87394727-87394749 AAACCACTGCCCTAGGAGATGGG - Intergenic
1072218882 10:93310790-93310812 AAACACATGGAAGAGGAAATGGG - Intronic
1073686624 10:105761510-105761532 AAAATAATGCCAGAGGCTATTGG + Intergenic
1074723164 10:116281347-116281369 AAATAACAGTCAGAGGAGATAGG + Intergenic
1075692497 10:124407567-124407589 AACCGAAGGCCAGAGGTGATTGG - Intronic
1077735425 11:4785809-4785831 AAACATATCCCAGAGGAGTAGGG - Intronic
1077976000 11:7250005-7250027 GAAGAAATGAAAGAGGAGATTGG - Intronic
1078343609 11:10522573-10522595 AAACAAAGGCCAAAGGAACTGGG + Intronic
1079602341 11:22325166-22325188 AGACAAATGCCACAAGAGAGGGG + Intergenic
1080099979 11:28448578-28448600 AAATAAAAGCAAGATGAGATTGG - Intergenic
1080268928 11:30429820-30429842 AAACAAAGGGCTGAGGGGATTGG - Intronic
1080459032 11:32437816-32437838 AAATAAATGGCAGAGGAGAGAGG - Intergenic
1081305304 11:41504508-41504530 AAAAAAATGTGAGAGGAGAAGGG - Intergenic
1081536814 11:44002464-44002486 AAACATAAGCCAGAGGAAAGTGG - Intergenic
1081541675 11:44039124-44039146 AAACAAATGACAGAGGAGATGGG + Intergenic
1082036759 11:47651332-47651354 AGACAAATGCCTGGGCAGATAGG + Intergenic
1083780574 11:64915344-64915366 AAGCACATGGCAGAGCAGATGGG + Intronic
1084662978 11:70558022-70558044 AAGGAAATGCCAGGGGAGAAGGG + Intronic
1085254283 11:75163731-75163753 GAAGAAAGGCCAGAGGAGGTAGG - Intronic
1085440754 11:76560385-76560407 GAACAAATGACAGCAGAGATGGG - Intergenic
1085728935 11:78979729-78979751 AAACAAATGACTGAGGAGACAGG + Intronic
1086611698 11:88764617-88764639 AAACAAATCACAGGGGAAATTGG + Intronic
1087326988 11:96736905-96736927 ACATACATGCCAGAAGAGATTGG - Intergenic
1087887438 11:103496838-103496860 AAACAAATGTCAGTTGAAATTGG - Intergenic
1088421999 11:109658650-109658672 AAATAGATGCCCCAGGAGATGGG + Intergenic
1088901357 11:114120223-114120245 AAACAAAGGCCTGAGGAGTTTGG - Intronic
1089004154 11:115076897-115076919 AAATAAATGCCAGATGATAATGG - Intergenic
1089222964 11:116890440-116890462 AAACAAATGCCACTGGGGATGGG + Intronic
1089381831 11:118038651-118038673 AAACAAATGCCCCAGGAGAAGGG - Intergenic
1090128244 11:124112406-124112428 AGACAAATGCCAAAGGGGATAGG - Intergenic
1091048098 11:132343482-132343504 AAATAAATGACAGAGAAGAGAGG - Intergenic
1091531425 12:1360075-1360097 AAAAAGATGCCAGAGGAGAAGGG - Intronic
1092477406 12:8830891-8830913 AAAGAAAAGCCATAGGTGATGGG - Intronic
1094083878 12:26567081-26567103 AAACAAATTGGGGAGGAGATTGG + Intronic
1094460348 12:30691183-30691205 AAACAAAGGCTACAGGAAATAGG + Intronic
1095403471 12:41841477-41841499 AAAAAAATGCTACAGAAGATGGG - Intergenic
1096810461 12:54166375-54166397 AAATAAATGTCAGAGGCCATAGG + Intronic
1096964673 12:55616614-55616636 AGACAAATGCCAAGGTAGATAGG + Intergenic
1098165371 12:67691733-67691755 AAACAAAAGCAAGTGGAGGTGGG - Intergenic
1100018039 12:90035712-90035734 AAATAATTGCCTGAGGTGATGGG + Intergenic
1100885785 12:99068554-99068576 AAAAAAATGCTAGAGTGGATTGG + Intronic
1103175143 12:118856726-118856748 AAATAAATGCAAGAGTAGATGGG + Intergenic
1103522589 12:121546352-121546374 AAAAAAAAGACAGAGGAGATGGG - Intronic
1104621608 12:130318097-130318119 AATGAGATGCCAGGGGAGATCGG - Intergenic
1106371936 13:29142981-29143003 AAACAAAAACCAGAGAAGATTGG + Intronic
1106762607 13:32881678-32881700 AAGCAAGTGCAAGAGCAGATTGG - Intergenic
1107867520 13:44717147-44717169 AAACAAATGGCAATGGAGAGTGG + Intergenic
1108746869 13:53405203-53405225 AGACAAATGCCTAAGCAGATGGG + Intergenic
1109631071 13:65046884-65046906 AGACAAATGCTTGAGGTGATGGG - Intergenic
1109809136 13:67486951-67486973 AAGCAAATGCCAGAGGTTATTGG + Intergenic
1112129040 13:96501018-96501040 AAGGAATTGCAAGAGGAGATGGG + Intronic
1113730019 13:112634788-112634810 AAACAAATGCTAAAGCAAATAGG - Intergenic
1113980652 13:114271939-114271961 AAACAAATGAAAAAGAAGATTGG + Intronic
1114229827 14:20770676-20770698 AAATAAATGCAAGAGGGGAGTGG - Exonic
1114549113 14:23523090-23523112 AAAGGAAGGCCACAGGAGATTGG + Intronic
1115597609 14:34924296-34924318 GAAGAAAAGCCAGGGGAGATGGG - Intergenic
1115874771 14:37848126-37848148 CATCAAATGCCAGCTGAGATGGG + Intronic
1116399922 14:44493858-44493880 CATCAAATCCCAGAGGAGCTGGG + Intergenic
1117261721 14:54041886-54041908 ACTCAAAAGCCAGAAGAGATAGG - Intergenic
1117326311 14:54672057-54672079 AAACAAATTCCAAAGCAGAATGG - Intronic
1117347726 14:54850266-54850288 AAAAAATTGACAAAGGAGATCGG - Intronic
1117537039 14:56712433-56712455 ACACAAAGGCCAGGGGAGAATGG - Intronic
1117690496 14:58299704-58299726 AAACAAACGCCAGCGGGGAGGGG - Intronic
1118012270 14:61621999-61622021 AAACAAAAGCCAGAGGACAAGGG + Intronic
1118592419 14:67411529-67411551 AAACGAAGCCCAGAGGAGTTAGG - Intronic
1119511388 14:75214266-75214288 ACCTAAATGCAAGAGGAGATGGG - Intergenic
1121610318 14:95274235-95274257 AAACCAAAACCAGAGGAGACGGG - Intronic
1124839697 15:33230121-33230143 GAACAAATTACAGAGGAGACAGG + Intergenic
1125095583 15:35847042-35847064 ATAGATATGTCAGAGGAGATGGG - Intergenic
1126245830 15:46504171-46504193 ACATAAATGTCAGAGGAAATAGG - Intergenic
1128248114 15:66146894-66146916 AAAACAAAGGCAGAGGAGATGGG - Intronic
1128421978 15:67500817-67500839 AAATAAAAGCCAGGGGAAATTGG + Exonic
1129499298 15:76020186-76020208 ATAGAGAGGCCAGAGGAGATAGG - Intronic
1129618572 15:77121229-77121251 AAAAAAATGTCAGAGGAGGGAGG - Intronic
1129857120 15:78832305-78832327 AAACTGAAGCCAGAGGAGATGGG - Intronic
1131055925 15:89374934-89374956 AAAAAGAGGCCAGAGCAGATGGG - Intergenic
1131139477 15:89965391-89965413 AAACAAATGACAGAGGAAGCTGG + Intergenic
1131392571 15:92061422-92061444 AATCAAATGCCAGTGGGGAGTGG - Intronic
1131530006 15:93182906-93182928 AGACAAATGCCACAGGAAACAGG - Intergenic
1131809228 15:96155091-96155113 ATACAACTGAGAGAGGAGATAGG - Intergenic
1133196533 16:4174861-4174883 AATCCAATGCCAGAGGAGAGAGG + Intergenic
1133821373 16:9239704-9239726 AAAGAAATGCAGGAGGAGAAGGG - Intergenic
1133838678 16:9388924-9388946 AAGCAAATGTCAGTGGAAATGGG + Intergenic
1133930860 16:10231102-10231124 AAACAGAAGACAGAGGAGAAGGG + Intergenic
1136485524 16:30569707-30569729 AAACAAAAGACTGGGGAGATGGG + Exonic
1137840894 16:51639979-51640001 AATCAAAAGCCAGAGGTGAAAGG - Intergenic
1138078673 16:54067960-54067982 AAAAAAAAGACAGAGGAGAGAGG - Intronic
1138570037 16:57864663-57864685 AAAAAAATTCCAGTAGAGATTGG + Intergenic
1138629134 16:58279642-58279664 AAAAAAATGATAAAGGAGATGGG - Intronic
1138723098 16:59104944-59104966 AAACAGGAGCAAGAGGAGATGGG - Intergenic
1138943753 16:61822274-61822296 CAATAAATGCCAGTGGAGAAAGG - Intronic
1140984773 16:80147659-80147681 GAACAAAAGACAGGGGAGATAGG - Intergenic
1141443529 16:84044162-84044184 ACACAAATGCCAGAAAAGAGAGG + Intergenic
1143033480 17:3981275-3981297 AAAAAAATGTCAGTGGAGATGGG + Intergenic
1145238711 17:21227003-21227025 AAGAAAATGCCTGAGAAGATAGG + Intergenic
1151805851 17:76404928-76404950 AAAGAAATGTTAGAGGAGAAAGG + Intronic
1152395928 17:80033315-80033337 AACTAAGTGCCAGAGGAGTTGGG + Intronic
1152926855 17:83091295-83091317 AAGCAAATGCAGGAGGAGGTGGG + Intronic
1153409114 18:4773727-4773749 ACAGAAATGCGAGAGGAAATGGG + Intergenic
1154256080 18:12781927-12781949 AACCAAATGCCAGACCACATGGG - Intergenic
1154489957 18:14913773-14913795 AAACACATCCCAGAGGATCTGGG - Intergenic
1155757274 18:29515594-29515616 AAATAAAAGACAGAGGAGAGAGG - Intergenic
1156512584 18:37653571-37653593 AAAAAAAAGGAAGAGGAGATGGG - Intergenic
1157491869 18:48129207-48129229 AAAAAACTGCCAAAGGAGAGTGG + Intronic
1158404207 18:57146960-57146982 AAACAAATGCCAGTGGGCAAGGG - Intergenic
1158915803 18:62127828-62127850 AGAAAAATGCCACAGGATATAGG - Intronic
1159184818 18:64955846-64955868 AAACAAACACCAGAGGTGAATGG - Intergenic
1159246641 18:65813943-65813965 AAACAAAATCCCAAGGAGATAGG + Intronic
1159535630 18:69711614-69711636 AAACAAATGTCAAAGGAAAATGG - Intronic
1162405716 19:10472202-10472224 AAACAAATGGCAGAGTAGGCAGG - Intergenic
1163486342 19:17588866-17588888 AAAAAGATGCCAGTGGGGATGGG - Intergenic
1164509503 19:28885847-28885869 AAGCAAATGGCAGTGGAGAAGGG - Intergenic
1165274545 19:34736804-34736826 AAATAAATGCCAGGACAGATAGG + Intronic
1167448505 19:49553643-49553665 AAAAAAATGACAGAACAGATTGG + Intergenic
926502920 2:13677631-13677653 AGACCACTGCCAGAGGAGAACGG - Intergenic
926985769 2:18621522-18621544 AAACAAATGCTAGAGGCAAAAGG - Intergenic
927086127 2:19675483-19675505 CAACAAATGTCAGAGCAGAGTGG + Intergenic
927660931 2:24992086-24992108 AGACAAATGCCTAAGCAGATAGG + Intergenic
927698135 2:25251513-25251535 GGACAACTGCCTGAGGAGATGGG - Intronic
929348685 2:40920204-40920226 AAAGAAATGCCAGAAAACATTGG + Intergenic
929538595 2:42801535-42801557 AGGCACATGCCAGAGGATATGGG - Intergenic
930950268 2:57133492-57133514 ATAGCAATGACAGAGGAGATGGG - Intergenic
931549492 2:63426358-63426380 AAACAAATGGCAGAAGAAATAGG + Intronic
932162013 2:69469233-69469255 AAAGAAATGCCAGAGAATATGGG + Exonic
933105133 2:78315532-78315554 AAATAAAGTCCAGAGGAGAAAGG - Intergenic
933225235 2:79740722-79740744 AAAGAAAAGCAAGAGGAGACTGG + Intronic
933275447 2:80278970-80278992 AAAAAATTGCCAGTGGAGAATGG + Intronic
933416104 2:81988236-81988258 AAACAGAAGGCAGAGGTGATTGG - Intergenic
933839178 2:86272704-86272726 AAGGAAATGGCAGAGGAGAATGG - Intronic
934561390 2:95315341-95315363 AAGCAAATGCCAGAGGAGCCAGG + Intronic
936394306 2:112109508-112109530 CAACAAAAGCCAGAAGATATTGG - Intronic
936577561 2:113668820-113668842 AAATCAAGGCCAGAGGAGAGAGG + Intergenic
937537808 2:122912927-122912949 GAACAGATGTCAGTGGAGATGGG + Intergenic
939680617 2:145127563-145127585 AAACAAATGCTAAAGTAAATAGG - Intergenic
940075358 2:149735435-149735457 AGCCAAATGCCTGAGGAAATAGG - Intergenic
940697064 2:156993037-156993059 AAACCAATGACAGTGGAGAAAGG + Intergenic
940892081 2:159044834-159044856 AAACAGATGGCAGAGTACATGGG - Intronic
942063909 2:172252473-172252495 AAACCAATGAAAGAGGAGAGAGG - Intergenic
942139765 2:172966246-172966268 AAACAAATGGCATAAGAGTTTGG - Intronic
942579053 2:177396782-177396804 AAATTAATGCCACAGGAGTTTGG + Intronic
942591186 2:177548539-177548561 CAACAAGTGCCAGGGGAGTTAGG + Intergenic
942973043 2:181980329-181980351 AAACAAATGAAAAGGGAGATAGG + Intronic
946114609 2:217450523-217450545 GAACAAAGTCCAGATGAGATTGG - Intronic
946633828 2:221702093-221702115 TAACAAAAGAAAGAGGAGATGGG - Intergenic
948005140 2:234602248-234602270 GAAGACATGCCAGAGCAGATGGG + Intergenic
948058232 2:235025368-235025390 AAACCAATGCCACAGGAGAGGGG - Intronic
1169233188 20:3906790-3906812 AAAAAAAGGCCTGAAGAGATTGG - Intronic
1169545131 20:6642192-6642214 AAACAAATACCAACAGAGATTGG - Intergenic
1170310509 20:14986276-14986298 AAAGAAATGCCTGAGGAAACAGG - Intronic
1170758305 20:19224745-19224767 AAACTAATGTCAAAGGAAATTGG + Intronic
1172276684 20:33683961-33683983 AGACAAATGCCAGTGCAGAGAGG + Intronic
1172305999 20:33881227-33881249 AAACAAAAGACAGAAGACATGGG - Intergenic
1172980629 20:38938915-38938937 AAACTGATGCCAGAAGAGATTGG - Intronic
1173055899 20:39612410-39612432 AATCAGATGCCAGAGGACCTTGG + Intergenic
1173619942 20:44429264-44429286 AAATAAATGATGGAGGAGATGGG + Intronic
1174097334 20:48099667-48099689 AAATAAAAGCCATAGGAGCTTGG - Intergenic
1174749473 20:53097432-53097454 ACATAAAGGCCAAAGGAGATGGG - Intronic
1174913403 20:54630945-54630967 AAAAATATTACAGAGGAGATTGG + Intronic
1175325022 20:58118449-58118471 AAAACAATGCCACAAGAGATAGG + Intergenic
1175425978 20:58867207-58867229 AAACAAATGCCAGACGTTAGGGG + Intronic
1177885113 21:26737448-26737470 AAACAAATCCTACAGGAGAAAGG - Intergenic
1178490311 21:33046588-33046610 AAAACAATGCCAGAGAAGAGGGG + Intergenic
1179307854 21:40171063-40171085 AAATAAATACCAGACCAGATTGG - Intronic
1179620739 21:42614061-42614083 CCACAACTGACAGAGGAGATGGG + Intergenic
1181635068 22:24170709-24170731 AAACCAATGTCAGAAGAGACAGG + Intronic
1182243428 22:28935664-28935686 GAACAAATCTAAGAGGAGATGGG - Intronic
1183807088 22:40220655-40220677 AAACAAAGGTGAAAGGAGATGGG - Intronic
1184870225 22:47233092-47233114 AATCAAATGCCTCAGTAGATAGG + Intergenic
1185096390 22:48808364-48808386 AAAGAATTCCCAGAGGAGAGAGG - Intronic
1185422670 22:50743844-50743866 AAATCAAGGCCAGAGGAGAGAGG - Intronic
949241952 3:1883784-1883806 AAACAAATGCCAGAAAGGAAAGG + Intergenic
949593677 3:5520757-5520779 AAGCAGATGCAAGAAGAGATTGG - Intergenic
949822116 3:8126710-8126732 AAACCAATGGCAGAGGACATAGG + Intergenic
951015835 3:17731653-17731675 AAACAAAGGCAAGAGATGATGGG + Intronic
952018572 3:28989249-28989271 AAAAAAATGCCATAGGAAAAAGG - Intergenic
952431263 3:33225536-33225558 AAGCAAAAGCCAGAAGAGTTTGG - Intergenic
952439064 3:33305397-33305419 AAATACATGACAGAGGTGATAGG - Intronic
952536493 3:34315590-34315612 AGACAAATACCAGAGAACATGGG - Intergenic
952790785 3:37198992-37199014 GTCCAAATGCCTGAGGAGATGGG + Intergenic
952995162 3:38872824-38872846 AAAAAAATGACAAAGCAGATGGG + Intronic
953424546 3:42782672-42782694 AGACAAATGGCAGAGGATAGGGG - Intronic
954480416 3:50795062-50795084 AAACCCAAGCCAGAAGAGATTGG - Intronic
955144485 3:56302676-56302698 AAATGAATGCCAGTGGAGTTTGG - Intronic
955403939 3:58613554-58613576 ACACAAAGGCCAGAGGAGAGAGG - Intronic
955873167 3:63461341-63461363 AGACAAATGCCAGAGGGAGTAGG - Intronic
956552433 3:70476675-70476697 ACACAGATGCAAGAGGAGAGTGG - Intergenic
957454706 3:80426564-80426586 GAAGAAATGCCTCAGGAGATTGG - Intergenic
958889804 3:99770813-99770835 AAAAACATGGCAGAGGAGATAGG + Intronic
959327902 3:104961072-104961094 AAAAAAAATCCAGAAGAGATAGG + Intergenic
959715420 3:109427915-109427937 CAACAAAACCTAGAGGAGATGGG - Intergenic
959813658 3:110649867-110649889 GAATAAAAGCCAGAAGAGATAGG - Intergenic
960618708 3:119619255-119619277 AAACAACTACTATAGGAGATTGG + Intronic
960818199 3:121696093-121696115 AAGCAAAAACCAGAAGAGATTGG - Exonic
961007302 3:123413567-123413589 AAACAAATCCCAGAGCAGTGAGG + Intronic
961352293 3:126311629-126311651 AGGAAAGTGCCAGAGGAGATGGG - Intergenic
961367736 3:126411667-126411689 AAACAAAACCCAGAGGAAACTGG - Intronic
962112483 3:132467933-132467955 AAACAAAGTCCAGAGAAGAAGGG - Intronic
962832844 3:139159249-139159271 AAACAAATGGCAGACTGGATGGG - Intronic
963153673 3:142073527-142073549 AAACAAAAGCCAGATTATATTGG + Intronic
963465692 3:145678575-145678597 AACCAGATGCCAGAGGACAAGGG + Intergenic
964222680 3:154365041-154365063 AAAGAAATGCCACAGGAGCAGGG - Intronic
964466061 3:156994538-156994560 TAATAAATGGCAGAGGAGGTGGG - Intronic
967804046 3:193698562-193698584 AAACAAATGCCTTATGATATAGG - Intergenic
968158928 3:196408736-196408758 CAACAGAAGCCAGAGGACATTGG - Intronic
969971311 4:11051319-11051341 AAACAGATGCCAGTGGAGGAGGG - Intergenic
972122409 4:35720812-35720834 AAAAAAATGCCACTGGCGATTGG - Intergenic
972383474 4:38540828-38540850 AAACATATGGCATAGGAGGTAGG - Intergenic
972805388 4:42524948-42524970 AAACGAATGCCAAAAGAGATTGG - Intronic
973807131 4:54537464-54537486 AAAGAGCTGCTAGAGGAGATAGG - Intergenic
974237113 4:59196224-59196246 AAACAAGAGCCAGAGTAGATGGG - Intergenic
974896198 4:67942284-67942306 AAACCGATGATAGAGGAGATGGG + Intronic
974909320 4:68097406-68097428 CAACAAAAGCAAGAGGAGAATGG - Intronic
975047096 4:69818842-69818864 CAACAAGTGGCAGAGTAGATTGG + Intronic
978727845 4:111991163-111991185 AAACAAATTTCCCAGGAGATAGG - Intergenic
979394179 4:120165774-120165796 AAAGAAAAACCAGAGGAGAAGGG - Intergenic
980866326 4:138557091-138557113 AAGGAAATGGCAGTGGAGATGGG + Intergenic
981575752 4:146203269-146203291 AAACAAAACCAACAGGAGATAGG + Intergenic
981952691 4:150429283-150429305 AAACAAATGCCTCAGGTGAAAGG + Intronic
982900072 4:160988012-160988034 AAAAAAATGCTAGAGGCGAGGGG + Intergenic
983675533 4:170288196-170288218 AGACAAAGGGCAGAGGAGAGAGG - Intergenic
984397044 4:179215165-179215187 ATACAAGTACCAGAGGAAATAGG + Intergenic
984521617 4:180808959-180808981 AAACACATTCCAGAGAAGAAAGG + Intergenic
988279251 5:29124599-29124621 TAACATAGGACAGAGGAGATTGG + Intergenic
989020639 5:37002334-37002356 AAACAAAAGCCAGAGGGCATGGG + Intronic
989302790 5:39913758-39913780 GAACCAGTGCCAGAGGAGAAGGG + Intergenic
989440053 5:41460128-41460150 AATCATATCCCAGAGGAGACTGG - Intronic
990603249 5:57382291-57382313 AAAAGAATGCCAGAGGACAGAGG - Intergenic
991240683 5:64456463-64456485 AAACAAATGACTGAGAAGAGTGG + Intergenic
992278841 5:75152008-75152030 AAATAAATTCCAGTGGAGGTGGG + Intronic
993234783 5:85290501-85290523 AAAGAAAAGCCAGTGGAGAAAGG + Intergenic
993778501 5:92034199-92034221 AAACAAATGGGAAAGGAGAAAGG - Intergenic
994167550 5:96623619-96623641 AAAATAATGTCAGAGGAGAAAGG - Intronic
994829500 5:104760797-104760819 AACCACATGCCAGAGCAGATGGG + Intergenic
995355845 5:111236906-111236928 GAACAAATGTCAGAGGAATTAGG + Intronic
996481529 5:123980901-123980923 TCATAAATGCCAGAGGAGAGAGG - Intergenic
996931019 5:128887378-128887400 AAACAACTGACATAGCAGATTGG + Intronic
996933403 5:128918557-128918579 ACACAAATGCCACTGGAGCTGGG - Intronic
996999606 5:129743954-129743976 ACACAACTGTGAGAGGAGATGGG + Intergenic
997175072 5:131766864-131766886 AAAAAAAAGGCAGAGGAAATGGG - Intronic
997401553 5:133607478-133607500 AATCAGATGAAAGAGGAGATGGG + Intronic
998822365 5:146068177-146068199 AAACCAATGGCAGAGGAGCTGGG - Intronic
999694624 5:154178203-154178225 ACAGAAATGGCAGAGGAGTTAGG + Intronic
1000969138 5:167694567-167694589 AAAGAAATGACAGAGTGGATAGG - Intronic
1001034851 5:168290429-168290451 ACACAGATGTAAGAGGAGATGGG + Intergenic
1001155138 5:169266228-169266250 AAACAAATCCTAGAAGAGACTGG + Intronic
1003749770 6:9042343-9042365 AAACAAAAGCCAAAGGAAAAGGG - Intergenic
1004572700 6:16863262-16863284 CAACAAATGCAAGATGAGAGTGG + Intergenic
1004990933 6:21137759-21137781 AACCAAATGTTAGAGGAGGTAGG + Intronic
1006400725 6:33815726-33815748 AAAAAAATTCCAGAGGTGCTGGG + Intergenic
1006446433 6:34082293-34082315 AAACAGAGGCCAGAGAAGTTAGG + Intronic
1007749188 6:44061757-44061779 AAACAAAGGACAGAGAAGTTAGG - Intergenic
1007810044 6:44479265-44479287 ACACATATGCCAGAGGAACTCGG + Intergenic
1008154223 6:47994141-47994163 AACCAAAAGCCAGAGGACAAGGG + Intronic
1009537589 6:64908605-64908627 AAACAAGTCTCAGAGGAGAGGGG + Intronic
1009611038 6:65941478-65941500 AAACAGATGGTAGAGAAGATAGG + Intergenic
1010864987 6:80965466-80965488 AAAGACATGTCAGAGTAGATGGG + Intergenic
1010922193 6:81696541-81696563 AAACCACTGGCAGAGGAGAATGG - Intronic
1011406407 6:87019718-87019740 AAACAAATGCACTAGAAGATAGG - Intergenic
1011823012 6:91274892-91274914 AAAGAAAGGGAAGAGGAGATAGG + Intergenic
1012290890 6:97454053-97454075 TAACCAATGCCAGAGCAGAGAGG - Intergenic
1012541200 6:100364076-100364098 AAACAAATGCCAAAGCAAAATGG + Intergenic
1015823280 6:137285178-137285200 AAACAAATGCCAGGGGAGGCAGG + Intergenic
1015988751 6:138913248-138913270 AAACACATGCAAGTGGAGAATGG - Intronic
1016116422 6:140290964-140290986 ACACAGATGCCAGTGGTGATAGG - Intergenic
1016869083 6:148798829-148798851 AAAGCAATGCAGGAGGAGATAGG + Intronic
1017647313 6:156551165-156551187 AGAGAAATGGCAGAGGTGATTGG + Intergenic
1019073473 6:169368428-169368450 AACCATATTCCAGAGGAGCTGGG + Intergenic
1019412576 7:912692-912714 AAATAAATGCAAGAGGAGTGAGG - Intronic
1019743925 7:2688961-2688983 AAACACTTGGCAGAGGAGTTTGG + Intronic
1019985868 7:4655255-4655277 AAAAAAATGCCAGTAAAGATTGG - Intergenic
1020403055 7:7799730-7799752 AAACCAATGCATGAGGAGTTTGG - Intronic
1021038176 7:15827340-15827362 AAATACATGCTAGAGTAGATTGG - Intergenic
1023654931 7:42409650-42409672 AGACAAATACAAAAGGAGATCGG - Intergenic
1024029313 7:45444175-45444197 AAACAAATGGGAGAGAAGAGAGG + Intergenic
1024208032 7:47180462-47180484 AAACAAATTGCAGGGCAGATGGG + Intergenic
1024418108 7:49131921-49131943 AAACAAATGCCATTTTAGATGGG - Intergenic
1024458931 7:49639584-49639606 AAACAAAGGCAAGAGCAGTTTGG - Intergenic
1024922444 7:54573671-54573693 ATACAAATCCCAGAGGACAATGG + Intergenic
1027458186 7:78419984-78420006 ATAGTAATGCCAGAGGACATTGG + Intronic
1027567082 7:79808478-79808500 ATGCAAATTCCAGAAGAGATAGG - Intergenic
1027800109 7:82739658-82739680 AAACAGAAGCCATAGGAGATAGG - Intergenic
1027894103 7:84018539-84018561 AAAAAAATGCCATGGGAGATAGG + Intronic
1028154230 7:87411076-87411098 AAACAAATGGCACAGCAAATGGG - Intronic
1028444632 7:90907091-90907113 AATCAAAAGCCTGAGGACATTGG + Intronic
1028649096 7:93130457-93130479 AAAAATAAGCCAGGGGAGATGGG + Exonic
1028738231 7:94242159-94242181 AAAGAAATGCTAGAGAAGACAGG + Intergenic
1028999441 7:97138152-97138174 AAAAAAATGCCAGTGGGGCTTGG - Intronic
1029839803 7:103350064-103350086 AAACAAAGTCCAGAGGAGGAAGG - Intronic
1030916643 7:115322681-115322703 AGACAAATGACATAGGATATCGG + Intergenic
1030943572 7:115686913-115686935 AGACATATGCCAGAAGAGACTGG - Intergenic
1031466695 7:122121553-122121575 AAAAAAATGCAAGAGTAGCTGGG - Intronic
1032697184 7:134347634-134347656 AAACAAAAACCAGAAGAGAAGGG + Intergenic
1033881533 7:145889944-145889966 ATACATATGCCAGATGAGAATGG - Intergenic
1034168318 7:149042877-149042899 AAGCAAATGCCAGAAGACAGTGG + Intergenic
1034327967 7:150254864-150254886 AACCAATTTCCAGAGGACATAGG + Intronic
1034765244 7:153714574-153714596 AATCAATTTCCAGAGGACATAGG - Intergenic
1035005479 7:155655325-155655347 AAAAAAAAGCCAGAGCAGAGAGG - Intronic
1035032017 7:155867040-155867062 AAACAAATCAAAGAGGAGTTGGG + Intergenic
1035907658 8:3531241-3531263 GAATAAAAGCCAGAGGAAATGGG - Intronic
1035978697 8:4343131-4343153 AAACAGATGCCACATGAAATGGG + Intronic
1036117630 8:5975520-5975542 TAACATATGCCAGAGAAGACTGG + Intergenic
1036167995 8:6455934-6455956 AAAAGAATGACAGAGTAGATGGG + Intronic
1037183645 8:16035861-16035883 AAAAAAAAGTCAGAGGAGAAGGG - Intergenic
1037685777 8:21138314-21138336 AAACAAATGAGAGAGCAGGTTGG - Intergenic
1037776718 8:21840517-21840539 AAACAAAGGCAATAGGTGATGGG - Intergenic
1038583440 8:28769756-28769778 AAACAGATGCCACAGGACAGTGG + Intronic
1039124896 8:34190492-34190514 AAACACATCCCAGATGAGAGTGG + Intergenic
1040710316 8:50180570-50180592 AAAGAAATGCAAGAGAAAATGGG + Intronic
1041001496 8:53459239-53459261 GAACAAATGGAAGAGGAAATAGG - Intergenic
1042212811 8:66398442-66398464 AAACTAATGAGAGAGGAAATGGG + Intergenic
1042409327 8:68444295-68444317 AAAGAAATTAGAGAGGAGATAGG - Intronic
1042569512 8:70147297-70147319 AAACAAAAGACAGATGAGTTTGG - Intronic
1043730493 8:83672971-83672993 AAATAAATGGCATATGAGATTGG + Intergenic
1043996046 8:86817751-86817773 CTACAAATGCCTGAGGGGATTGG + Intergenic
1044466559 8:92513425-92513447 AAACAAAGGCCAGAGGCGGGGGG + Intergenic
1044736291 8:95282592-95282614 TCACCTATGCCAGAGGAGATGGG + Intergenic
1044926843 8:97216583-97216605 AAACCAAAGCCTGAGGAGCTTGG - Intergenic
1045917525 8:107490164-107490186 AAACAAATGACAGGGGGGAAAGG + Intronic
1046343774 8:112894926-112894948 TAATAAATGCCAGTGGAGTTTGG + Intronic
1047031229 8:120883376-120883398 AAACAAGTGTCAGAGGGGAGTGG - Intergenic
1047535818 8:125718754-125718776 AAACAGAAGTCAGATGAGATTGG - Intergenic
1047689248 8:127334373-127334395 AAAAAAATGACAGATTAGATGGG + Intergenic
1047703629 8:127474912-127474934 ATAGAAAGGCCAGAGGAGATGGG - Intergenic
1048687510 8:136920176-136920198 AAACAAATCCCAAGGCAGATAGG - Intergenic
1049064573 8:140302728-140302750 AAACATATCCAAGAAGAGATGGG + Intronic
1050897846 9:10906550-10906572 AAAAAAGTGTCAGAGGAGAGAGG - Intergenic
1051796780 9:20880483-20880505 AACCAGAAGCCAGAGGACATGGG + Intronic
1051867909 9:21702589-21702611 AAATAAATGGCAGAGGGAATAGG - Intergenic
1051952232 9:22649846-22649868 AAACAAATGCCAGAAAAGAAGGG - Intergenic
1053365670 9:37520954-37520976 TAACAAGTGCCAGTGGGGATGGG + Intronic
1054952566 9:70869286-70869308 AAACAAATCCCCGGAGAGATCGG + Intronic
1055265275 9:74488367-74488389 AAATAAATGCCTCAGTAGATAGG + Intergenic
1055733243 9:79300750-79300772 AATTTAATGCCAGAGGAGTTAGG - Intergenic
1055760072 9:79597736-79597758 AAACAAATGCAAGAGTAACTGGG - Intronic
1058879866 9:109276996-109277018 AAACAGAGGCCAGAGGAGCAAGG + Intronic
1059032388 9:110712940-110712962 ATACACAGGACAGAGGAGATAGG + Intronic
1059727787 9:117026339-117026361 ACACCAATGCCAGAGTACATGGG - Intronic
1060280925 9:122214761-122214783 CACCAAAGGCTAGAGGAGATAGG + Intronic
1061080558 9:128367310-128367332 AAGCCAAGGCCAGAGGAGGTGGG + Intergenic
1061968552 9:134030345-134030367 AAACAAATGCCCCAGGAGAAGGG + Exonic
1185974110 X:4699843-4699865 AAAGAAAAACCAGAGGAGAAAGG + Intergenic
1186437269 X:9553252-9553274 AACAGAATCCCAGAGGAGATAGG + Intronic
1187011608 X:15285477-15285499 AGACAAAGGACAGAGGAGCTAGG + Intronic
1187089480 X:16080296-16080318 GAACCAGTGCCAGAGAAGATGGG + Intergenic
1187145020 X:16629406-16629428 ACACAAATTCCAGAGGAGCACGG - Intronic
1187288392 X:17928625-17928647 AAAGCAAGCCCAGAGGAGATGGG - Intergenic
1189105065 X:38227077-38227099 AAACGAATGCCAGACGAGTAGGG + Intronic
1189878377 X:45461748-45461770 ACACACAAGCCAGAGAAGATTGG - Intergenic
1190118243 X:47639508-47639530 AAACCAATGGGAGAGGAAATGGG - Intronic
1191033828 X:56004696-56004718 AAACAAAAGCCAGAGAAGAGGGG + Intergenic
1195583945 X:106541333-106541355 AATCAAATGCCAGAAGAAATAGG + Intergenic
1197396344 X:125932154-125932176 AGACAAATGCCTAAGCAGATAGG - Intergenic
1198568096 X:137925867-137925889 CAACAAATGCCAGAAGACAAAGG + Intergenic
1198580196 X:138055196-138055218 AAACAAAAGCCAGGGGAAAAGGG + Intergenic
1198733240 X:139756906-139756928 AAACTCATGCCACAGGAGTTTGG - Intronic
1198780758 X:140233195-140233217 AAACAAATGCTAGTGAGGATAGG - Intergenic
1199099250 X:143779680-143779702 ACACAAATGCTAGAGGTGATGGG + Intergenic
1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG + Exonic
1202602485 Y:26608313-26608335 AAACAAATGCAGAAGGAGAAGGG + Intergenic