ID: 920407573

View in Genome Browser
Species Human (GRCh38)
Location 1:205729335-205729357
Sequence GCTTTTTTCTTACCTGGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 435}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920407573_920407575 10 Left 920407573 1:205729335-205729357 CCAAAACCAGGTAAGAAAAAAGC 0: 1
1: 0
2: 3
3: 42
4: 435
Right 920407575 1:205729368-205729390 TTATTATCAATGATTTACCAAGG 0: 1
1: 0
2: 3
3: 18
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920407573 Original CRISPR GCTTTTTTCTTACCTGGTTT TGG (reversed) Intronic