ID: 920406538

View in Genome Browser
Species Human (GRCh38)
Location 1:205717624-205717646
Sequence TTGTAGGGAGGGTGGGCAAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 251}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920406538 Original CRISPR TTGTAGGGAGGGTGGGCAAT GGG (reversed) Exonic
900318985 1:2073245-2073267 GTGTGGGGACGGTGGGCACTGGG - Intronic
900438189 1:2641198-2641220 TTGTGGGGAGGGTTGGGAAGGGG + Intronic
900512490 1:3067238-3067260 GTGTGGGGAGGGTGGGTAAAGGG + Intergenic
901819339 1:11816696-11816718 CTGGAGGGATGGTGGGCCATAGG + Intronic
902811917 1:18892775-18892797 TTTTAGGGAGGGAGGGAAACTGG - Intronic
903516398 1:23913785-23913807 TGGTAGGGACTGTGGGTAATAGG + Intergenic
903886147 1:26542215-26542237 TGGTAGGGAGGGTGAGCTTTGGG + Intronic
904920350 1:34003145-34003167 TGGGAGGGAGGGAGGGGAATGGG - Intronic
906889136 1:49688187-49688209 TTGTGGGGAGGGTGTGGAAGTGG - Intronic
908787555 1:67750052-67750074 TTGTTGGCAGGCTGGGCAGTGGG - Intronic
909925297 1:81431202-81431224 TTGGAGGTAGGGTGGGGAGTTGG + Intronic
914772575 1:150702749-150702771 TTGGAGGGAGGGAGAGCATTAGG + Intronic
914909322 1:151771346-151771368 TTCTTGGGGGGGTGGGTAATAGG + Intronic
915129397 1:153686475-153686497 TTCTGGGGAGGGTGGGCTAAAGG + Intronic
915265827 1:154716909-154716931 TTGCAGGGAGAGGAGGCAATTGG + Intronic
915780028 1:158537812-158537834 GTGTAGGGAGAGAGGGCAGTGGG - Intergenic
916288353 1:163135765-163135787 TTGGAGGAAGGGAGGGCATTAGG - Intronic
916348946 1:163826988-163827010 ATGTGGGGAGGTTGGGAAATGGG + Intergenic
917149891 1:171932043-171932065 ATGGAGGGAGGGTGGGGGATGGG - Intronic
918011887 1:180594510-180594532 TTGGATGGAGGGTGGGAAGTGGG - Intergenic
918146381 1:181759624-181759646 TTGGGGGGAGGGTGGCCAAGGGG - Intronic
918496226 1:185140559-185140581 TTGAAGGGAGGATGGGAAGTTGG + Intronic
918672737 1:187240392-187240414 ATGTGGGGTGGGTGGGAAATGGG - Intergenic
920406538 1:205717624-205717646 TTGTAGGGAGGGTGGGCAATGGG - Exonic
920728521 1:208460929-208460951 TTGTAGGCAGAGTGGGGAATTGG - Intergenic
921331367 1:214041054-214041076 TTGTGGGGAGGGTGGGAAAGGGG + Exonic
921820674 1:219612898-219612920 GTGTAATGAGGGTGGGGAATGGG + Intergenic
922409694 1:225359984-225360006 TTGTAGGGAGGGAGAGCATCAGG - Intronic
922903446 1:229156160-229156182 TTGGAGGGAGGGAGGCCAATGGG + Intergenic
923676285 1:236083306-236083328 TTGTTGGGAATGTGGGCAAGGGG + Intergenic
1062960449 10:1569419-1569441 ATGTAGAGAGGATGGGCAGTTGG + Intronic
1063503111 10:6572365-6572387 TTGGAGGGAGGGAGAGCATTAGG - Intronic
1066391203 10:34978591-34978613 TTGTAGGGATGGAGGGACATGGG + Intergenic
1066758723 10:38735978-38736000 TGGCAGGGAGGGTGGGTTATGGG + Intergenic
1066962923 10:42236790-42236812 TGGCAGGGAGGGTGGGTTATGGG - Intergenic
1067479974 10:46588278-46588300 CTGTGGGGAGGGTGGGCCATGGG - Intronic
1067614763 10:47753519-47753541 CTGTGGGGAGGGTGGGCCATGGG + Intergenic
1069490776 10:68858684-68858706 TGGGAGAGAGGGTGGGCAATGGG + Intronic
1070240346 10:74674028-74674050 TTGTGGGTGGGGTGGGCCATGGG + Intronic
1071583480 10:86795646-86795668 TAGTAGGGAGGGAGGGAATTAGG + Intronic
1071630169 10:87213482-87213504 CTGTGGGGAGGGTGGGCCATGGG + Intergenic
1071878384 10:89867270-89867292 GTGTAGTCAGGGTGGGCAAGGGG - Intergenic
1072539398 10:96386841-96386863 GTGTAGGAACGATGGGCAATGGG - Intronic
1072540418 10:96394217-96394239 TTGTAGGGGGGCTGGGGAAGTGG + Intronic
1075741448 10:124698762-124698784 CTGGATGGAGGGTGGGGAATGGG - Intronic
1076203824 10:128579050-128579072 TGGCAGGGAGGGTGGGCCCTGGG + Intergenic
1077351717 11:2096181-2096203 TTGGGGGGAGGCTGGGCAGTGGG - Intergenic
1080546218 11:33321474-33321496 TGGTAATGAGGGTGGGAAATTGG + Intronic
1083506911 11:63166474-63166496 TTGTATGGAGGATGTGCTATGGG + Intronic
1083775329 11:64891804-64891826 CAGCAGGGAGGGTGGGCAAAGGG - Intergenic
1084525973 11:69698184-69698206 TGTTAGGGAGGGTGGGGAAGGGG - Intergenic
1085525073 11:77159397-77159419 GGGGAGGGAGGGTGGGCAACAGG - Intronic
1087985732 11:104677212-104677234 TTGCAGGGAGGGAGGGAAAGAGG - Intergenic
1088018286 11:105086995-105087017 TTGAAGGGAGGGAGAGCATTAGG - Intronic
1088020851 11:105117184-105117206 TTGAAGGGAGAGAGGGCATTAGG - Intergenic
1088566053 11:111174054-111174076 TGGTAGTGAGGGAGTGCAATCGG + Intergenic
1089219431 11:116858521-116858543 TGGGAGGGAAGGTGGGGAATTGG + Intronic
1089229653 11:116961185-116961207 TAGTAGGTAGGGTTGGCAAGGGG - Intronic
1089747208 11:120625741-120625763 TTGGGGGGAGGGTGGGCAGCTGG + Intronic
1090329764 11:125922076-125922098 TGTTTGGGAGGGTGGGCAAGAGG - Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1096020317 12:48318953-48318975 TTGTAGGGAGGAAGGACACTTGG - Intergenic
1098986476 12:77017847-77017869 TTGTAGGAAGGGAGGGAAAGTGG + Intergenic
1100008314 12:89921371-89921393 TTGTAGAGAGGAGGGCCAATAGG - Intergenic
1102496155 12:113320785-113320807 TTGTGGGGAGGCTGGGAGATAGG - Intronic
1104009527 12:124919858-124919880 GTGTAGGGAGGTCGGGAAATCGG - Intergenic
1105586753 13:21752005-21752027 TTGAAGGGAGGGTGGTTGATGGG + Intergenic
1108693176 13:52878431-52878453 TGGTGGGGAGGGTGGGTTATTGG + Intergenic
1112099948 13:96177635-96177657 TTGTAGGGAGGGTGGGAGGAGGG + Intronic
1113080043 13:106509845-106509867 CTGTAGGGTGGGTGAGAAATTGG + Intronic
1116021917 14:39471622-39471644 TTTTAGGGAGAGAGGGGAATGGG - Intergenic
1117741581 14:58824369-58824391 TTGTAGAGTGGGTTGGAAATAGG + Intergenic
1117997974 14:61496050-61496072 TTGGAGGGAGAGTGCGCAGTGGG + Intronic
1119473472 14:74913213-74913235 ATGTAGGGAAGGTAGGCATTTGG - Intronic
1119977264 14:79038951-79038973 GTGTAGGGAGGATGGTAAATTGG + Intronic
1120368496 14:83602374-83602396 TTGTGGGGAGGGAGGGCATCAGG - Intergenic
1121898125 14:97667787-97667809 TTGTAGGTAGGCAGGGCCATGGG + Intergenic
1123442147 15:20300676-20300698 TGGCAGGGAGGGTGGGTTATGGG + Intergenic
1124359396 15:29024718-29024740 TTGTAGGCAGGGTCAGCAAAAGG + Intronic
1124603921 15:31156593-31156615 TTGTGGGGAGGGTGGCCCACAGG - Intronic
1125411519 15:39411097-39411119 TTTTAGGTAGGGTGGCCAAGGGG - Intergenic
1125598650 15:40903354-40903376 TTTGATGGGGGGTGGGCAATGGG + Exonic
1126519630 15:49577289-49577311 TTGCAGGGGGTGTGGGGAATGGG - Intronic
1129727252 15:77907747-77907769 CTGTGGGGAGGGTGGGGCATAGG + Intergenic
1129840628 15:78741271-78741293 CTGTGGGGAGGGTGGGGCATAGG - Intergenic
1133148225 16:3806747-3806769 TTGGAGGGAAGATGGGCCATCGG - Intronic
1136724091 16:32343231-32343253 TGGCAGGGAGGGTGGGTTATGGG - Intergenic
1136842425 16:33549275-33549297 TGGCAGGGAGGGTGGGTTATGGG - Intergenic
1137676657 16:50306986-50307008 CTGGAGGCAGGGTGGGCAAGTGG + Intronic
1137950577 16:52779782-52779804 TTGTAGGGAGGTGGGGAAAGAGG + Intergenic
1138193402 16:55034678-55034700 TTGTTGGGAGTGTGAGCACTGGG - Intergenic
1138918569 16:61498717-61498739 TGGAAGGGCAGGTGGGCAATAGG + Intergenic
1142433727 16:90044259-90044281 TTGTGGGGAGGCTGGGCCAAGGG - Exonic
1203002340 16_KI270728v1_random:174534-174556 TGGCAGGGAGGGTGGGTTATGGG + Intergenic
1203133945 16_KI270728v1_random:1710940-1710962 TGGCAGGGAGGGTGGGTTATGGG + Intergenic
1203152590 16_KI270728v1_random:1849572-1849594 TGGCAGGGAGGGTGGGTTATGGG - Intergenic
1142630184 17:1220667-1220689 TTGCAAGGAGGGTGGGGAGTGGG - Intronic
1142805385 17:2368650-2368672 TGGGAGGGAGGGTGGGCATGAGG - Intronic
1143124230 17:4631481-4631503 CTCTAGGGAGGGTGGGACATGGG + Exonic
1143376706 17:6471431-6471453 TGGGAGGGAGGCTGGGCACTTGG + Intronic
1145398265 17:22512550-22512572 GTGCAGGGAGGGTGGGCAGCAGG - Intergenic
1146297057 17:31658512-31658534 TTATAGGCAGGGTGGGCAGCGGG + Intergenic
1146933578 17:36795437-36795459 CTGTGAGGAGGGTGGGGAATGGG - Intergenic
1147265082 17:39229695-39229717 TTGTTGGGAAAGTGGGCAGTGGG + Intergenic
1148603557 17:48911278-48911300 ATGTAGGGAAGGTTGGGAATAGG + Intronic
1148767866 17:50049691-50049713 TTGGAGGCAGGGAGGGCAACAGG + Intergenic
1149662836 17:58344515-58344537 TTGTGGGGAGGGGAGGCAAGAGG - Intergenic
1150252303 17:63713360-63713382 ATGGAGGGAGGGTGGGCTCTTGG - Intronic
1151418250 17:73980881-73980903 TTGTAGGGAGGGAGAGCAACTGG + Intergenic
1152026372 17:77812020-77812042 TTGCAGGGAGGCTGAGCATTTGG - Intergenic
1152369971 17:79880706-79880728 TTGGAGGGAAGGTGGGAAAATGG + Intergenic
1152703687 17:81832460-81832482 GTGTAGAGAGGGTGGGAAGTGGG - Intronic
1155079161 18:22390389-22390411 GTGGAGGGAGGGAGGGCATTAGG + Intergenic
1156707029 18:39895376-39895398 TTTTGGGGTGGGTGGGCAGTGGG + Intergenic
1157120146 18:44901557-44901579 AGGTAGGGAAGGTGGGGAATGGG + Intronic
1157385116 18:47253821-47253843 CTGTAGGGTGGGAGGGCACTGGG - Intergenic
1157501390 18:48193376-48193398 GTGTTGGGAGTGTGGGGAATAGG - Intronic
1158051090 18:53220857-53220879 TTTTAGGAAGGGTGGGGAGTAGG + Intronic
1160148871 18:76384597-76384619 CTGTAGGGGGGGTGGGGGATGGG - Intronic
1160710428 19:548814-548836 GTGGGGGGAGGGTGGGCAATGGG - Intronic
1160893730 19:1393181-1393203 GTGGAGGGAGGGTGGGCAGGCGG + Intronic
1163020959 19:14480539-14480561 TGGGAGTGAGGGTGGGCCATGGG - Intronic
1164165636 19:22672104-22672126 CTGTAGTGAGGCTGGGCAAGGGG + Intergenic
1164448298 19:28336591-28336613 TTGGAGGCGGGGTGTGCAATGGG - Intergenic
1164663444 19:30001489-30001511 TTGTAGAGATGGTAGGGAATAGG - Intronic
1164833743 19:31343115-31343137 TTGTCGGGAGGGAGGGCACAAGG - Intronic
1167304212 19:48697496-48697518 TTGTAGGGATGGTGGGGAGGGGG - Intronic
1168102227 19:54147376-54147398 TAGTAGTGAGGGCGGGCAACAGG + Intronic
1168300645 19:55402871-55402893 TGGCAGAGAGGGTGGGGAATTGG - Intronic
927994927 2:27477959-27477981 TTGAGGGTAGGGTGGGGAATAGG - Intronic
928053659 2:28028366-28028388 GTGTTGGGAGGGTGGGATATTGG - Intronic
929107793 2:38380948-38380970 TTGTAGGGACAGAGGGAAATCGG + Intergenic
930284904 2:49415398-49415420 ATGTGTGGATGGTGGGCAATTGG - Intergenic
934237919 2:90247773-90247795 TGGCAGGGAGGGTGGGTTATGGG + Intergenic
934580127 2:95431054-95431076 TTGTAGGCAGGGTGGGGTGTTGG - Intergenic
934599320 2:95645671-95645693 TTGTAGGCAGGGTGGGGTGTTGG + Intergenic
934736593 2:96692759-96692781 TTGTAGGGAGTGGGGACAGTAGG + Intergenic
935979548 2:108613487-108613509 GTGTAGGGAGGGAGGGCAGAAGG - Intronic
939258326 2:139773710-139773732 TGGTAGTGAGGGAGGTCAATGGG - Intergenic
940776672 2:157891987-157892009 ATGGAGGGAGGGTTGGCAATGGG + Intronic
945933320 2:215878449-215878471 TTGCAGGGAGGGTCAGCACTAGG + Intergenic
945965499 2:216182116-216182138 TTTTGGGGAGGGTGGACAAGGGG - Intronic
945990705 2:216393187-216393209 TGGGAGGCAGGGTGGGCAGTAGG + Intergenic
946253169 2:218425810-218425832 GTGTAGGGAGGGTGGGCTGCAGG + Exonic
946521233 2:220467300-220467322 TTGTAGGGAGGGAGGGATTTCGG + Intergenic
1169044552 20:2525166-2525188 TGGTAGGGCGGGTGGGGATTCGG - Intergenic
1171049664 20:21843627-21843649 TTGGAGGCAGGGTGGGCAAAAGG + Intergenic
1171360558 20:24583699-24583721 TTGTGGGGAGGGTGGGGCAGTGG + Intronic
1171392734 20:24811809-24811831 TTGTCAGGAGGGTGGGGTATTGG - Intergenic
1171392789 20:24811989-24812011 GTGTCAGGAGGGTGGGGAATAGG - Intergenic
1172656410 20:36541278-36541300 TTGTAGGGAGGGGAGGTGATGGG - Intergenic
1172775027 20:37402325-37402347 GTGTGGGGAGGGTGGGGAAGGGG + Intronic
1172837433 20:37882077-37882099 TGGAAGGGAGGGTGGCCACTCGG + Intergenic
1173976458 20:47190298-47190320 TTGGAAGGTGGGTGGGTAATTGG + Intergenic
1175341346 20:58232151-58232173 TTGTAGGTAGGGTGGGGCAGGGG + Intergenic
1176661277 21:9637269-9637291 ATGTAGGGTGGGTGGGCAGGAGG - Intergenic
1177447023 21:21210871-21210893 GAGTTGGGAGGGTGGGAAATGGG + Intronic
1177534235 21:22403173-22403195 TTGGCGGGAGGGTGGGAAAAGGG + Intergenic
1178259758 21:31088349-31088371 TTGTAGGCGGGGTGGGGACTTGG - Intergenic
1178510638 21:33202290-33202312 CTGCAGTGAGGGTGGGCACTGGG - Intergenic
1183305956 22:37083354-37083376 GAGTGGGGAGGGTGGGCAAGGGG - Intronic
1184121788 22:42455525-42455547 TTTTTGGGAGGGTGGGGAGTGGG - Intergenic
949520103 3:4843731-4843753 ACGGAGGGAGGGTGGGCGATGGG + Intronic
949891747 3:8738360-8738382 TTGTAGGGCTGGTGGGCATCTGG - Intronic
950696272 3:14703464-14703486 TTGTAGGGAGGGTGGTGAGCAGG - Intronic
951545661 3:23822410-23822432 TTGTGGGGAGGATGGGGAAAGGG + Intronic
952350477 3:32531427-32531449 ATGTAGGGAGAGTGAGCAAGGGG - Intronic
952707289 3:36392207-36392229 CTGTAGGGAGGTTGGACGATGGG - Intronic
952924979 3:38314058-38314080 CTGTGGGGTGGGTGGGCTATAGG - Intronic
955412703 3:58666486-58666508 AGGTGGGGAGGGTGGGAAATAGG - Intronic
955446890 3:59021482-59021504 GTGTAGGCAGGGTGGGCAGATGG - Intronic
955873934 3:63470702-63470724 TTATAGGGGAGGTGGGCAAGAGG - Intronic
959566126 3:107834655-107834677 CGGTACGGAGGGTGGGCAAGGGG + Intergenic
961107034 3:124250867-124250889 TGTGAGGGAGGGTGGGAAATAGG + Intronic
961572397 3:127809140-127809162 ATGTAGGGAGTGAGGGGAATTGG + Intronic
963015344 3:140819258-140819280 TTGTGGGGAGGGAGAGCATTAGG - Intergenic
963215023 3:142735790-142735812 GTGTTGGGAGGGTGGGAAGTAGG + Intronic
963534824 3:146514404-146514426 TTGCAGGCAGGGCGGGCCATGGG - Intergenic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
966716918 3:183021970-183021992 TTGTGGGGAAGGTGGACAGTAGG - Intronic
972283901 4:37630114-37630136 GGGAAGGGAGGGCGGGCAATGGG - Intronic
972461020 4:39302418-39302440 TTGTAGGGATGGGGAGCAACAGG - Intronic
977751430 4:100614375-100614397 TTGGAGGGTGGGTGGGTATTGGG - Intronic
978756034 4:112303896-112303918 TTGTAGTGGGGTTGGGGAATGGG - Intronic
983122859 4:163910216-163910238 TTTTAGGCTTGGTGGGCAATGGG + Intronic
983743445 4:171164830-171164852 TTGTGGGGGTGGTGGGCAAGCGG + Intergenic
984163851 4:176285297-176285319 TTGCAGGGAGTGTGGGGAAAGGG - Intergenic
985187641 4:187334778-187334800 TTGTAGAGGGGTTGGGGAATGGG - Intergenic
985414118 4:189719258-189719280 ATGTAGGGTGGGTGGGCAGGAGG + Intergenic
985672809 5:1214858-1214880 GGGTAGGGAGGGTGGGCCCTGGG + Intronic
985687992 5:1292204-1292226 TTGTGGGGAGGGGGTGAAATCGG + Intronic
986862482 5:11943581-11943603 TTGGAGGTATGGAGGGCAATGGG + Intergenic
987817902 5:22928095-22928117 TTGTAGGGAAGGAGGTCAAGAGG - Intergenic
989333523 5:40287978-40288000 TTGAAAGGAAGGTGGGTAATAGG - Intergenic
990664429 5:58055614-58055636 ATGTTGGGGGGGTGGGTAATGGG - Intergenic
991477317 5:67036220-67036242 AGCTAGAGAGGGTGGGCAATGGG - Intronic
992405897 5:76457381-76457403 TTGAAGGGAGGGTTGGCAAGAGG - Intronic
996891831 5:128429338-128429360 TTGTATAGTGGGTGGGCAGTAGG - Intronic
996961651 5:129256583-129256605 TTGGGGGGAGGAGGGGCAATTGG + Intergenic
997419500 5:133754967-133754989 TTGAAGGAAGGGTGGGAAGTGGG - Intergenic
998216337 5:140240867-140240889 CTGTTGGGAGGATGGGCAATGGG - Intronic
998646389 5:144066809-144066831 TTGTAGTGAGGGAGTGGAATTGG + Intergenic
1000502267 5:162066932-162066954 TTGAAGGAAGGGTGGGCAGAGGG - Intergenic
1001299824 5:170525502-170525524 TTCTAGGGAGGGAAGGCAAAGGG - Intronic
1001379356 5:171293442-171293464 TTGGAGAGAGGGAGGGGAATGGG - Intronic
1001566312 5:172701635-172701657 TTCTGGGGAGGGTGGGCAGAAGG + Intergenic
1004495174 6:16156178-16156200 CTGGAGGCAGGGTGGGCCATGGG + Intergenic
1004982528 6:21042250-21042272 GAGTAGGGTGGGTGGGAAATGGG - Intronic
1005993427 6:30917595-30917617 TTGCAGGGAGGCTGGGCAGATGG + Intronic
1009564965 6:65301661-65301683 GTGTAATGAGGGTGGGGAATGGG - Intronic
1011994216 6:93565248-93565270 TTGTGGGGTGGGGGGGCAAGGGG - Intergenic
1014446196 6:121531006-121531028 TTGTGAGGAGGGTGAGCAAATGG + Intergenic
1017107978 6:150906153-150906175 TTGTTGGGAGGGATGGGAATAGG + Intronic
1018515060 6:164570328-164570350 TTGCGGGGAGGCTGGCCAATAGG - Intergenic
1021193932 7:17653370-17653392 TGTTAGATAGGGTGGGCAATCGG - Intergenic
1021734805 7:23632619-23632641 TTGTAGGGAAACTGGGCAAAGGG + Intronic
1021820321 7:24491420-24491442 TTGTGGGGAGTCTGGACAATTGG - Intergenic
1022040844 7:26579893-26579915 TTGCAGGGAGGCTGAGAAATGGG + Intergenic
1023483738 7:40662338-40662360 ATGTGGGGAGGATGGGCTATAGG - Intronic
1023598845 7:41861429-41861451 GTGTTGGGAGGGTGGTCAGTTGG + Intergenic
1024821307 7:53333190-53333212 TTGTCGGGGGGTGGGGCAATGGG + Intergenic
1026420612 7:70233220-70233242 TGGTAGGGAGGGTAGGAAAGTGG - Intronic
1026978146 7:74511277-74511299 CTGTAGGGAGGGTGGGCTGAAGG + Intronic
1029917058 7:104221206-104221228 TTGTAGGCAGTGTATGCAATTGG + Intergenic
1031216781 7:118903001-118903023 TTGGTGGGAGGGTGGAAAATGGG - Intergenic
1031743812 7:125468533-125468555 TTGCAGGGTGGGAGGGCAAGGGG - Intergenic
1032090352 7:128908687-128908709 CTGGATGGTGGGTGGGCAATTGG - Intronic
1035095346 7:156349801-156349823 GTCTGGAGAGGGTGGGCAATAGG - Intergenic
1036079838 8:5543052-5543074 GTGTTGGGAGGGTGGGCACAGGG - Intergenic
1038083761 8:24171338-24171360 TTGTAGTAAGAGTGGGGAATGGG + Intergenic
1038389615 8:27183219-27183241 TTGGGGGGTGGGTGGGCATTAGG + Intergenic
1038606850 8:29015322-29015344 CAGGATGGAGGGTGGGCAATAGG - Intronic
1041682992 8:60612125-60612147 CTGTAGGGAGGTTGGGGAAAAGG - Intronic
1044824385 8:96182565-96182587 TTGGAGGGAGGGTGGCCATAGGG - Intergenic
1046401098 8:113704145-113704167 GTGTTTGGAGGGTGGGCAATGGG + Intergenic
1048019804 8:130527848-130527870 TTGTAGCAGGGGTGGGGAATGGG + Intergenic
1049095435 8:140545615-140545637 CTGTTGGGAGGGTGAGCACTGGG - Intronic
1049646802 8:143739230-143739252 TTGTTGGGAGGGTGGGCTCCAGG + Intergenic
1050825672 9:9942123-9942145 TTTTGGTGAGGGTGGGAAATGGG - Intronic
1051345708 9:16148993-16149015 TGGTAGGGGGGTTGGGGAATAGG - Intergenic
1051370942 9:16358503-16358525 TGGTAGGGATGGTGGGAAGTGGG + Intergenic
1051534035 9:18136910-18136932 TTGTAAGGAGGGTCAACAATGGG + Intergenic
1052977785 9:34424431-34424453 TTTTAGGAAGTGTGGGCAAGGGG + Intronic
1055429489 9:76229236-76229258 TTGTTGGTATGGTGGGGAATTGG - Intronic
1056223514 9:84472630-84472652 TAGCAGGGAGGGTGGTCAAATGG - Intergenic
1056949229 9:91028796-91028818 TGATGGGGATGGTGGGCAATAGG - Intergenic
1057956307 9:99410862-99410884 TTGTAGTGTGGATGGGGAATGGG + Intergenic
1059154591 9:111978537-111978559 GGGTAGGGAGGGTGGGGAGTGGG - Intergenic
1059506442 9:114803670-114803692 TTGGAGGCAGGGTGGGGGATGGG + Intronic
1061178293 9:129010091-129010113 GTTTAGTGAGGGTGGGCAGTGGG + Intronic
1061543525 9:131290738-131290760 TTGAAGGGAGGCTGGGCCAGAGG + Intronic
1062022950 9:134327638-134327660 CTGCAGGGAGGGTGGGCAGGAGG - Intronic
1062218573 9:135402399-135402421 CTGCAGGCAGGGTGGGCAAAGGG - Intergenic
1062416711 9:136454888-136454910 AGGCAGGGAGGGTGGGCAGTGGG + Intronic
1062490636 9:136803338-136803360 TTGTAGGCAGTGTGGGCATGGGG - Intronic
1203638844 Un_KI270750v1:139113-139135 ATGTAGGGTGGGTGGGCAGGAGG - Intergenic
1186858321 X:13646956-13646978 TTCCAGGGAGGATGTGCAATCGG + Intergenic
1187182169 X:16953434-16953456 GGGTAGGGAGGGAGGGGAATGGG - Intronic
1189410305 X:40764498-40764520 TTGTGGGGAGGGAGAGCATTAGG + Intergenic
1190141585 X:47850599-47850621 TTGCAGGGAGGGAGGGAAAGAGG + Intronic
1190717649 X:53117413-53117435 TGGTGGGGAGGGTGAGGAATGGG - Intergenic
1193526171 X:82592123-82592145 TTTTAGGGATTGTGGGCCATGGG + Intergenic
1195722488 X:107879557-107879579 TGGTGGGCAGGGTGGGCCATGGG + Intronic
1195778758 X:108438000-108438022 TGGGAGGGAGGGTGAGTAATGGG + Intronic
1196719494 X:118839985-118840007 TTTTTTGGAGGGTGGGCAACTGG - Intergenic
1202584110 Y:26406471-26406493 TGGCAGGGAGGGTGGGTTATGGG - Intergenic