ID: 920400449

View in Genome Browser
Species Human (GRCh38)
Location 1:205672941-205672963
Sequence CATGTTCACCCTTGTGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 233}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920400441_920400449 25 Left 920400441 1:205672893-205672915 CCCCCTAAGGGCTCACTGATGAG 0: 1
1: 0
2: 1
3: 7
4: 91
Right 920400449 1:205672941-205672963 CATGTTCACCCTTGTGAAATAGG 0: 1
1: 0
2: 0
3: 21
4: 233
920400442_920400449 24 Left 920400442 1:205672894-205672916 CCCCTAAGGGCTCACTGATGAGG 0: 1
1: 0
2: 0
3: 8
4: 96
Right 920400449 1:205672941-205672963 CATGTTCACCCTTGTGAAATAGG 0: 1
1: 0
2: 0
3: 21
4: 233
920400444_920400449 23 Left 920400444 1:205672895-205672917 CCCTAAGGGCTCACTGATGAGGC 0: 1
1: 0
2: 0
3: 8
4: 91
Right 920400449 1:205672941-205672963 CATGTTCACCCTTGTGAAATAGG 0: 1
1: 0
2: 0
3: 21
4: 233
920400445_920400449 22 Left 920400445 1:205672896-205672918 CCTAAGGGCTCACTGATGAGGCT 0: 1
1: 0
2: 2
3: 12
4: 115
Right 920400449 1:205672941-205672963 CATGTTCACCCTTGTGAAATAGG 0: 1
1: 0
2: 0
3: 21
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920400449 Original CRISPR CATGTTCACCCTTGTGAAAT AGG Intronic
904136313 1:28315278-28315300 CATGTCCACATCTGTGAAATTGG + Intergenic
906991854 1:50747454-50747476 CATTTTCTCCCTTTTGGAATGGG + Intronic
907374309 1:54022922-54022944 CATGTTAACACTTGTTAACTCGG - Intergenic
910261243 1:85295700-85295722 CAGGTTTTCCCTTGTGGAATTGG + Intergenic
913042403 1:115040180-115040202 CATGTTTTCCCTTCTGAAACAGG - Intergenic
913181202 1:116323681-116323703 CTTTTTCCCACTTGTGAAATGGG - Intergenic
913563965 1:120052493-120052515 GATGTTGATCCATGTGAAATAGG - Intronic
913634160 1:120741072-120741094 GATGTTGATCCATGTGAAATAGG + Intergenic
914620978 1:149408086-149408108 GATGTTGATCCATGTGAAATAGG + Intergenic
916190469 1:162172904-162172926 CAAGTTCACCCTTGCTCAATAGG + Intronic
916648420 1:166812279-166812301 CATGTTCTCCCTTATAAAAGAGG + Intergenic
917235543 1:172888306-172888328 CAATTTCTCCCTTTTGAAATGGG - Intergenic
919485770 1:198145497-198145519 CACCTTCACCTTTGTGACATGGG - Intergenic
919828743 1:201523333-201523355 CATGTTCAGACATGTGAAAGGGG + Intergenic
920400449 1:205672941-205672963 CATGTTCACCCTTGTGAAATAGG + Intronic
921777514 1:219118773-219118795 CATGTTCAAGTTTGTTAAATAGG - Intergenic
922073345 1:222217898-222217920 CATGTTCACACTTTTGAGAAGGG - Intergenic
923864221 1:237921709-237921731 CTTGTTTTCCTTTGTGAAATTGG + Intergenic
923941613 1:238833055-238833077 CAATTTCTCCCTTGTGGAATGGG + Intergenic
1063855431 10:10246439-10246461 CATGTTCTCACTTATAAAATGGG - Intergenic
1063888158 10:10600842-10600864 CTTATTCAACCCTGTGAAATAGG + Intergenic
1069991974 10:72321609-72321631 CATTTTTCCACTTGTGAAATGGG + Intergenic
1070370833 10:75780388-75780410 CATGTTCACCCTTGTACTTTGGG + Intronic
1072163414 10:92789039-92789061 CATATCCTCCCTTGTAAAATGGG + Intergenic
1074238044 10:111606177-111606199 CATGTTGCTCCCTGTGAAATGGG - Intergenic
1075688077 10:124377715-124377737 CATTTGCACACATGTGAAATGGG + Intergenic
1077452074 11:2654356-2654378 TCTGTTCATCCTTGTGAAGTAGG + Intronic
1078861719 11:15254092-15254114 CATTTTCACCTTTGTGAGTTGGG + Intergenic
1079040889 11:17058564-17058586 CATGTACACCCCTGTGACATTGG + Intergenic
1081011387 11:37817174-37817196 CATTTTCACCTTTTTGATATGGG - Intergenic
1081166521 11:39814824-39814846 CAATTTCTCCCTTGTGGAATAGG + Intergenic
1082700562 11:56424533-56424555 CATGTTCAGGCTTGTCATATAGG - Intergenic
1083045574 11:59731979-59732001 CAAGTCCACCCTTGTCAATTTGG + Intronic
1084143051 11:67246789-67246811 CATTTTAACCTTTCTGAAATTGG - Intronic
1085293405 11:75416393-75416415 CAAATTCACCATTGTAAAATGGG - Intronic
1086183090 11:83979372-83979394 CATGTCTACCCTTGTAAAACAGG - Intronic
1086308518 11:85509016-85509038 CATATTCACTCTTGTGATTTAGG - Intronic
1086343722 11:85874091-85874113 CAATTTCACTCTTGTAAAATGGG + Intronic
1087021343 11:93606380-93606402 CAAGTTTACCCTTGTCAACTTGG + Intergenic
1087968241 11:104446677-104446699 GATGTTCAGGTTTGTGAAATAGG + Intergenic
1090842855 11:130507834-130507856 CAATTTCACCCTTTTGGAATGGG + Intergenic
1092502587 12:9064267-9064289 CACCATCAGCCTTGTGAAATAGG - Intergenic
1096508433 12:52112605-52112627 GATGTACACCCTCGTGACATGGG + Intergenic
1099060274 12:77899912-77899934 CATGTGCACGCTTGTTACATGGG + Intronic
1099394451 12:82120898-82120920 CAAGTTGACCCTAGGGAAATGGG - Intergenic
1099858713 12:88203463-88203485 CATTTTCTCCCTTTTGGAATGGG - Intergenic
1101275689 12:103198497-103198519 CATGGTGATCCTTGTGAGATGGG + Intergenic
1102263078 12:111457094-111457116 CATGTCCACCCTCGTGAAGATGG - Intronic
1102727155 12:115075732-115075754 CATGTGGACCCTTGAGAAAATGG - Intergenic
1103145682 12:118593744-118593766 CAAGTCCACCCTTGTCAACTTGG - Intergenic
1104370030 12:128216250-128216272 CAGGTTCCCCTCTGTGAAATGGG + Intergenic
1106221698 13:27751333-27751355 CCTGCTCACCCTTGGGAAGTGGG + Intergenic
1110681752 13:78322086-78322108 CAAGGTCAGCCTTCTGAAATTGG - Intergenic
1111394597 13:87648715-87648737 TATGTTCACCCTAATGATATGGG + Intergenic
1111511386 13:89268307-89268329 CAGGTACACCCTGCTGAAATGGG + Intergenic
1112447997 13:99484142-99484164 CAAATTCACCCTTGAGAGATAGG + Intergenic
1114583467 14:23787125-23787147 CATGTGCAACTTTGTGACATAGG + Intergenic
1116613123 14:47103830-47103852 CTTGTTCTCCCTAGTGCAATAGG + Intronic
1117575778 14:57095686-57095708 CATGTGCAGCCTTGTTATATAGG - Intergenic
1117906917 14:60599181-60599203 CATGTTCAACAGTGAGAAATGGG - Intergenic
1117953102 14:61102390-61102412 TATTTTCACACTTGTGAAATGGG + Intergenic
1118094197 14:62518013-62518035 CACGTTCTCCCTGGGGAAATAGG - Intergenic
1118422790 14:65625595-65625617 CATTTTCACCCTTTTAAAACAGG - Intronic
1118475174 14:66109700-66109722 CATGTTCCCCCTTGGGACCTGGG - Intergenic
1120719317 14:87873203-87873225 CATGATCACACTTCAGAAATGGG + Intronic
1123064706 14:105611667-105611689 CAACTTCTCCCTTGTGGAATGGG + Intergenic
1123074009 14:105657308-105657330 CAACTTCTCCCTTGTGGAATGGG + Intergenic
1123088010 14:105726891-105726913 CAACTTCTCCCTTGTGGAATGGG + Intergenic
1123093968 14:105756264-105756286 CAACTTCTCCCTTGTGGAATGGG + Intergenic
1123744527 15:23308939-23308961 CATGTGCACCCATGGGAAAAGGG - Intergenic
1126486268 15:49185014-49185036 CATGTGCACCTTTGTTATATGGG + Intronic
1126992999 15:54405197-54405219 CATTTTCTCACTTGTCAAATGGG - Intronic
1127133787 15:55897529-55897551 CATACTGACCCTTTTGAAATGGG - Intronic
1127185153 15:56471722-56471744 CATTTTAACCTTTCTGAAATTGG - Intergenic
1127245782 15:57172737-57172759 CATGTTCAGCTTTGTTATATAGG - Intronic
1127292709 15:57584694-57584716 AATCTTCTCACTTGTGAAATGGG - Intergenic
1130663694 15:85851644-85851666 CATGTTCTCACTTATAAAATGGG - Intergenic
1131696624 15:94883412-94883434 CATTTTCTCCCTTTTGGAATGGG + Intergenic
1131700843 15:94934255-94934277 CAACTTCTCCCTTTTGAAATGGG - Intergenic
1135142992 16:19937513-19937535 CATGTTCTCACTTATGAAATGGG + Intergenic
1135925557 16:26690549-26690571 CATTTTCTCCTTAGTGAAATGGG + Intergenic
1138116025 16:54361403-54361425 AATGTTCACCTCTGTAAAATGGG - Intergenic
1138336503 16:56257604-56257626 CATGTTCAAACTTGTGAAAACGG - Intronic
1138417262 16:56878557-56878579 CATTTTCTCCTTGGTGAAATAGG - Intronic
1139256396 16:65546998-65547020 CTTTTTCTCCCCTGTGAAATAGG - Intergenic
1139731507 16:68949729-68949751 CATGTTTAACCTTTTGAAAATGG - Intronic
1147901279 17:43786783-43786805 TATGTTCATCCTTTTGAGATTGG + Exonic
1148722764 17:49766105-49766127 CAAGACCACACTTGTGAAATGGG + Intronic
1148800484 17:50221942-50221964 AATTTTTACTCTTGTGAAATGGG + Intergenic
1148946207 17:51263700-51263722 CATTTTTTCCTTTGTGAAATGGG + Intronic
1149010872 17:51854916-51854938 CATTTTCTCCTCTGTGAAATTGG - Intronic
1149602894 17:57904592-57904614 CTTGATGACCCCTGTGAAATGGG - Intronic
1150057156 17:62028505-62028527 CATGTGCAGGTTTGTGAAATAGG - Intronic
1155428424 18:25729781-25729803 GTCGTTCACCCTGGTGAAATTGG + Intergenic
1156611974 18:38735498-38735520 GAGCTTCACCCTTGAGAAATTGG + Intergenic
1159026823 18:63190737-63190759 CATGTACAGGCTTGTGACATAGG + Intronic
1159142761 18:64417876-64417898 AATGTCCTCCCTTGTGAAAAAGG + Intergenic
1160329963 18:77982357-77982379 CATGTGCAGGCTTGTGATATAGG - Intergenic
1160897479 19:1409401-1409423 CATGGACACCCTTGGGAAGTGGG + Intronic
1161875569 19:6906299-6906321 CATTTTCCCCCTTGTGTATTAGG + Intronic
1163887786 19:19983296-19983318 CATGTGCAGGTTTGTGAAATGGG - Intergenic
1163950935 19:20585549-20585571 CATGTGCAGGTTTGTGAAATGGG - Intronic
1163965751 19:20745869-20745891 CATGTGCAGGTTTGTGAAATGGG + Intronic
1165401099 19:35600827-35600849 CTTGTTCTCCCTTCTGAACTAGG + Intergenic
1165710990 19:38010825-38010847 CATGTTCTCCCCTGTAATATAGG + Intronic
1167239322 19:48333907-48333929 CAGGTTCACCCGTGGGAACTGGG + Intronic
1168107497 19:54173565-54173587 CAGTTTCCCCTTTGTGAAATGGG + Exonic
1168655290 19:58123131-58123153 CAAGTTCTCCCTTTTGGAATAGG - Intergenic
925334370 2:3082728-3082750 CATGTTCACCTTTGTGCATGTGG - Intergenic
925737920 2:6980419-6980441 CAAGTTCTCCCATTTGAAATGGG - Intronic
926556104 2:14359958-14359980 CATGTGCAGGCTTGTGAAATAGG - Intergenic
927170790 2:20367717-20367739 CAATTTCTCCCTTTTGAAATGGG - Intergenic
930753600 2:54954617-54954639 CATTTTAACACTTTTGAAATAGG + Intronic
931830879 2:66050009-66050031 CATGTTCACTTTTCTGAAATTGG + Intergenic
931862468 2:66370375-66370397 CATGTGCACATTTGTTAAATAGG + Intergenic
932113137 2:69019806-69019828 CATGTTCTCACTTGTTAAGTGGG - Intronic
932174890 2:69590746-69590768 CATTTTCACAGTTGTAAAATGGG + Intronic
936584748 2:113746488-113746510 CATATTCACCATTGTGAGGTAGG + Intronic
937985391 2:127635990-127636012 CATGTGCACCCATGTGATCTTGG - Intronic
938209311 2:129453572-129453594 CATGTTCTCCCATGTTAAGTGGG + Intergenic
938750536 2:134324819-134324841 AATGTTCAGCCATTTGAAATGGG + Intronic
939285883 2:140128659-140128681 CATGTTCTCCCTTGTTAAGTAGG - Intergenic
939782985 2:146473120-146473142 CAATTTCTCCCTTGTGAAATGGG + Intergenic
940076302 2:149746138-149746160 AATTTTCTCCCATGTGAAATAGG - Intergenic
943093268 2:183399171-183399193 CATGTGCACCTTTGTCATATAGG + Intergenic
943153879 2:184148999-184149021 CAATTTCTCCCTTTTGAAATGGG - Intergenic
945098465 2:206241507-206241529 CAGTTTCACTCTTGTGAAACTGG - Intergenic
945325806 2:208480945-208480967 CCTGTTCACATTTATGAAATGGG + Intronic
945566737 2:211410366-211410388 CATGTTTACACATGTGAAAGAGG - Intronic
945900749 2:215534615-215534637 CAATTTCTCCCTTGTGGAATGGG + Intergenic
948219547 2:236258708-236258730 CATGTGCACACATGTGAAAATGG - Intronic
1170122675 20:12927331-12927353 CCTGTTCATCCTTGTAGAATAGG + Intergenic
1170237674 20:14125624-14125646 CATGTACATATTTGTGAAATAGG + Intronic
1170487371 20:16832489-16832511 CATGGCCACCCTTGGCAAATAGG + Intergenic
1172229146 20:33325365-33325387 GATTTTCACACTTGTAAAATAGG - Intergenic
1175272481 20:57744368-57744390 CATTTTCTCACTTGTGAAAAGGG - Intergenic
1176075450 20:63246276-63246298 GATGTGCACACTTGGGAAATTGG + Intronic
1176690552 21:9903516-9903538 CAATTTCTCCCTTTTGAAATGGG - Intergenic
1177312371 21:19413690-19413712 CAATTTCTCCCTTTTGAAATGGG + Intergenic
1178063031 21:28873013-28873035 CAAGTTTACCCTTGTCAACTTGG + Exonic
1178218179 21:30624974-30624996 CAATTTCTCCCTTTTGAAATGGG - Intergenic
1178741071 21:35201889-35201911 AATTTTCTCACTTGTGAAATGGG - Intronic
1178931545 21:36823113-36823135 CATTTTAACACTTCTGAAATTGG - Intronic
1180616886 22:17134313-17134335 CATTTTCTCACCTGTGAAATTGG - Intergenic
1182071323 22:27465760-27465782 CAGTTTCTCCCTAGTGAAATGGG - Intergenic
1182268499 22:29137731-29137753 CTTCTTCACCCTTGTGACTTGGG + Intronic
1182945394 22:34316792-34316814 CAAGTTCTCCCTTTTGGAATGGG + Intergenic
1183272040 22:36868337-36868359 GGTTTTCACACTTGTGAAATGGG + Intronic
1183854530 22:40621843-40621865 CATTTTCTCCCTTCTGAAACCGG + Intronic
1184928048 22:47658150-47658172 CATTTTCTCCCCTGTAAAATGGG - Intergenic
1185089198 22:48756452-48756474 CATTTTGACACCTGTGAAATCGG + Intronic
1185126997 22:49016881-49016903 CACGGTCACCCTATTGAAATGGG + Intergenic
949768870 3:7556365-7556387 CATTTTCACCTCTGTAAAATGGG + Intronic
950111076 3:10419083-10419105 AGTGTTCACCTCTGTGAAATGGG + Intronic
952293901 3:32044055-32044077 CATGTTCAGGCTTGTTACATTGG - Intronic
952859617 3:37802154-37802176 CATGTTCCCCTCTGTAAAATGGG + Intronic
953419699 3:42744931-42744953 CATCTTCACACCTGTGAAATGGG - Intronic
955564674 3:60231133-60231155 CATGCTCATATTTGTGAAATGGG + Intronic
955642944 3:61106118-61106140 CATTATCTCCCTTGTGAAGTAGG - Intronic
961241707 3:125417104-125417126 CATATTCACCCTTGGGACAGAGG + Intergenic
965109230 3:164400979-164401001 CATGTTCACAATTGTTAATTTGG - Intergenic
970317290 4:14841618-14841640 CAGTTTCTCCCTTTTGAAATGGG - Intergenic
970455257 4:16217081-16217103 CATGTTCACTCCTGGAAAATTGG - Intronic
970670858 4:18395289-18395311 CAAGTTCTCCTTTGTAAAATGGG + Intergenic
971556951 4:28024665-28024687 CAGATTTACCCTTGTAAAATGGG + Intergenic
972023742 4:34350469-34350491 CATCTTCACCTCTGTGAGATGGG - Intergenic
972226299 4:37016869-37016891 CATCTACACCCTTGAGTAATTGG + Intergenic
975860258 4:78669572-78669594 CATGTCCAGCCTTCTGAACTGGG - Intergenic
977455350 4:97252717-97252739 CATGTTTAAGCATGTGAAATTGG - Intronic
977487492 4:97666701-97666723 CATGCTAAGCCTTGTGAACTCGG + Intronic
979086155 4:116411875-116411897 CATGTTCTCACTTGTTAAGTGGG + Intergenic
980353951 4:131721439-131721461 CAATTTCTCCCTTTTGAAATGGG - Intergenic
983263358 4:165481254-165481276 CAGATTCCTCCTTGTGAAATGGG + Intronic
983453238 4:167932088-167932110 CATTTTCACCCTTTTTAAATGGG + Intergenic
983453584 4:167935332-167935354 CATTTTCACCCTTTTTAAATGGG - Intergenic
983486720 4:168340872-168340894 CATGTTCTCACTTGTTAAGTGGG - Intergenic
984876268 4:184370644-184370666 CATGTTAACATTTATGAAATTGG - Intergenic
986601636 5:9478647-9478669 CAAGTTCTCCCTTTTGGAATGGG + Intronic
987369807 5:17182569-17182591 CATGTTCTCCCATGAAAAATGGG - Intronic
987432621 5:17854969-17854991 CCTGTTCACCCTTGTGACCTGGG + Intergenic
992430419 5:76705308-76705330 CAGTAGCACCCTTGTGAAATTGG + Intronic
993281699 5:85933413-85933435 AATGAGCACCCTTGTGAAAGAGG + Intergenic
996480831 5:123973408-123973430 CAATTTCTCCCTTTTGAAATGGG - Intergenic
997801723 5:136869507-136869529 CAAGTTCATTCTTGTTAAATAGG - Intergenic
997834380 5:137180470-137180492 CATGTTCCCTCCTGTGAAATGGG - Intronic
1001344585 5:170881282-170881304 CATGCTCACCCTTGAAAATTTGG - Intronic
1001434354 5:171687603-171687625 CCTGCTCACCCTCGTGAATTGGG - Intergenic
1002467151 5:179413293-179413315 TGTGTTCGCCCTTGTGAAATGGG + Intergenic
1003244842 6:4375090-4375112 CAAGTCCACCCTTGTCAACTTGG - Intergenic
1005239758 6:23810218-23810240 CATGTTCTCACTTGTTAACTGGG + Intergenic
1008073091 6:47117273-47117295 CATGTTCTCACTTGTAAAATGGG + Intergenic
1009500679 6:64408826-64408848 CATGTGCACGCTTGTTACATGGG + Intronic
1012735303 6:102932114-102932136 CATTTTCACTCTTTTGAATTAGG - Intergenic
1017787184 6:157766206-157766228 CAAGTTCATCCCTTTGAAATGGG - Intronic
1019183828 6:170209457-170209479 CATCTCCACCCCTGTGAAACAGG + Intergenic
1020186765 7:5964949-5964971 CATCTTCACGCATGTGAAATCGG - Intronic
1020296151 7:6759825-6759847 CATCTTCACGCATGTGAAATCGG + Intronic
1021098929 7:16565890-16565912 CACATGCACCCTTGTGAACTTGG + Intronic
1021235135 7:18134055-18134077 AATGTTCACCCTCCTGGAATTGG + Intronic
1024083902 7:45878000-45878022 CAATTTCTCCCTTTTGAAATGGG - Intergenic
1029153864 7:98501081-98501103 TATGTTCTCCCTTTTGAACTTGG - Intergenic
1030516902 7:110550337-110550359 CAATTTCTCCCTTTTGAAATGGG - Intergenic
1033513412 7:142083005-142083027 CATGTTCACATTTGTTACATGGG - Intronic
1034465926 7:151228840-151228862 CATGTTCTCCTCTGTAAAATGGG + Intergenic
1034637680 7:152580295-152580317 CATGTTCCCCCTAGTGAAAAAGG - Intergenic
1036489570 8:9212380-9212402 CATGTTCTCACCTGTGAAACGGG + Intergenic
1037293213 8:17373231-17373253 CATTTTCAACCTAGAGAAATCGG + Exonic
1037407078 8:18554319-18554341 CTTGTTCATTCTTGGGAAATGGG - Intronic
1039116388 8:34095770-34095792 CAGGGTCACCCCTGTGTAATGGG - Intergenic
1039263119 8:35794629-35794651 CATTTTCACTTTTGTGACATTGG - Intronic
1040672748 8:49712378-49712400 CATGTTCTCACTTGTTAAGTAGG + Intergenic
1043878526 8:85514481-85514503 CATGTTCACCTCTGTAAAATTGG - Intergenic
1045239452 8:100386364-100386386 CATGTGCAGCCTTGTTATATAGG - Intronic
1045814527 8:106264138-106264160 CATGTTAACCTTCATGAAATTGG - Intergenic
1046222213 8:111231143-111231165 CTTGTTCACCCTTTTTAAAAAGG - Intergenic
1046599997 8:116305126-116305148 CTTATTCACCCTTCAGAAATGGG + Intergenic
1047919591 8:129620475-129620497 CATTTTCTCCCCTGAGAAATGGG + Intergenic
1048409176 8:134154042-134154064 CATGTTCTCACTTGTTAAGTGGG - Intergenic
1050699300 9:8319670-8319692 CATTTTCCCCCTTTTTAAATGGG - Intronic
1051376617 9:16408668-16408690 CATGTGCAGCTTTGTGAGATGGG + Intergenic
1052826959 9:33183935-33183957 CATGTTCTCACTTGTTAAGTGGG + Intergenic
1053455521 9:38230611-38230633 AATGTTCACCTTTGTGATATGGG + Intergenic
1053627277 9:39888030-39888052 CAATTTCTCCCTTTTGAAATGGG - Intergenic
1053778716 9:41577995-41578017 CAATTTCTCCCTTTTGAAATGGG + Intergenic
1054166678 9:61788235-61788257 CAATTTCTCCCTTTTGAAATGGG + Intergenic
1054216610 9:62362673-62362695 CAATTTCTCCCTTTTGAAATGGG + Intergenic
1054670872 9:67792670-67792692 CAATTTCTCCCTTTTGAAATGGG - Intergenic
1055618389 9:78097039-78097061 CAAGTTCACAATGGTGAAATGGG + Intergenic
1056317194 9:85401410-85401432 CACCTTCACCCCTGTGAATTAGG - Intergenic
1057435309 9:95035015-95035037 CATGTGCAGCCTTGTTACATAGG + Intronic
1058489883 9:105486466-105486488 CATGTTCACTCTTGGGAGATAGG + Intronic
1059808882 9:117834226-117834248 CCTGTTAACACTTGTGAACTAGG - Intergenic
1060726708 9:126011019-126011041 AATGTCCACCCGTGTGAAAAGGG + Intergenic
1060874459 9:127071342-127071364 CATTTTAACACTTCTGAAATTGG + Intronic
1061466023 9:130780434-130780456 CATATTTACCTTTGTGATATTGG + Intronic
1062438908 9:136560431-136560453 CAATTTCTCCCTTTTGAAATGGG + Intergenic
1186609649 X:11126498-11126520 CATGTGCACACTTGTTACATAGG - Intergenic
1188470681 X:30535353-30535375 CTTCATCACCCTGGTGAAATTGG + Intergenic
1188651010 X:32632120-32632142 CAATTTCACCCTTTTGGAATAGG - Intronic
1188807161 X:34605416-34605438 CATGTTCACCCTCCTGTAAGGGG + Intergenic
1189635971 X:43009638-43009660 CATTTTCTCCCTTTTTAAATAGG - Intergenic
1190444675 X:50512031-50512053 CATGTTCTCGCTTATGAAGTAGG - Intergenic
1190512800 X:51191591-51191613 CAATTTCTCCCTTTTGAAATGGG - Intergenic
1190522336 X:51293131-51293153 AATCTTCTCCCTTGTGAAAATGG + Intergenic
1190543918 X:51505355-51505377 AATCTTCTCCCTTGTGAAAATGG - Intergenic
1191117504 X:56866952-56866974 CAAGTTCTCCCTTGTGCAAGGGG + Intergenic
1193526350 X:82594864-82594886 GATGATCAGGCTTGTGAAATAGG + Intergenic
1193564077 X:83055998-83056020 CAATTTCTCCCTTTTGAAATGGG - Intergenic
1193859863 X:86651968-86651990 CATGTTCAGGTTTGTTAAATGGG + Intronic
1193906257 X:87248472-87248494 ATTGTTCACTCTTGTCAAATAGG + Intergenic
1195020906 X:100826985-100827007 CATTTTCCCCCTTGTTAACTTGG - Intronic
1197814101 X:130478830-130478852 CATGTTCTCACTTGTTAAGTGGG + Intergenic
1198170334 X:134099080-134099102 TAAGTCCACCCTTGTCAAATTGG - Intergenic
1198751778 X:139943466-139943488 CATGTTCTTCCCTGGGAAATGGG - Intronic
1199239785 X:145532924-145532946 CATGTGCAGGCTTGTTAAATAGG - Intergenic