ID: 920404251

View in Genome Browser
Species Human (GRCh38)
Location 1:205697215-205697237
Sequence CTGGAGCCAGAGATGTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920404251_920404261 -1 Left 920404251 1:205697215-205697237 CCCAGCCACATCTCTGGCTCCAG No data
Right 920404261 1:205697237-205697259 GGGGGAAGCAGGAGGAAGTCAGG No data
920404251_920404262 5 Left 920404251 1:205697215-205697237 CCCAGCCACATCTCTGGCTCCAG No data
Right 920404262 1:205697243-205697265 AGCAGGAGGAAGTCAGGAGCTGG No data
920404251_920404265 18 Left 920404251 1:205697215-205697237 CCCAGCCACATCTCTGGCTCCAG No data
Right 920404265 1:205697256-205697278 CAGGAGCTGGGAGGTGCCAGAGG No data
920404251_920404264 9 Left 920404251 1:205697215-205697237 CCCAGCCACATCTCTGGCTCCAG No data
Right 920404264 1:205697247-205697269 GGAGGAAGTCAGGAGCTGGGAGG No data
920404251_920404259 -9 Left 920404251 1:205697215-205697237 CCCAGCCACATCTCTGGCTCCAG No data
Right 920404259 1:205697229-205697251 TGGCTCCAGGGGGAAGCAGGAGG No data
920404251_920404266 22 Left 920404251 1:205697215-205697237 CCCAGCCACATCTCTGGCTCCAG No data
Right 920404266 1:205697260-205697282 AGCTGGGAGGTGCCAGAGGCAGG No data
920404251_920404263 6 Left 920404251 1:205697215-205697237 CCCAGCCACATCTCTGGCTCCAG No data
Right 920404263 1:205697244-205697266 GCAGGAGGAAGTCAGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920404251 Original CRISPR CTGGAGCCAGAGATGTGGCT GGG (reversed) Intergenic
No off target data available for this crispr