ID: 920407573

View in Genome Browser
Species Human (GRCh38)
Location 1:205729335-205729357
Sequence GCTTTTTTCTTACCTGGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 435}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920407573_920407575 10 Left 920407573 1:205729335-205729357 CCAAAACCAGGTAAGAAAAAAGC 0: 1
1: 0
2: 3
3: 42
4: 435
Right 920407575 1:205729368-205729390 TTATTATCAATGATTTACCAAGG 0: 1
1: 0
2: 3
3: 18
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920407573 Original CRISPR GCTTTTTTCTTACCTGGTTT TGG (reversed) Intronic
900435112 1:2626838-2626860 TCTCTTTTCTTGCCTTGTTTTGG - Intronic
905211157 1:36374998-36375020 GCTTTCTCCTTGCCTGATTTGGG - Intronic
905735438 1:40322134-40322156 GCATTTTTCTTATCTTTTTTAGG - Intergenic
906290082 1:44614155-44614177 GCTTTCTTCTTACCTAGTGAGGG - Exonic
906840668 1:49135081-49135103 GTATTTCTCTTACCTGTTTTTGG + Intronic
907037687 1:51230581-51230603 TCTTCTTCCTAACCTGGTTTTGG - Intergenic
908062235 1:60363811-60363833 GCTGTTTTCTTCCCTAGATTGGG - Intergenic
908251884 1:62272399-62272421 GGTTTTCTCTGGCCTGGTTTTGG - Intronic
909070213 1:70984830-70984852 ACTTTATTCTTAACTGTTTTTGG - Intronic
911318444 1:96382709-96382731 GTTTTGTCCTTTCCTGGTTTTGG - Intergenic
911966554 1:104379490-104379512 CTTTTTTTCTTGTCTGGTTTTGG - Intergenic
912358958 1:109078695-109078717 GGTTTTTTGTTACCTAATTTTGG + Intergenic
913487563 1:119347141-119347163 GCTTTTTTAGTATCTGATTTAGG + Intergenic
915436982 1:155914519-155914541 TCTGTTTTCTTACATGGTTCTGG - Intronic
915688842 1:157666213-157666235 GCTGTGTTCTTGTCTGGTTTTGG + Intergenic
915955532 1:160217291-160217313 CCTATTTTGTTAACTGGTTTGGG - Exonic
916566065 1:165979066-165979088 GTTATGTTCTTTCCTGGTTTTGG + Intergenic
917317272 1:173738962-173738984 GTTATGTTCTTTCCTGGTTTTGG + Intronic
917573205 1:176292100-176292122 GTTATGTTCTTTCCTGGTTTTGG - Intergenic
917588095 1:176448404-176448426 GCTTTTTTGTTTGCTTGTTTTGG - Intergenic
919111345 1:193222797-193222819 CCTTTTTTCTCACCTCTTTTTGG + Intronic
919221202 1:194630820-194630842 GCTTATTTCTTCCCTCTTTTGGG - Intergenic
920407573 1:205729335-205729357 GCTTTTTTCTTACCTGGTTTTGG - Intronic
920500767 1:206483802-206483824 GCTGTTTTATAACCTGTTTTGGG + Intronic
921030219 1:211329716-211329738 GCTTTTTTCTGCCCAGGTTGTGG + Intronic
921471317 1:215553404-215553426 TCCTTTTTTTTATCTGGTTTTGG + Intergenic
921753321 1:218823020-218823042 AATTTTTTTTTACTTGGTTTGGG - Intergenic
923691643 1:236199358-236199380 GCTATGTCCTTTCCTGGTTTTGG + Intronic
1063158928 10:3405316-3405338 GTTTTTTTCTTCCCATGTTTGGG + Intergenic
1063328336 10:5128015-5128037 GCTTTTTTCTCACCTCTCTTAGG - Intronic
1063555897 10:7079312-7079334 GTTATGTTCTTTCCTGGTTTTGG - Intergenic
1063892814 10:10647678-10647700 TATTTTTTCTTGCCTGATTTTGG - Intergenic
1066281399 10:33921722-33921744 GCTCTTTTCCCACCTGCTTTTGG - Intergenic
1066651340 10:37658538-37658560 GTTATTTCCTTTCCTGGTTTTGG - Intergenic
1067034836 10:42906200-42906222 GTTATTTCCTTTCCTGGTTTTGG - Intergenic
1067779802 10:49192130-49192152 GCTTTCTTCTTGCCTGGTTTGGG - Intergenic
1068043287 10:51854628-51854650 GGTTTTTTCTTACATATTTTTGG - Intronic
1068172592 10:53415271-53415293 GCTATGTTTTTTCCTGGTTTTGG + Intergenic
1068172794 10:53417875-53417897 GCTATGTTTTTTCCTGGTTTTGG + Intergenic
1068390007 10:56383582-56383604 GCTTTTTTTTTCCCTAGCTTAGG + Intergenic
1068457372 10:57274208-57274230 GTTATGTTCTTACCTGGTTTTGG - Intergenic
1068511795 10:57975491-57975513 GCTGTGTTCTTGTCTGGTTTTGG - Intergenic
1068662992 10:59642861-59642883 GTTCTGTTCTTACCTGGTTTGGG + Intergenic
1069172525 10:65251325-65251347 GTGTTTTACTTTCCTGGTTTGGG + Intergenic
1069221049 10:65884084-65884106 GTTGTGTTCTTGCCTGGTTTTGG + Intergenic
1069242413 10:66159645-66159667 GTTATGTTCTTTCCTGGTTTTGG + Intronic
1070433712 10:76367222-76367244 GCTATGTGCTTTCCTGGTTTTGG + Intronic
1070951969 10:80438356-80438378 GCTTTTTTCCTTCCTTGTTTCGG - Intergenic
1072815208 10:98501216-98501238 GTTATGTTCTTTCCTGGTTTTGG - Intronic
1072920799 10:99575696-99575718 GATTTTTTCTTAACTGGTAATGG - Intergenic
1073701302 10:105929952-105929974 GGTTTTTTATTTCCTTGTTTAGG - Intergenic
1073752557 10:106545343-106545365 GCTTTTTACTTTCCTGCTCTTGG + Intergenic
1074239796 10:111626654-111626676 GCTTTTTTTTCACATGCTTTTGG - Intergenic
1074428114 10:113370072-113370094 GGCTTTTTCTTTCCTGGTATAGG - Intergenic
1074972898 10:118555722-118555744 TCTTTTTTCTTACCTTCTTTTGG + Intergenic
1075153034 10:119952340-119952362 GCATTTTTCTTGCCCGGCTTAGG - Intergenic
1075494082 10:122903746-122903768 GTTATGTTCTTTCCTGGTTTTGG - Intergenic
1075654441 10:124152067-124152089 GCCTCTTTCTTGCCTGGTTCTGG - Intergenic
1075931869 10:126304267-126304289 TCCTTTTTGTTACCTGGTTTTGG - Intronic
1076619049 10:131775417-131775439 GGTTTTTTCTTTCTTAGTTTTGG - Intergenic
1077942771 11:6861136-6861158 GCTTTTTTCTCATGTGCTTTTGG - Intergenic
1077957676 11:7038605-7038627 TCTTCTTTCTTTCCTGATTTTGG + Exonic
1078018610 11:7636759-7636781 GATTAATTCTTACATGGTTTTGG + Intronic
1078025478 11:7691256-7691278 TCTATCTTCTTACCTGCTTTAGG + Exonic
1078373763 11:10775280-10775302 GCCTTTTTCTTCTCTGCTTTTGG - Exonic
1078404419 11:11057480-11057502 GCTTTTTTCTAACAAGGTCTGGG - Intergenic
1078592885 11:12660653-12660675 GTTATGTTCTTTCCTGGTTTTGG + Intergenic
1078991484 11:16651296-16651318 GTTTTGTTTTTTCCTGGTTTTGG - Intronic
1079179786 11:18180951-18180973 GCTATGTTCTTTCCTGGTTTTGG - Intronic
1079634259 11:22715866-22715888 GTTATGTTCTTTCCTGGTTTTGG - Intronic
1080759661 11:35236320-35236342 ACTTTCTACTTACCTGGTTTGGG - Intergenic
1081143197 11:39529608-39529630 GTTTTGTTCTTGTCTGGTTTTGG + Intergenic
1081897640 11:46600408-46600430 GCTTTTTTCTGGCATGGTTTTGG - Intergenic
1082865146 11:57892890-57892912 GTTTTTTCCTTGTCTGGTTTTGG + Intergenic
1083046373 11:59739518-59739540 GCTATGTCCTTTCCTGGTTTTGG + Intronic
1085363611 11:75916426-75916448 CCTCTTTACTTACCTGGTCTTGG + Intronic
1085475308 11:76785144-76785166 GCTTTTGCCTTTCCTGGTGTTGG - Intronic
1086844276 11:91729689-91729711 GTTATATTCTTCCCTGGTTTTGG - Intergenic
1087652343 11:100882569-100882591 GTTTTTTCCTTTCCTGGTTTTGG + Intronic
1087690234 11:101312526-101312548 GCTATGTCCTTTCCTGGTTTAGG + Intergenic
1088179807 11:107096288-107096310 GTTATGTTCTTTCCTGGTTTTGG - Intergenic
1088206739 11:107400737-107400759 GCTATGTCCTTTCCTGGTTTTGG - Intronic
1089721336 11:120425711-120425733 TCTTTGTTCTGGCCTGGTTTGGG + Intronic
1090545319 11:127759346-127759368 GTTATTTTCTTTCCTGGATTTGG + Intergenic
1090936785 11:131350168-131350190 GATTTTTGCTTCCCTGGATTAGG - Intergenic
1091533274 12:1380729-1380751 TCTTTTTTGTCACCTGCTTTGGG + Intronic
1092911447 12:13148569-13148591 GCTTTTTCCTTACAGGTTTTTGG - Intergenic
1093026614 12:14251225-14251247 TCTTTTCCCTTACCTGGATTAGG - Intergenic
1093287478 12:17282515-17282537 GTTATGTTCTTTCCTGGTTTTGG - Intergenic
1093408907 12:18841708-18841730 GCTATGTCCTTTCCTGGTTTTGG + Intergenic
1093964046 12:25306727-25306749 GTTATATTCTTTCCTGGTTTTGG - Intergenic
1095176603 12:39099436-39099458 GTTATATTCTTTCCTGGTTTTGG - Intergenic
1097547418 12:61022135-61022157 GTTATGTTCTTTCCTGGTTTTGG + Intergenic
1097611157 12:61822884-61822906 TCTTTTTCCTTTCCTGGTTGAGG - Intronic
1098071250 12:66677423-66677445 GTTCTTTTCTGACCTGATTTTGG - Intronic
1098257360 12:68630640-68630662 GCTTTTTGCTTTTTTGGTTTTGG + Intronic
1098784602 12:74735571-74735593 GCTTTTCTCTTACCTCCTATAGG + Intergenic
1099283648 12:80686992-80687014 GCTTTTTTCGTAATTGCTTTTGG - Intergenic
1099533233 12:83813526-83813548 GGTTTTTTTTTAAGTGGTTTTGG - Intergenic
1099860186 12:88216801-88216823 GTTTTTTCCTTGTCTGGTTTTGG - Intergenic
1100084580 12:90893637-90893659 CCTTTTTTCTTTCCTGGATTTGG - Intergenic
1100542539 12:95571708-95571730 GCTTTTATCTTTACTGTTTTGGG - Intergenic
1101523744 12:105508270-105508292 TGATTTCTCTTACCTGGTTTTGG - Intergenic
1106751503 13:32774377-32774399 GCTTGTTTCTTAAAGGGTTTTGG + Intronic
1106759315 13:32852152-32852174 TCTTGTTTATTACCTGGGTTAGG + Intergenic
1107608577 13:42088692-42088714 TCTTTTTTCTTGCCTTCTTTTGG - Intronic
1107755680 13:43619720-43619742 GCTATATTCTTTCTTGGTTTTGG + Intronic
1107757562 13:43641291-43641313 TCTTGTTTCTTACCTGCTTTGGG - Intronic
1108018861 13:46104725-46104747 TCTTTTTTCTTTCCTGGCTCTGG - Intronic
1108099374 13:46937295-46937317 GCTACATTGTTACCTGGTTTGGG + Intergenic
1108801477 13:54101473-54101495 TCTTTTTTCCTCCATGGTTTTGG - Intergenic
1108985637 13:56583650-56583672 TCTTTTTTTCTACCTTGTTTTGG + Intergenic
1109002305 13:56820999-56821021 TCTTTTTGCTTACTTGGCTTTGG + Intergenic
1109157734 13:58931730-58931752 GCTTTTTTCTTAATTGGACTTGG - Intergenic
1109862124 13:68213529-68213551 TCTTTTTTCTAACTAGGTTTAGG + Intergenic
1109917602 13:69011931-69011953 TCTTTTATTTTACCTAGTTTGGG + Intergenic
1110647163 13:77901045-77901067 TGTATTTTCTTACCTGCTTTAGG + Exonic
1111157289 13:84344619-84344641 GCTATGTCCTTTCCTGGTTTTGG + Intergenic
1112165488 13:96914721-96914743 GTTGTGTTCTTGCCTGGTTTTGG + Intergenic
1112826886 13:103401820-103401842 GCTTTATTGTCACCTTGTTTAGG + Intergenic
1112942742 13:104885070-104885092 GCTTTTTGCTTACCTGTTGTTGG - Intergenic
1113637854 13:111933308-111933330 GTTATTTCCTTTCCTGGTTTTGG + Intergenic
1114286627 14:21250789-21250811 CCTTTTTTATTACTTGGCTTGGG - Intronic
1114597068 14:23922070-23922092 GGTATTTTATTCCCTGGTTTTGG - Intergenic
1115128112 14:30020552-30020574 GATTTTTTTTCACCTTGTTTAGG + Intronic
1115958991 14:38813425-38813447 GTTATTTTCTTTTCTGGTTTTGG - Intergenic
1118568333 14:67167354-67167376 GCTTTTTTATTTGTTGGTTTGGG + Intronic
1120431021 14:84415613-84415635 GTTTTATCCTTGCCTGGTTTTGG + Intergenic
1120736063 14:88054214-88054236 GTTATGTTCTTCCCTGGTTTTGG + Intergenic
1120852378 14:89183129-89183151 GCTTTTTGTTTGCCTGTTTTGGG + Intronic
1121247904 14:92476038-92476060 GCCTTTTTCTTGCCTGCTATGGG - Intronic
1121589058 14:95085649-95085671 ACTTTTTTCTCATCTAGTTTAGG + Intergenic
1122432165 14:101659542-101659564 GCTTTTTTTTTTCTTGTTTTTGG + Intergenic
1123860908 15:24465726-24465748 GCTTTTTTTTTTTCTTGTTTTGG + Intergenic
1124131013 15:26985655-26985677 GCATTTTTCTGAGCTGGTCTTGG + Intronic
1126039146 15:44573929-44573951 GCCTTTCTTTTACCTGGATTTGG - Intronic
1126254644 15:46611699-46611721 ACTTTTTTCCTGCCTGATTTTGG + Intergenic
1126332279 15:47546171-47546193 TCTTTTTACTTCCATGGTTTTGG - Intronic
1126385524 15:48089556-48089578 TCTTTGTTCTTCCCTGGTTAGGG - Intergenic
1126516507 15:49544973-49544995 GTTATGTTCTTTCCTGGTTTTGG + Intronic
1126881617 15:53104960-53104982 GCTAATTTCTTACCTTGTGTAGG - Intergenic
1127249461 15:57216067-57216089 GGCTTTTTCTTGCCTAGTTTAGG + Intronic
1127364725 15:58277495-58277517 GCTTTTCTGTTACTAGGTTTGGG + Intronic
1127406175 15:58649143-58649165 ACTTCTTTCTTGCCTTGTTTTGG + Intronic
1127769576 15:62220322-62220344 GCCTTTTTCTTAGGTGTTTTTGG - Intergenic
1129106954 15:73317079-73317101 GCCTTTTTATTACCTGCATTAGG - Intergenic
1129489209 15:75906646-75906668 TCTTTCTCCTTACCTTGTTTGGG + Intronic
1129863274 15:78880871-78880893 TTTTTTTTTTTTCCTGGTTTTGG + Intronic
1129919416 15:79307337-79307359 GCTGGTTTCTCACCTAGTTTGGG + Intergenic
1130921760 15:88352111-88352133 GCTTTTTAGTGACCTGATTTCGG + Intergenic
1131214723 15:90527721-90527743 GCTTTTCTGTTACATTGTTTGGG - Intergenic
1131435444 15:92418138-92418160 TCTTATTTCTGACTTGGTTTTGG - Intronic
1131683542 15:94748514-94748536 GCTTTTGTTTTGCCTTGTTTTGG - Intergenic
1132033704 15:98461149-98461171 GCTATGTCCTTTCCTGGTTTTGG - Intronic
1132750640 16:1455881-1455903 GCTTCTTTCTGACGTGGTCTGGG - Intronic
1137066106 16:35845437-35845459 TTTTCTTTTTTACCTGGTTTTGG - Intergenic
1137414288 16:48258908-48258930 GCATTTTTCTCACTTTGTTTTGG + Intronic
1137824831 16:51483388-51483410 GCTTGTTTCTTTCCATGTTTAGG + Intergenic
1137867211 16:51912377-51912399 ATTTTTTACTTACCTCGTTTGGG + Intergenic
1138192406 16:55025450-55025472 GTTATTTTCTTCCCTGGTTTTGG - Intergenic
1138753542 16:59454216-59454238 GTTTCTGTCTTACCTGATTTTGG - Intergenic
1138826173 16:60323105-60323127 GCTTTTGTCTTAATTGCTTTTGG + Intergenic
1140160424 16:72485490-72485512 GCTTTTTTTTTACTTTCTTTAGG + Intergenic
1140344609 16:74200852-74200874 GCTGTTTTTTACCCTGGTTTAGG - Intergenic
1144417036 17:15058450-15058472 GCTTTTTTCTTGTCTTCTTTGGG - Intergenic
1145927809 17:28660615-28660637 GCTTATTTTTTACTTTGTTTTGG - Intronic
1147340949 17:39753117-39753139 ACTTTGTTCTTACTTGGATTAGG + Intergenic
1148287529 17:46408376-46408398 ACTTTTTAGTTACCTGGTATAGG + Intergenic
1148309698 17:46625954-46625976 ACTTTTTAGTTACCTGGTATAGG + Intronic
1148937937 17:51179581-51179603 GCTTTTATCTATCCTGGATTTGG - Exonic
1149935008 17:60796198-60796220 GTTTTATCCTTCCCTGGTTTTGG + Intronic
1150584049 17:66501583-66501605 GCTGTCTTCTTACCTGGTGTTGG + Intronic
1150588045 17:66536053-66536075 TTCTGTTTCTTACCTGGTTTTGG + Intronic
1152147553 17:78577342-78577364 GCCATTTTCTTTCCTGGTTTGGG - Exonic
1152180667 17:78819464-78819486 ATTTTTTACTTAACTGGTTTTGG - Intronic
1153330079 18:3864593-3864615 TCCTTCTTCTTAGCTGGTTTTGG - Intronic
1153396103 18:4622698-4622720 GTTATGTCCTTACCTGGTTTTGG + Intergenic
1154298655 18:13173713-13173735 GCTGTGTTCCTTCCTGGTTTGGG - Intergenic
1155134109 18:22970876-22970898 TATATTTTCTTACCTTGTTTAGG + Intronic
1155743902 18:29325853-29325875 GATTTTCTCTTTCTTGGTTTTGG + Intergenic
1156064605 18:33125052-33125074 GATTTTTTTTTTCCTGTTTTTGG + Intronic
1156192911 18:34740409-34740431 GCTGTGTTCTTACCAGGTTGAGG + Intronic
1156575722 18:38312719-38312741 GCTCTCTTCTAATCTGGTTTGGG + Intergenic
1156976372 18:43226207-43226229 GTTATGTTCTTTCCTGGTTTTGG - Intergenic
1157071157 18:44410269-44410291 GGTCTTTTCTGACCTGATTTTGG - Intergenic
1157525651 18:48378452-48378474 TCTTTCTTCTTAGCTGGGTTGGG - Intronic
1157976103 18:52328764-52328786 GCTTTTTTCTTAACTTCTTTGGG - Intergenic
1158024636 18:52881016-52881038 GCATTTTTATTACCTGTCTTTGG + Intronic
1158100045 18:53820107-53820129 GCTTTTTTCTCATCTGGGTGGGG - Intergenic
1158358944 18:56650544-56650566 ACTTTTTTATTACCTGGTCTAGG + Intronic
1159526542 18:69599225-69599247 GTTTTTTTCTTTACTGTTTTTGG + Intronic
1159638264 18:70832627-70832649 GTTTTGTCCTTATCTGGTTTTGG + Intergenic
1159719260 18:71865928-71865950 GCCTGATTCTTACCTGGTTGGGG - Intergenic
1160038826 18:75325218-75325240 GCTTTTTTCCTTCCTGTTTAAGG + Intergenic
1160597116 18:79983536-79983558 GGTGTTTTCTTAGCTGGTTGAGG - Intronic
1162282532 19:9710547-9710569 TCCTTTTTCTTACCTTGTTTGGG - Intergenic
1164273513 19:23695648-23695670 GCTATGTTCTTTCCTGGTTTTGG + Intergenic
1164298910 19:23941447-23941469 GGTTTTGTCTTTTCTGGTTTTGG + Intronic
925155138 2:1643319-1643341 TCCTTTTTCATCCCTGGTTTTGG - Intronic
925637599 2:5955994-5956016 GTTATTTCCTTTCCTGGTTTTGG + Intergenic
926194711 2:10755731-10755753 GCATTTCTCATACCTGATTTGGG - Intronic
926560483 2:14411686-14411708 GTTATCTTCTTTCCTGGTTTTGG - Intergenic
927355541 2:22168806-22168828 GTTATGTTCTTTCCTGGTTTTGG - Intergenic
930114655 2:47708161-47708183 GCCTTCTTTTTTCCTGGTTTAGG + Intronic
930423357 2:51181145-51181167 TTTTATTTCTTTCCTGGTTTTGG - Intergenic
930562024 2:52971654-52971676 GCTTGGTTCTTAACTTGTTTTGG + Intergenic
931517296 2:63057473-63057495 GTTGTTTTGTTCCCTGGTTTTGG - Exonic
931689869 2:64826423-64826445 GTTTTTCTTTTACCTGGCTTAGG - Intergenic
933266828 2:80189737-80189759 GTTTTTTTTTTAACTGGTTGAGG - Intronic
933597616 2:84298005-84298027 GCCTTTTTCTTACTTGGTGAAGG + Intergenic
934135040 2:88987474-88987496 CCTTTTTTCCTACATGGTGTTGG - Intergenic
934894914 2:98108917-98108939 GTTTTTTTCCTACCTGCTTTTGG + Intronic
935610097 2:105013918-105013940 GTTATGTTCTTTCCTGGTTTTGG + Intergenic
937828664 2:126396115-126396137 GTTATGTTCTTTCCTGGTTTTGG + Intergenic
937978862 2:127599968-127599990 TCTTTTGTCTTGTCTGGTTTTGG + Intronic
939145835 2:138413642-138413664 TCTATTTTCTTACCTAGATTTGG + Intergenic
939484952 2:142799479-142799501 GTTTCTTTCTTACCAGCTTTTGG - Intergenic
940053090 2:149484730-149484752 CTTTTTATCTTACCTTGTTTTGG - Intergenic
940125719 2:150321730-150321752 GCTTTTTTGTTACCTAGTTTGGG + Intergenic
940126007 2:150325386-150325408 GCTTTTTTGTTGCCTAGTTTGGG - Intergenic
940534404 2:154921619-154921641 GCATCTCTCTTACCTTGTTTTGG + Intergenic
940762695 2:157754781-157754803 GTTATGTTCTTTCCTGGTTTTGG - Intronic
941661351 2:168198530-168198552 CTTTTTTACTTACTTGGTTTGGG - Intronic
941972775 2:171370092-171370114 CCTTTTTTCCTGCCTGCTTTTGG - Intronic
942000072 2:171637369-171637391 GTTCTTTTAATACCTGGTTTGGG + Intergenic
942154421 2:173112886-173112908 GTTATATTCTTTCCTGGTTTTGG + Intronic
943265920 2:185732290-185732312 TCTTATTTCTTCCCTGCTTTTGG - Intergenic
943281501 2:185940359-185940381 TCTTTTTTTTTAACTGTTTTTGG + Intergenic
943783583 2:191851190-191851212 GCTTTTTTCCTACCACCTTTTGG - Intergenic
945006342 2:205411564-205411586 GTTATTTTCTGACCTGCTTTGGG + Intronic
945549994 2:211209405-211209427 GCATTTTTCTTGAATGGTTTTGG + Intergenic
945959060 2:216113303-216113325 TATTTTTTCTTCCCTCGTTTTGG + Intronic
948511731 2:238471045-238471067 GTTGTGTTCTTATCTGGTTTTGG + Intergenic
1170435589 20:16324820-16324842 GTTATGTTCTTTCCTGGTTTTGG - Intronic
1172016749 20:31880051-31880073 GCTTTTTTTCTTCCTGTTTTCGG - Intronic
1172607144 20:36221709-36221731 GATTTTTTCTTTTCTGATTTTGG - Intronic
1175163863 20:57029382-57029404 GCTTTTGCCTTACCTGCTCTGGG + Intergenic
1175394037 20:58646432-58646454 GCTTTTTTCTTTCCAGGACTTGG - Intergenic
1175769499 20:61614681-61614703 GCTTTTTTCTTACATTCTCTGGG - Intronic
1177011672 21:15737867-15737889 GTATTTTGCTTACCTGGGTTGGG + Intronic
1177329129 21:19633295-19633317 GTTATTTCCTTTCCTGGTTTTGG - Intergenic
1177853101 21:26372069-26372091 GCTGATCTCTTCCCTGGTTTGGG + Intergenic
1180175681 21:46086440-46086462 GTGTTTTTCTTTTCTGGTTTGGG - Intergenic
1181122058 22:20676870-20676892 GTTATGTTCTTTCCTGGTTTTGG + Intergenic
1181717323 22:24740932-24740954 GTTTTCTTCTTTCTTGGTTTTGG - Intronic
1183078530 22:35441789-35441811 GCTTTTTCCTTCCCTGGCCTGGG - Intergenic
1184160002 22:42692407-42692429 GCTTTGTTCTTTTCTGGTTTTGG - Exonic
949327065 3:2878516-2878538 GTTGTTCTCTTACCTGCTTTAGG - Intronic
949367061 3:3293394-3293416 TCTTTTTTCCTACCTCCTTTGGG - Intergenic
949747350 3:7310414-7310436 GCTTTGTTCTTTCCAGTTTTAGG - Intronic
950056674 3:10030572-10030594 GCCTATTCCTTACATGGTTTTGG - Intronic
950981431 3:17310701-17310723 ATTTTTTTCTTATGTGGTTTTGG - Intronic
951209836 3:19963309-19963331 GCTTTTTTGTTTGCTGTTTTAGG + Intronic
952083167 3:29785188-29785210 GCTATGTTCTTCCCTGGTTTTGG - Intronic
952143617 3:30506673-30506695 GCTGTGTTCTTGTCTGGTTTTGG - Intergenic
952199762 3:31114111-31114133 TCTTTTTTCTTATGTGGTCTGGG + Intergenic
952685183 3:36139438-36139460 CCTTTTTTCTTGCCTGGCTGTGG - Intergenic
952804596 3:37336448-37336470 GCTATTTTCTTACCTTTCTTAGG - Intronic
953546209 3:43865356-43865378 GCTGTTTTCTTTCCTGTTTGGGG - Intergenic
954517666 3:51193387-51193409 GTTGTGTTCTTGCCTGGTTTTGG + Intronic
955477235 3:59350272-59350294 GTTATTTTCTTTCCTGGTTTTGG + Intergenic
955722187 3:61894340-61894362 GCTTTTATCTTATCTGGTGCTGG + Intronic
956559785 3:70562452-70562474 GCTATGTTCTTGCCTGATTTTGG + Intergenic
957702293 3:83730934-83730956 CCTCTTTTCTTACCTTCTTTGGG + Intergenic
957772387 3:84711078-84711100 GCTATGTTCTTTTCTGGTTTTGG - Intergenic
957960553 3:87245399-87245421 CCTTTTCTCTTACCTTCTTTTGG + Intronic
958268995 3:91475126-91475148 GGCTTTTTATTACCTGTTTTTGG - Intergenic
958480495 3:94640180-94640202 GTTATCTTCTTTCCTGGTTTGGG + Intergenic
959185953 3:103048581-103048603 TCTTTATTCTTAAGTGGTTTTGG + Intergenic
959625473 3:108444895-108444917 TCTTTTTTCTTTCTTGATTTAGG - Exonic
960486881 3:118263354-118263376 TCTTTTTTGTTTCCTGCTTTAGG - Intergenic
961851231 3:129821060-129821082 GTTTTTTTCTTATGTGTTTTAGG + Intronic
962105609 3:132385600-132385622 TTTTTTTTCTTACCTTTTTTTGG + Intergenic
962121378 3:132564234-132564256 GGTTTGTTCTTGTCTGGTTTTGG + Intronic
962186212 3:133262545-133262567 GCTTTTATCTTCACTGCTTTGGG + Intronic
962371150 3:134821850-134821872 CCTTTTTTCCAACCTGGGTTTGG + Intronic
963213557 3:142720694-142720716 GTTATGTTCTTTCCTGGTTTTGG - Intergenic
964005773 3:151826685-151826707 CCTTTTTTCCTCCCTGGTATTGG + Intronic
964047764 3:152351078-152351100 ACTTTTTTTTTTCCTGTTTTTGG + Intronic
965714870 3:171592108-171592130 CTTTTTTTCTTAACTAGTTTTGG - Intergenic
966534228 3:181013670-181013692 CCTTTTTTCTTGCCTTCTTTTGG + Intergenic
966552990 3:181226364-181226386 GTTATGTTCTTTCCTGGTTTTGG + Intergenic
968595798 4:1482811-1482833 TCATTTTTTTTGCCTGGTTTTGG + Intergenic
969089729 4:4684836-4684858 CCTTTTTTTTAACCAGGTTTGGG - Intergenic
970312363 4:14796421-14796443 GCTATGTTCTTTCCTGGTTTTGG - Intergenic
971721454 4:30250284-30250306 GCTGTGTACTTTCCTGGTTTTGG + Intergenic
972097056 4:35361195-35361217 GTTATTTCCTTTCCTGGTTTTGG + Intergenic
972285203 4:37641710-37641732 ACATTTTTCTTGCCTGATTTTGG - Intronic
972514699 4:39800841-39800863 GTTTTTTTCTTTCCTTTTTTTGG - Intergenic
972765207 4:42146519-42146541 GCTTTCTTATTATTTGGTTTTGG - Intronic
972806759 4:42536621-42536643 GTTTTATCCTTTCCTGGTTTTGG - Intronic
972927364 4:44027206-44027228 GTTTTGTTCTTGTCTGGTTTTGG - Intergenic
973839793 4:54849779-54849801 GCTTATTTGTAACCTGGTTTGGG - Intergenic
974357389 4:60830888-60830910 TCTTTTTTCTTACCTGTCTTTGG + Intergenic
975199478 4:71569155-71569177 GATTTTTTCATATGTGGTTTGGG - Exonic
975243519 4:72091300-72091322 GTATTATTCTTTCCTGGTTTTGG + Intronic
975790240 4:77941337-77941359 GTTATGTTCTTTCCTGGTTTTGG + Intronic
975848756 4:78550818-78550840 ACTTTTTACTTACGTGGTCTCGG + Intergenic
978483534 4:109223526-109223548 ACTCTTTTCTGACTTGGTTTTGG - Intronic
978916414 4:114131024-114131046 GTTATGTTCTTCCCTGGTTTAGG - Intergenic
978917269 4:114142509-114142531 GTTATGTTCTTTCCTGGTTTTGG + Intergenic
978993810 4:115124052-115124074 CCTTTTTTTTTACCCTGTTTAGG + Intergenic
979068460 4:116169284-116169306 TCTTCTTGCTTTCCTGGTTTTGG + Intergenic
979705242 4:123713039-123713061 GTTTTGTCCTTTCCTGGTTTAGG - Intergenic
979799983 4:124896452-124896474 ACTTTTTTTTTCCCTGGTCTAGG + Intergenic
980254854 4:130365924-130365946 TCTTTTTACTTACATAGTTTAGG - Intergenic
980314643 4:131181949-131181971 TTTTTAGTCTTACCTGGTTTTGG - Intergenic
980409694 4:132400712-132400734 TTTTTTGTCTTCCCTGGTTTTGG + Intergenic
980543795 4:134230591-134230613 GTTATGTTCTTTCCTGGTTTTGG + Intergenic
981015099 4:139966045-139966067 GCTTTTTATTTGCTTGGTTTTGG - Intronic
981166095 4:141559274-141559296 GCTTTGTCCTTATCTGGCTTTGG - Intergenic
981346774 4:143684940-143684962 TCTTTTTTCTTTCTTGGATTGGG - Intronic
982679808 4:158415605-158415627 TTTTGATTCTTACCTGGTTTTGG + Intronic
982830069 4:160048031-160048053 GTTATGTTCTTCCCTGGTTTTGG - Intergenic
983488954 4:168365695-168365717 GCTGTATCCTTATCTGGTTTTGG - Intronic
984402567 4:179286113-179286135 GCTTTATTCATACGTCGTTTGGG + Intergenic
984516575 4:180748829-180748851 GCTTTTTCCTTACCTTGCTTAGG - Intergenic
986857303 5:11885132-11885154 GCTGTTTCCTTGTCTGGTTTTGG + Intronic
987217346 5:15750680-15750702 GCATTTTTTTTTCCTGTTTTGGG + Intronic
987672630 5:21031764-21031786 GCTTTTCTCTTTCTTGCTTTTGG - Intergenic
988002478 5:25366329-25366351 GTTTTGTCCTTTCCTGGTTTTGG - Intergenic
989054981 5:37358068-37358090 TTTTATTTCTTACCTGCTTTTGG + Exonic
989192190 5:38681636-38681658 ACTTATTTCTTAACTGGTTTTGG - Intergenic
989514944 5:42331237-42331259 GTTTTTTTCTTAGCAGTTTTAGG + Intergenic
989637700 5:43554581-43554603 CCTTTTTTATTACCTCTTTTTGG - Intronic
990918415 5:60935998-60936020 TCTTTGTTCTTTCCTGGTTTTGG + Intronic
991924179 5:71687590-71687612 GCTATGTTCTTTCCTTGTTTTGG - Intergenic
992987993 5:82253420-82253442 GCTTTTCTTTTACCTTGTTAAGG - Exonic
993401680 5:87460994-87461016 GTTATGTTCTTTCCTGGTTTGGG - Intergenic
993614055 5:90088469-90088491 GTTATGTTCTTTCCTGGTTTAGG - Intergenic
993948273 5:94141013-94141035 GTTATGTTCTTTCCTGGTTTTGG + Intergenic
995228965 5:109736660-109736682 GCTTTTTTGTTACTTGTTTTGGG + Intronic
995293451 5:110487771-110487793 GTTATTTCCTTTCCTGGTTTTGG + Intronic
995351379 5:111179777-111179799 GTTATGTTCTTTCCTGGTTTTGG + Intergenic
995505271 5:112853639-112853661 GCTTTTTTAATGCCTGGTCTTGG - Intronic
995654981 5:114415909-114415931 GCTTTTTTCCTGCATGGCTTTGG - Intronic
995955624 5:117773077-117773099 GCTATATCCTTTCCTGGTTTTGG - Intergenic
996198124 5:120635288-120635310 GTTATGTTCTTTCCTGGTTTTGG - Intronic
996325720 5:122270726-122270748 GCTATGTCCTTCCCTGGTTTTGG - Intergenic
996584071 5:125065087-125065109 CCTTTTTTCTTCCCAGGGTTTGG + Intergenic
996602363 5:125279163-125279185 GCAATTTCCTTACCTTGTTTTGG + Intergenic
996757104 5:126946686-126946708 GTTGTTCTCTTTCCTGGTTTTGG - Intronic
997680398 5:135746242-135746264 GCCTTTTTCTTACCCGGGTCTGG + Intergenic
998532021 5:142894159-142894181 TTTTTTTTCTGACCTGCTTTCGG + Intronic
999677437 5:154018579-154018601 GTTATGTTCTTTCCTGGTTTTGG - Intronic
999845566 5:155475716-155475738 GCTTTTTTCCTCCCAGGGTTTGG + Intergenic
1000278833 5:159764436-159764458 GCCTGTTTCCTGCCTGGTTTTGG + Intergenic
1000693554 5:164352196-164352218 GCATTTTTCATAAGTGGTTTTGG - Intergenic
1000820594 5:165978260-165978282 GCTTTATTATTTCCAGGTTTTGG - Intergenic
1003269762 6:4597721-4597743 GTTATGTTCTTTCCTGGTTTTGG + Intergenic
1003573321 6:7270204-7270226 GCTATTTTTTTTCCTGGTTTGGG - Intronic
1004356001 6:14930523-14930545 GCCTTTTTCTTATCTGGTATTGG - Intergenic
1004526822 6:16416884-16416906 GCTTTTATCTTGCATGGTGTAGG + Intronic
1004614659 6:17279140-17279162 CCTTTCTTCCTACCTGGATTGGG - Intergenic
1004788049 6:18990875-18990897 GCTTGTTTCATTCTTGGTTTCGG + Intergenic
1004902731 6:20209053-20209075 GCACTTTTCTTTCCTGTTTTGGG - Intronic
1006978946 6:38130781-38130803 GTTATGTTCTTTCCTGGTTTTGG + Intronic
1007051031 6:38830037-38830059 CCTTTATTCTTACTTAGTTTAGG + Intronic
1007344735 6:41220895-41220917 GGTGTATCCTTACCTGGTTTTGG + Intergenic
1008128630 6:47695747-47695769 GCTTTTTTGATACCTGGGATTGG + Intronic
1008393719 6:50982442-50982464 GCTTTTTTCTCCCCTGTTATAGG + Intergenic
1008986237 6:57546610-57546632 GGCTTTTTATTACCTGTTTTTGG + Intronic
1009174195 6:60439165-60439187 GGCTTTTTATTACCTGTTTTTGG + Intergenic
1009402028 6:63268169-63268191 GCTTCTGTCTTATATGGTTTGGG - Intergenic
1009961857 6:70532624-70532646 GTTTGTTTCTTAGGTGGTTTTGG - Intronic
1010410038 6:75550910-75550932 TATTTTTTCTTCTCTGGTTTTGG - Intergenic
1010619154 6:78053042-78053064 TCTCTTTTCTTACCAGGATTTGG + Intergenic
1010817235 6:80372918-80372940 GTTATGTTCTTTCCTGGTTTTGG + Intergenic
1011150806 6:84271146-84271168 GTTTCTTTCTTAACTGGTGTAGG + Intergenic
1011327450 6:86165109-86165131 GCTATGTCCTTTCCTGGTTTTGG - Intergenic
1011882500 6:92047390-92047412 GTTTCTTTCTTATCAGGTTTAGG - Intergenic
1012292096 6:97469264-97469286 CCTTTTTTCTTTCTTTGTTTTGG + Intergenic
1012298955 6:97560449-97560471 GTTATGTTCTTTCCTGGTTTTGG + Intergenic
1012314184 6:97764957-97764979 GATTTCTTTTTTCCTGGTTTGGG + Intergenic
1012485531 6:99717833-99717855 GATTTGTTCTTGTCTGGTTTTGG + Intergenic
1012636474 6:101548880-101548902 GCTTTTTTCTTACCTCTGTATGG + Intronic
1012717264 6:102691437-102691459 GTTATGTTCTTCCCTGGTTTTGG + Intergenic
1013086250 6:106860324-106860346 GCATTTTTTTTTCCTGGTTTTGG - Intergenic
1013377138 6:109528520-109528542 GGTTTTTTCTTATCTACTTTTGG + Intronic
1013947632 6:115741004-115741026 GCTCTTTTCTTGCCTTGCTTGGG - Intergenic
1014326029 6:119995000-119995022 GCTTTGCTCTTACATTGTTTGGG - Intergenic
1014522297 6:122459495-122459517 GCTTTATTCTTACCTTATATTGG - Intronic
1014658512 6:124136529-124136551 GTTATTTCCTTTCCTGGTTTTGG - Intronic
1015250199 6:131119434-131119456 GCTTTATTTTTACCTCTTTTGGG - Intergenic
1017214643 6:151896152-151896174 GTTTTGTTCTTTCTTGGTTTTGG + Intronic
1017466871 6:154702654-154702676 GTTTTTTTCTTACCTGCTAGTGG + Intergenic
1019653795 7:2175979-2176001 CCTTTTTTCCTGCCTGATTTTGG - Intronic
1021255641 7:18389148-18389170 GTTTTTTTGCTACCTGATTTTGG + Intronic
1024605553 7:51019928-51019950 TTTTTTCTCTTTCCTGGTTTGGG + Intronic
1025105956 7:56172260-56172282 GCTATTTTTTTACTTTGTTTTGG - Intergenic
1027407398 7:77876152-77876174 ACTTTTTTCTTACCTGGCTTTGG + Intronic
1028075751 7:86513005-86513027 TCTTTTTTCTTTTCTGGTTTTGG + Intergenic
1028999580 7:97139130-97139152 GCCTTTTTCCTACCTGTGTTCGG + Intronic
1030027497 7:105338888-105338910 GCTTCTTTCTAACCTGTTTGGGG + Intronic
1030403983 7:109087517-109087539 GCTTTTGGCTTGCCTGTTTTTGG - Intergenic
1031148100 7:118019810-118019832 GCTATGTCCTTTCCTGGTTTTGG - Intergenic
1031297998 7:120028287-120028309 GCTTTTTGCTTGCCTGTTGTTGG + Intergenic
1032289261 7:130572998-130573020 CCCTTTTTCATCCCTGGTTTTGG - Intronic
1035489977 7:159266898-159266920 GTTGTGTTCTTATCTGGTTTTGG + Intergenic
1036083282 8:5581857-5581879 GCTTTTTTCTCATCTATTTTAGG + Intergenic
1037978312 8:23230298-23230320 GCTTTTTTTTTTCCTAGTTGGGG + Intergenic
1038007843 8:23448678-23448700 CCTTCTGTCTTACCTGTTTTAGG - Intronic
1038534819 8:28346494-28346516 GCTTTGTTCTTACTAGGTTTTGG - Exonic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1040919000 8:52596138-52596160 TTTTTTTTCTGACCTGTTTTAGG + Intergenic
1041499733 8:58527563-58527585 GCTATTTTCTGACTTTGTTTTGG - Intergenic
1041832304 8:62168200-62168222 GCTATGTCCTTCCCTGGTTTTGG - Intergenic
1042473700 8:69220703-69220725 GCTTTTTTCGCAACTGCTTTTGG - Intergenic
1043361978 8:79483682-79483704 GCTTTTTTCTTTAGAGGTTTAGG - Intergenic
1043672052 8:82898724-82898746 GTTATGTTCTTTCCTGGTTTTGG + Intergenic
1043862081 8:85330935-85330957 GTAGTTTTCATACCTGGTTTTGG + Intronic
1044136604 8:88593534-88593556 GCTTTTTTCTTTCCAGTTTAAGG + Intergenic
1044493619 8:92849943-92849965 GCTCTTTTCTTACATGATTATGG - Intergenic
1045168152 8:99630415-99630437 GCTTCTTTCTGTCCTGGTTTAGG + Intronic
1045731886 8:105251947-105251969 GCATTTTTCTTGCCTGATTTTGG + Intronic
1045779636 8:105848375-105848397 GCTTCTATCTTACCTGCCTTAGG + Intergenic
1045812306 8:106236736-106236758 AATTTTTTGTTACCTGGATTTGG - Intergenic
1045952055 8:107863662-107863684 GTTATGTTCTTTCCTGGTTTGGG + Intergenic
1046441176 8:114256378-114256400 GCTTTTTTCTTACTGCTTTTAGG - Intergenic
1046692433 8:117300875-117300897 GCTGTCTTCTTTCCTGGTCTTGG + Intergenic
1046797739 8:118390853-118390875 GATTTTTTTTTACCTGTCTTGGG + Intronic
1046895726 8:119470264-119470286 GCTTTTTTATGACCTAGCTTCGG - Intergenic
1046980834 8:120335031-120335053 GCTTTTTCCTAGCCTGGGTTAGG - Intronic
1047022453 8:120789908-120789930 GTTATATTCTTTCCTGGTTTTGG - Intronic
1048382597 8:133880486-133880508 GGTTTTTTCATAGCTGGTTAAGG + Intergenic
1048430964 8:134370267-134370289 GCTTTTTCTTTACCTGAGTTGGG + Intergenic
1048646249 8:136423404-136423426 CTTTTTTCCTTCCCTGGTTTTGG - Intergenic
1048712392 8:137226843-137226865 GCTTTCTTCATACCTGCATTCGG + Intergenic
1049515969 8:143056127-143056149 TCTTTTTTCTTTTCTGTTTTTGG + Intronic
1049974865 9:851827-851849 GTTATTTTCTTACATGATTTTGG + Intronic
1052253107 9:26423406-26423428 GCATTTTTGTGACCTGGTTTAGG + Intergenic
1052351890 9:27466582-27466604 CCTTTTTTCTTCCCAGTTTTGGG - Intronic
1052448083 9:28589850-28589872 GCTTTTTTCTTTTTTGGCTTAGG - Intronic
1052453544 9:28664081-28664103 GCTTTATTCTTAACAGGATTTGG + Intronic
1052629106 9:31014327-31014349 GTTTTGTCCTTTCCTGGTTTTGG - Intergenic
1052708754 9:32025591-32025613 GTTTTATCCTTTCCTGGTTTTGG + Intergenic
1053028932 9:34757992-34758014 TATTGTTTCTTAGCTGGTTTTGG + Intergenic
1055125044 9:72709331-72709353 GTTTTGTTCTTTCCTGGTTTTGG + Intronic
1055481614 9:76713916-76713938 ACTCCTTTCTTACATGGTTTGGG - Intronic
1055905503 9:81289228-81289250 GCTATGTCCTTTCCTGGTTTTGG + Intergenic
1056431264 9:86530309-86530331 GCCTTTTTATTGCCTGATTTGGG - Intergenic
1056531725 9:87494009-87494031 GCTTTTTTGTAACATGGCTTTGG - Intergenic
1056713720 9:89011680-89011702 GCTGTTTTCTGAAATGGTTTTGG - Intergenic
1057959900 9:99445105-99445127 GCATTTTTCTTTCCTAGTGTGGG + Intergenic
1058264990 9:102888226-102888248 GCTCTTTTCTTACTTAGTATTGG - Intergenic
1061835948 9:133329848-133329870 CCCTTTCTCTTACCTAGTTTTGG + Intergenic
1187639239 X:21269803-21269825 GTTTTGTTCTTGTCTGGTTTTGG - Intergenic
1188569699 X:31568837-31568859 TCTTTTTTCTTACCTTCTTGTGG + Intronic
1188922229 X:35990764-35990786 CCTTTTGCCTTACCTAGTTTGGG + Intergenic
1189705908 X:43758543-43758565 GCTTTTTTTTTACTTCATTTAGG + Intergenic
1189769194 X:44406048-44406070 GTTGTGTTCTTACCTGGTTTTGG + Intergenic
1189945713 X:46176035-46176057 GTTATGTTCTTTCCTGGTTTTGG + Intergenic
1190768809 X:53498201-53498223 GCTTTTTTCTTTCCTGGCAAGGG - Intergenic
1191913520 X:66177192-66177214 GTTATGTTCTTTCCTGGTTTTGG + Intronic
1192329704 X:70165451-70165473 TATTTTTTCTTTCCTGTTTTTGG + Intronic
1192673733 X:73172532-73172554 GCTGTGTCCTTTCCTGGTTTTGG + Intergenic
1192820539 X:74640357-74640379 GCTATGTCCTTTCCTGGTTTTGG - Intergenic
1192863459 X:75104717-75104739 GTTGTTTCCTTGCCTGGTTTTGG - Intronic
1192931631 X:75812641-75812663 GTTGTGTTCTTCCCTGGTTTTGG - Intergenic
1193015671 X:76730786-76730808 GTTATGTTCTTCCCTGGTTTTGG - Intergenic
1193245997 X:79230814-79230836 GCTTTTGTCTTCCGTGTTTTAGG + Intergenic
1193760229 X:85456140-85456162 TCTTTTTTCTTGCTTGCTTTTGG + Intergenic
1194076135 X:89396578-89396600 GTTATGTTCTTTCCTGGTTTTGG + Intergenic
1194165610 X:90511352-90511374 GTTATGTTCTTTCCTGGTTTTGG - Intergenic
1194516220 X:94857761-94857783 GTTATGTTCTTCCCTGGTTTTGG - Intergenic
1194848661 X:98844268-98844290 TTTTTTTCCTTATCTGGTTTTGG + Intergenic
1196263237 X:113610511-113610533 GCAATGTTCTTATCTGGTTTTGG + Intergenic
1197096414 X:122601602-122601624 GCTGTGTTCTTATCTGGTATTGG - Intergenic
1197307028 X:124855310-124855332 TCTCTTTTCTTACCTGATTTGGG + Intronic
1197476017 X:126926436-126926458 GGTTATTCCTTTCCTGGTTTTGG + Intergenic
1197511675 X:127376880-127376902 TGTTTTTTTTTTCCTGGTTTTGG - Intergenic
1197591354 X:128414859-128414881 GTTATGTTCTTTCCTGGTTTGGG + Intergenic
1197653370 X:129088871-129088893 GTTTTGTCCTTGCCTGGTTTTGG - Intergenic
1197956307 X:131952244-131952266 GTTTTGTCCTTTCCTGGTTTTGG - Intergenic
1197956462 X:131954649-131954671 GTTTTGTCCTTTCCTGGTTTTGG + Intergenic
1199101233 X:143802846-143802868 GCTTCTGTCTTAGTTGGTTTGGG + Intergenic
1199104289 X:143844004-143844026 GCTTTGTCCTTGTCTGGTTTTGG + Intergenic
1200340182 X:155388501-155388523 GTTATGTTCTTTCCTGGTTTTGG + Intergenic
1200428774 Y:3052100-3052122 GTTATGTTCTTTCCTGGTTTTGG + Intergenic
1200523312 Y:4239549-4239571 GTTTTGTCCTTGCCTGGTTTTGG + Intergenic
1201953250 Y:19588677-19588699 GTTTCTTTCTTACTTGGCTTTGG + Intergenic