ID: 920403824

View in Genome Browser
Species Human (GRCh38)
Location 1:205694083-205694105
Sequence CCTCTGTGGGGGCTTCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920403817_920403824 -9 Left 920403817 1:205694069-205694091 CCTGGGGGGGCTTCCCTCTGTGG No data
Right 920403824 1:205694083-205694105 CCTCTGTGGGGGCTTCCCTCTGG No data
920403811_920403824 8 Left 920403811 1:205694052-205694074 CCACAGGGCAAGTGGCTCCTGGG No data
Right 920403824 1:205694083-205694105 CCTCTGTGGGGGCTTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920403824 Original CRISPR CCTCTGTGGGGGCTTCCCTC TGG Intergenic
No off target data available for this crispr