ID: 920409658

View in Genome Browser
Species Human (GRCh38)
Location 1:205749608-205749630
Sequence CCCAAGAGGCCCCACCTCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 293}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920409658_920409668 17 Left 920409658 1:205749608-205749630 CCGAGGAGGTGGGGCCTCTTGGG 0: 1
1: 0
2: 4
3: 35
4: 293
Right 920409668 1:205749648-205749670 CCTCCCCCTCCGGCCGCTGGCGG 0: 1
1: 0
2: 1
3: 28
4: 317
920409658_920409673 23 Left 920409658 1:205749608-205749630 CCGAGGAGGTGGGGCCTCTTGGG 0: 1
1: 0
2: 4
3: 35
4: 293
Right 920409673 1:205749654-205749676 CCTCCGGCCGCTGGCGGCTCAGG 0: 1
1: 0
2: 3
3: 15
4: 190
920409658_920409663 7 Left 920409658 1:205749608-205749630 CCGAGGAGGTGGGGCCTCTTGGG 0: 1
1: 0
2: 4
3: 35
4: 293
Right 920409663 1:205749638-205749660 ACTTCACACCCCTCCCCCTCCGG 0: 1
1: 0
2: 1
3: 16
4: 218
920409658_920409674 24 Left 920409658 1:205749608-205749630 CCGAGGAGGTGGGGCCTCTTGGG 0: 1
1: 0
2: 4
3: 35
4: 293
Right 920409674 1:205749655-205749677 CTCCGGCCGCTGGCGGCTCAGGG 0: 1
1: 0
2: 0
3: 13
4: 110
920409658_920409664 14 Left 920409658 1:205749608-205749630 CCGAGGAGGTGGGGCCTCTTGGG 0: 1
1: 0
2: 4
3: 35
4: 293
Right 920409664 1:205749645-205749667 ACCCCTCCCCCTCCGGCCGCTGG 0: 1
1: 0
2: 3
3: 32
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920409658 Original CRISPR CCCAAGAGGCCCCACCTCCT CGG (reversed) Intronic
900645964 1:3708870-3708892 CCCACGAGGCCCCGCCTCCCCGG + Intronic
900700631 1:4046751-4046773 CCCAAGAGGCTGCATCTTCTTGG - Intergenic
901184980 1:7367151-7367173 CAAAAGAGGCTCCAGCTCCTTGG - Intronic
901229356 1:7633406-7633428 CCCCAGATGCCACCCCTCCTGGG + Intronic
901883031 1:12205069-12205091 CTCCAGAGCCCCCAGCTCCTGGG - Intronic
901932329 1:12603510-12603532 CCCACGTGGCCCTACCTTCTTGG + Intronic
902451115 1:16497825-16497847 TCCCAAAGGCCCCCCCTCCTGGG - Intergenic
903138645 1:21325659-21325681 CACAATAGGACCCACTTCCTTGG + Intronic
903509638 1:23865529-23865551 CCGATGAGGCCCCACGTCTTTGG + Exonic
904056212 1:27672014-27672036 GCCAGGAGGCCCCTTCTCCTGGG - Intronic
904721833 1:32516018-32516040 CCCAGGAGCCTCCACCTCATGGG - Intronic
906118963 1:43374801-43374823 CCCAAGGGTCCCCAACCCCTGGG - Intergenic
907515009 1:54988323-54988345 GCCAAGGGGCCCCACCTGCCAGG - Intronic
910849721 1:91638290-91638312 CACAACAGCCTCCACCTCCTGGG + Intergenic
911573040 1:99540662-99540684 ACCAGGAGTCCCCAACTCCTGGG - Intergenic
912895133 1:113578315-113578337 GGCAACAGGCCCCACCTCTTAGG + Intronic
914995939 1:152543459-152543481 CCCACCATGCCCCACATCCTGGG + Intronic
915634794 1:157178493-157178515 CAGAAGCGGCCCCACCTCCCTGG - Intergenic
916762892 1:167832986-167833008 CCCAAGAGAGCCCACCTCCAGGG - Exonic
917528865 1:175815047-175815069 CCCAGGAGGCCCCACCTTCCTGG - Intergenic
918378543 1:183932834-183932856 CCCATGAGTCCCCACCTCCTTGG + Intronic
919116183 1:193283409-193283431 CCCAATAAATCCCACCTCCTGGG - Intergenic
919914970 1:202133655-202133677 CCCCAGGGCCCCCACCTCCACGG - Exonic
920182084 1:204138258-204138280 CCCATGAGGCCCCTCTCCCTAGG + Intronic
920409658 1:205749608-205749630 CCCAAGAGGCCCCACCTCCTCGG - Intronic
920780805 1:208989271-208989293 CCCAAGAGGACCCAATTACTGGG - Intergenic
922221732 1:223613513-223613535 ACCAAGAGGCCCCACCTGCCTGG - Intronic
922501345 1:226098974-226098996 CCCACCAGGCCCCACCTCATAGG - Intergenic
923385275 1:233459873-233459895 CCCAGGTGGCCTCTCCTCCTGGG + Intergenic
924384249 1:243487732-243487754 CCCAGGAAGCCCCGCCTCCCCGG - Intronic
924762237 1:246998890-246998912 CACTACAAGCCCCACCTCCTGGG - Intronic
924866087 1:247982250-247982272 CTCAAGAGGACCATCCTCCTTGG + Intronic
1063786553 10:9391677-9391699 CACAAAAGCCTCCACCTCCTAGG - Intergenic
1064413185 10:15126043-15126065 CCCCAGTGATCCCACCTCCTGGG + Intronic
1066353455 10:34659158-34659180 CCCAAGAGGCTCTGCCTCCAAGG + Intronic
1067251017 10:44587317-44587339 CCCAAGAGGCCACAGCTCATTGG + Intergenic
1067737560 10:48870055-48870077 GCCAACAGGCACCACCCCCTAGG - Intronic
1070366064 10:75738236-75738258 CACCAAAGGCCCTACCTCCTTGG - Intronic
1071497794 10:86180609-86180631 CCCAAGTGCACCCACTTCCTAGG + Intronic
1074712917 10:116192444-116192466 CCCAAGAGGCCCCACTTTCGGGG + Intronic
1075277196 10:121104756-121104778 GACTAAAGGCCCCACCTCCTGGG - Intergenic
1077232699 11:1465153-1465175 CACAAGAGGGCCCAACTCCCCGG - Intergenic
1078110713 11:8389498-8389520 TCCCAGAGGCCACAGCTCCTTGG + Intergenic
1078469916 11:11578631-11578653 CATAAGAGACCCCACCTCCCGGG + Intronic
1078928809 11:15897644-15897666 TCCCAGTGGTCCCACCTCCTGGG + Intergenic
1079353080 11:19709464-19709486 CCCAGGAAGCTCCGCCTCCTGGG - Intronic
1081281222 11:41211115-41211137 ACCAGGGGGCCCCAACTCCTGGG - Intronic
1081808168 11:45901124-45901146 CCCCAGCCGCCCCACCTCCCAGG - Intronic
1084118378 11:67055072-67055094 GCTAAGAGTCCCTACCTCCTAGG + Intergenic
1084128684 11:67118171-67118193 CCCAGGAAGCCCCCGCTCCTCGG - Intergenic
1084207945 11:67606830-67606852 CGCCAGCGGCCCCGCCTCCTCGG - Exonic
1084503690 11:69552510-69552532 CCCACGATGCCCCAAATCCTAGG - Intergenic
1084833320 11:71786547-71786569 CCCTAACGGCCCCGCCTCCTGGG + Intergenic
1085757099 11:79210960-79210982 CACAAAAAGCCCCACCTCCTTGG + Intronic
1088952269 11:114583867-114583889 CCCATAAGTCCCCATCTCCTGGG - Intronic
1089159055 11:116423908-116423930 CCCGTGAGGACCCACCTCCTGGG - Intergenic
1089532082 11:119136766-119136788 CCCAAGTCACCCCTCCTCCTAGG - Intergenic
1089681545 11:120121662-120121684 CCCAAGATGCCCCAGGCCCTAGG + Intronic
1090569746 11:128033048-128033070 CCCAAGAGATCCAACCACCTTGG - Intergenic
1090569773 11:128033183-128033205 CCCAAGAGATCCAACCACCTTGG - Intergenic
1091273967 11:134337619-134337641 CCCATGAGGCTCAACTTCCTTGG - Intronic
1092447250 12:8568570-8568592 ACGAAGGAGCCCCACCTCCTGGG - Intergenic
1095959537 12:47825566-47825588 GCCAAGAGGCCCCACCCACCAGG + Intronic
1096657108 12:53098568-53098590 CCGAAGAGGCCCCAAATCCAGGG + Intronic
1097100937 12:56588898-56588920 CGCAAGATGACCCCCCTCCTTGG + Intronic
1099294769 12:80816333-80816355 CCCCACAGCCCCGACCTCCTGGG - Intronic
1100790437 12:98124402-98124424 CCCAAGAGCACACATCTCCTTGG - Intergenic
1101841485 12:108330699-108330721 CCCAAGAGGGGCTACCTCATTGG - Intronic
1102875078 12:116442961-116442983 TCCCAAAGGCTCCACCTCCTAGG - Intergenic
1104683375 12:130767552-130767574 CCCAAGAGTGCCTACCCCCTGGG - Intergenic
1105039719 12:132953245-132953267 CCCAAGAGGCCGCCCCTCCAGGG + Intronic
1105296203 13:19089779-19089801 CCAATGAGGCCCCACTTCTTGGG + Intergenic
1106235042 13:27854174-27854196 CCCAAGAGGCCTCATTCCCTGGG + Intergenic
1106335371 13:28778422-28778444 CCCCCGAGGCCCCAGCTCCCTGG - Intergenic
1106999364 13:35525901-35525923 TCCCAAAGGCCCCACCTCTTAGG + Intronic
1108380359 13:49848652-49848674 CCCATGTGGCCCCAGCTACTAGG + Intergenic
1110016348 13:70410200-70410222 TCCCAAGGGCCCCACCTCCTAGG + Intergenic
1113982863 13:114290544-114290566 CCCCACAGGCCCCACCTCAGAGG - Intronic
1115479685 14:33849320-33849342 CCCAAGGGTTCCCACATCCTTGG - Intergenic
1115630820 14:35243408-35243430 CCCCAGTGGTCCCACCTACTTGG + Intronic
1119476837 14:74935254-74935276 CCGAGGAGGCCCCACCTCAGAGG - Intergenic
1119646082 14:76349479-76349501 CGCAGGAGGCCACACCTTCTTGG - Intronic
1120910390 14:89661316-89661338 CCCAAGAGATCCCACCACCTTGG + Intergenic
1121145140 14:91576365-91576387 CCCAAGTGGCCCCTGCTCTTTGG + Intergenic
1121542946 14:94742059-94742081 CCCAAGTGTTCCCTCCTCCTGGG - Intergenic
1122124357 14:99571058-99571080 CCCAAGTGACCCCACCTGCCAGG + Intronic
1122136228 14:99634539-99634561 CCTAAGCAGCCCCAGCTCCTGGG + Intergenic
1122414314 14:101541557-101541579 CCGAAGAGCCCACATCTCCTGGG + Intergenic
1122546991 14:102528612-102528634 CCCACGTGGCCTCCCCTCCTAGG - Intergenic
1122649611 14:103219385-103219407 CACAAGAGCCCCAACCTCCTGGG + Intergenic
1122958624 14:105084264-105084286 CCCTACAAGCCCCACGTCCTGGG + Intergenic
1124243873 15:28053682-28053704 CCTCAGAGGCCCCACCTCAGAGG + Intronic
1124347598 15:28932841-28932863 TCCATAAGGCCCCATCTCCTTGG - Intronic
1125591867 15:40859284-40859306 CCCGAGAGCTCCCACCTCCTCGG - Intergenic
1127647500 15:60973310-60973332 CCCAAGGTGGCCCAGCTCCTGGG + Intronic
1127797112 15:62448065-62448087 TCCAACAGGCCCCAACGCCTTGG + Intronic
1129765938 15:78167368-78167390 CCCAACAAGCTCCACCGCCTCGG + Intronic
1130081369 15:80736905-80736927 CCCATGAGACACCATCTCCTTGG + Intronic
1130543824 15:84840547-84840569 CCCAAGAGGCCTGACTGCCTGGG - Exonic
1130905949 15:88241033-88241055 CCCAAGAGCCCCCACCTAGTAGG - Intronic
1132771616 16:1566841-1566863 TCCCAGTGGCCCCACCTCCCTGG + Intronic
1132861740 16:2075145-2075167 CACTAGAAGCTCCACCTCCTGGG - Intronic
1132959085 16:2612319-2612341 CCCCACAGGCCCTGCCTCCTGGG - Intergenic
1132972145 16:2694294-2694316 CCCCACAGGCCCTGCCTCCTGGG - Intronic
1133228939 16:4357225-4357247 CCCGAGAGGCCCCTGCTCGTCGG - Exonic
1133774358 16:8885765-8885787 CCCCAAAGACCCCATCTCCTGGG + Intergenic
1133790037 16:9002581-9002603 CCCATGTGGTCCCAGCTCCTTGG - Intergenic
1134388892 16:13800349-13800371 CCCCTGAGCCCCCACCTACTAGG + Intergenic
1134868521 16:17630566-17630588 CCCAACAGGGGACACCTCCTTGG + Intergenic
1135125600 16:19806926-19806948 CCCAATAACCCCCACCCCCTGGG + Intronic
1135459523 16:22629194-22629216 CCCAAGTGGCCCTCCCACCTTGG - Intergenic
1136498915 16:30659970-30659992 CCCATTAGGCCCCACCTGCAAGG - Exonic
1138422644 16:56909576-56909598 CCAAAGAGGCCCCAGCTATTGGG + Intronic
1141906147 16:87028354-87028376 CTGAAGAAGCCCCACCTCCTGGG + Intergenic
1141992083 16:87616307-87616329 CACTACAGGCTCCACCTCCTGGG + Intronic
1142249752 16:88985882-88985904 CCCAAGAAGCCCTACCCTCTCGG - Intergenic
1142717668 17:1755777-1755799 CCCACGCTGCCCCAGCTCCTGGG - Intergenic
1142758364 17:2028901-2028923 CCCCAGAGGCCCTCCCTGCTTGG - Intergenic
1142770211 17:2091273-2091295 GCCAGGAGGCCCCTCCCCCTAGG - Intronic
1143476775 17:7207645-7207667 CCCAAGAGGCCCCCACGCCTGGG - Intronic
1143731656 17:8885620-8885642 CCCCCATGGCCCCACCTCCTGGG + Intronic
1143757879 17:9079852-9079874 CCCAGGGGGAACCACCTCCTTGG - Intronic
1144313524 17:14036831-14036853 CCCATCAGGCCCCACCTCCAAGG + Intergenic
1144348787 17:14374079-14374101 CCCAAGAGGCATTACCTCCCAGG + Intergenic
1144690140 17:17256101-17256123 CACAACAAGCTCCACCTCCTGGG - Intronic
1145254686 17:21316174-21316196 CCCATGGGGACCCTCCTCCTGGG - Intergenic
1145321911 17:21771791-21771813 CCCATGGGGACCCTCCTCCTGGG + Intergenic
1145761018 17:27425595-27425617 CCCCAGAGGCCCTGCATCCTAGG + Intergenic
1146161069 17:30559753-30559775 CCCCAGAGGCCCTGCATCCTGGG + Intronic
1146848075 17:36197271-36197293 CACCACAGCCCCCACCTCCTGGG - Intronic
1147308255 17:39578451-39578473 CTCAAGAGACTCCACCTTCTAGG + Intergenic
1147359597 17:39922581-39922603 CCCAAGCTGCCCCAGCTCCACGG - Exonic
1148907379 17:50919921-50919943 CCCAGCAGGCCCCACTGCCTTGG - Intergenic
1149610451 17:57955115-57955137 GCCCAGCGGCCCCACCTTCTCGG - Intronic
1150441805 17:65197430-65197452 TCAAAGAGGCCCCACCGTCTGGG + Intronic
1150513303 17:65778922-65778944 CACTATAGGCTCCACCTCCTGGG - Intronic
1151879515 17:76886655-76886677 CCCAGGTGGCCCCTCCTCCCTGG - Intronic
1152075653 17:78158230-78158252 CCCAAGAGGCCCCCTCCCCCAGG + Intronic
1153215939 18:2821193-2821215 CTCAAGAGGTCCCATCTCCAAGG + Intergenic
1155308509 18:24501777-24501799 CCCAAGAGATCCGCCCTCCTCGG + Intergenic
1155701131 18:28745395-28745417 CCCAAGTGGTCCTCCCTCCTGGG - Intergenic
1157030594 18:43902586-43902608 CCCTAGAAGACCCACTTCCTGGG + Intergenic
1158847191 18:61456968-61456990 TCCCAAAGGCCCCACCTTCTAGG + Intronic
1160527849 18:79547862-79547884 CCCACGAGCCCCCACCACTTTGG + Intergenic
1160680980 19:411495-411517 CCCCTGAGGCCCCCTCTCCTCGG - Intergenic
1161212588 19:3075332-3075354 ACCAGGGGGCCCCAGCTCCTGGG + Intergenic
1161421758 19:4179770-4179792 CCCCAGGGCCCCCACCTCCACGG - Intronic
1161714034 19:5865534-5865556 CCCAAGAGGCTTGACCTCCAGGG + Intergenic
1161867111 19:6841146-6841168 CTCAAGAGACCCACCCTCCTTGG + Intronic
1162297464 19:9823169-9823191 CTCAAGGGGACTCACCTCCTGGG - Intronic
1163153729 19:15429088-15429110 CCGGTGAAGCCCCACCTCCTGGG - Intronic
1163535485 19:17874077-17874099 CCCGAGAGGCCTCGGCTCCTGGG + Intronic
1163578063 19:18122142-18122164 CCCATGACCCCCCACCCCCTGGG - Intronic
1163580836 19:18137639-18137661 CCCAGGAGGCCCAACTTGCTGGG - Intronic
1165053898 19:33161402-33161424 CCCAAGGGGCCCCACACCCCAGG + Intronic
1165242545 19:34480450-34480472 CCCCAGAGTCTCAACCTCCTGGG - Intergenic
1165750161 19:38254603-38254625 CCAATGAGGCCCCACCTCTAAGG + Intronic
1165752345 19:38267953-38267975 CCCCTGAGGGCACACCTCCTGGG - Intronic
1165838554 19:38773514-38773536 CCCAGCAGGCCCCACCACCACGG - Intergenic
1165841005 19:38789183-38789205 CCCAGCAGGCCCCACCACCACGG + Intergenic
1166076973 19:40419430-40419452 CCCAGGAGGCCACACCACCTTGG - Intergenic
1168108818 19:54180720-54180742 CCCAGCAGCCCCCACCTCCAAGG - Intronic
1168341248 19:55624342-55624364 CACAAGAAGCCCCACCCCCAGGG + Intronic
1168347882 19:55659758-55659780 CCCAAGAGCTCCCTTCTCCTGGG - Intronic
925057939 2:869700-869722 CCCACCAGGTCCCACCTCCAGGG - Intergenic
925427483 2:3762702-3762724 CCCACCAGGCCCCACCTCCAAGG + Intronic
927154239 2:20212565-20212587 CCAGTGAGGCCCCTCCTCCTGGG - Intronic
929112187 2:38414278-38414300 CCAAAGGGGACCCACGTCCTTGG - Intergenic
929595543 2:43173459-43173481 GCCAAGAAGCCCTATCTCCTAGG - Intergenic
932143241 2:69297623-69297645 CCCCACAGGCAGCACCTCCTGGG + Intergenic
933327165 2:80852663-80852685 CCAATGAGGCCCCTCCTCCAAGG - Intergenic
934738392 2:96701986-96702008 GCCAGGAGGCCCCAGCTTCTTGG - Intergenic
936295069 2:111261718-111261740 CCCACTAGGGCCCACCTCCAGGG - Intergenic
937867906 2:126767727-126767749 CACAAGAGGAGGCACCTCCTGGG + Intergenic
938114903 2:128596309-128596331 CCCGGCAGGCTCCACCTCCTTGG + Intergenic
940665265 2:156601317-156601339 CTCAAGAGGTCCTCCCTCCTCGG + Intronic
941987319 2:171522378-171522400 CCCAAGAGGCCCCACATTCCGGG + Exonic
947840948 2:233207647-233207669 ACCAAGAGGCCCACCCTCCCTGG - Exonic
948615213 2:239194031-239194053 GCCAAGGGCCCCCACCACCTGGG + Intronic
948868305 2:240786201-240786223 CTCAGGAGGCCACACCTCCGCGG + Intronic
948909544 2:240996223-240996245 CCAGAGAGGCCACACTTCCTCGG - Intergenic
949028408 2:241776889-241776911 CCCCCGAGGTCCCACCGCCTCGG - Exonic
1170590487 20:17767688-17767710 CCCAAAATGCTCCATCTCCTTGG + Intergenic
1171052123 20:21869800-21869822 CCCTACAGCCTCCACCTCCTGGG + Intergenic
1171466960 20:25336608-25336630 CGCCACAGACCCCACCTCCTCGG + Intronic
1172594248 20:36139118-36139140 CCCAAGAGGGCCAGCTTCCTGGG + Intronic
1173860099 20:46277697-46277719 CTCAAGGGGCCCCTCCCCCTTGG - Intronic
1173883465 20:46436756-46436778 CCAGAGAGGCCCCACTGCCTGGG + Intergenic
1174719530 20:52797235-52797257 CTCAAGCGGCCCTCCCTCCTTGG - Intergenic
1175179589 20:57136096-57136118 GCCAAGAGGCCCACCCTCTTGGG + Intergenic
1175273645 20:57752714-57752736 CCCTATAGCCCCGACCTCCTGGG + Intergenic
1175394044 20:58646458-58646480 CCCAACAGGCCCCACCTAAATGG - Intergenic
1175905797 20:62378732-62378754 CCTGAGAGGAGCCACCTCCTGGG - Intergenic
1176110264 20:63407724-63407746 CCCAGGTCCCCCCACCTCCTGGG - Intronic
1177169741 21:17641805-17641827 CCCAACAGGCCCCACCTGGGAGG + Intergenic
1177774412 21:25551891-25551913 CCCACCAGGCCCTACCTCCAAGG + Intergenic
1179539622 21:42075731-42075753 CCCAGGTGGCACCTCCTCCTCGG + Intronic
1180846570 22:18986071-18986093 CCCATGGGGACCCAGCTCCTGGG - Intergenic
1181271423 22:21661018-21661040 ACCAAGGGGCTCCACCTACTTGG - Intronic
1181971314 22:26692438-26692460 CCCAAGATGCACCATCCCCTTGG - Intergenic
1182657015 22:31898802-31898824 CCACAGAGGCCCTACCTGCTGGG + Intronic
1183251780 22:36735415-36735437 CTCAAGAGATCCCACCACCTTGG + Intergenic
1184081206 22:42221694-42221716 CCCTATAGACCCCACATCCTTGG - Intronic
1184548365 22:45189399-45189421 CCCTGGAGCCTCCACCTCCTGGG - Intergenic
1184583547 22:45432859-45432881 CCCAAGCGCCCACACTTCCTGGG - Intergenic
1184900885 22:47445769-47445791 ACCAAGAAGCCCCACCTTGTGGG - Intergenic
1185237116 22:49720529-49720551 CCCAGCAGCCCCCACCTCCTGGG + Intergenic
1185414120 22:50700502-50700524 AACAAGTGGCCCCACCTCTTGGG - Intergenic
949996824 3:9624214-9624236 CACTACAGCCCCCACCTCCTGGG + Intergenic
950662279 3:14473953-14473975 TCCACCAGGCCCCACTTCCTGGG - Intronic
950719195 3:14870479-14870501 CCCTGGTGGCCTCACCTCCTTGG + Intronic
952971966 3:38656963-38656985 CCCAGGAGACCCCCCCTCCCCGG - Intergenic
953344565 3:42164619-42164641 CCCAGGAGCACCCACCTCATGGG - Intronic
954183795 3:48901476-48901498 CCCTACAAGCTCCACCTCCTGGG - Intergenic
954469574 3:50680742-50680764 CTCAAGAGACCCTCCCTCCTGGG + Intronic
954624907 3:52017029-52017051 CCCAAAAGGCTCAACATCCTAGG - Intergenic
956554620 3:70505006-70505028 ACCAGTAGGCCCCACCTCATGGG + Intergenic
959281214 3:104343341-104343363 CCCAAGAGGCCTCTTCTCCCTGG + Intergenic
960784647 3:121358596-121358618 CCCACCAGGCCCCACCTCCTGGG + Intronic
961299797 3:125915622-125915644 CCTAACCGGCCCCACCTCCCGGG + Intergenic
962069896 3:132022416-132022438 CCCATGAGGGGCCACCTCCTGGG - Intronic
962212108 3:133487610-133487632 CCCTACAGTCCCCACTTCCTGGG - Intergenic
962343723 3:134605216-134605238 CCCATGAGGACCCACCTGCCTGG + Intronic
963349206 3:144132036-144132058 CCCACTAGGCCCCACCTGGTGGG + Intergenic
964383865 3:156126504-156126526 CCCAAGAGGCTCCCCCTCCTTGG - Intronic
967271646 3:187737981-187738003 CCCCAGCGGCCCCGCCTCCCTGG - Intronic
968486746 4:866614-866636 CCCAAGAGGCCACTCCAGCTGGG + Intronic
968976995 4:3827326-3827348 CTCACGTGTCCCCACCTCCTGGG + Intergenic
969219874 4:5752554-5752576 CCCCAGAGGGCCACCCTCCTAGG - Intronic
969225994 4:5798674-5798696 CAGAAGCTGCCCCACCTCCTGGG - Exonic
969866919 4:10082304-10082326 CCCAGGAGTCCCCATCTCCCAGG + Intronic
971935035 4:33136847-33136869 CCCTAGAAGACACACCTCCTGGG - Intergenic
977169545 4:93743753-93743775 CCCATTAGGCCCCACCTAATGGG + Intronic
980614078 4:135195202-135195224 CCCACCAGGCCCCACCTCCTGGG - Intergenic
981356401 4:143794318-143794340 CCCAAGGAACCCCATCTCCTTGG + Intergenic
981364634 4:143888092-143888114 CCCAAGTCACCCCACCTCCATGG - Intronic
981375133 4:144006377-144006399 CCCAAGTCACCCCACCTCCTTGG - Intronic
981377727 4:144035190-144035212 CCCAAGGAACCCCATCTCCTTGG + Intergenic
981385749 4:144128566-144128588 CCCAAGTCACCCCACCTCCATGG - Intronic
985002478 4:185499816-185499838 CCCAACAGGCTCCCCCTGCTAGG - Intergenic
985714581 5:1448216-1448238 CCCACGGGTCCCCCCCTCCTTGG + Intergenic
987228001 5:15863645-15863667 CCCACTAGGCCCCACCTCCCAGG - Intronic
987511465 5:18845742-18845764 ACCAAGAGGCACCTCCTCTTTGG - Intergenic
988174027 5:27696999-27697021 TCTTAAAGGCCCCACCTCCTTGG - Intergenic
989089438 5:37714645-37714667 CCCCAGAGGTCCCACCTCATGGG - Intronic
990323462 5:54651650-54651672 CCCAAGAAGCAGCACCTCCTAGG - Intergenic
992906466 5:81350927-81350949 CCCAAGCAGGCCCACCTGCTGGG + Intronic
996722267 5:126641500-126641522 CCCACCAGGTCCCACCTCCTAGG - Intergenic
997965595 5:138353230-138353252 GCCAGCAGGCCCCGCCTCCTGGG + Intronic
997976865 5:138445991-138446013 CCGAGCAGTCCCCACCTCCTTGG - Exonic
999230805 5:150060815-150060837 CCCCAGAGGCCCCAAGACCTTGG + Intronic
1000670020 5:164049879-164049901 ACTGATAGGCCCCACCTCCTAGG + Intergenic
1000714249 5:164621496-164621518 CCCAGGAGGCCCCTCCTTCCAGG + Intergenic
1001049302 5:168401562-168401584 CCCACAAGTCCCCACCGCCTGGG + Intronic
1002069684 5:176671940-176671962 CCCACCTGGCCCCACCTGCTAGG + Intergenic
1002994431 6:2269563-2269585 TCCCAAAGGCCCCACCTCCATGG + Intergenic
1004329246 6:14706707-14706729 GCCAAGTGGCCCCAGCTCATGGG + Intergenic
1006012497 6:31054455-31054477 CCCAAGAGGCTCCTTCTCCAGGG - Intergenic
1006166231 6:32067443-32067465 CCCAAGAGGCCTCAGTCCCTGGG + Intronic
1006516991 6:34550698-34550720 CCCAACAGACCCCAGCTCCTGGG - Intronic
1007074349 6:39057383-39057405 CCCAAGACCCCTCCCCTCCTCGG - Intronic
1007154059 6:39725198-39725220 CCCAAGAGGCCCCGCCGCGCCGG + Intronic
1007398725 6:41591605-41591627 TCCTAGAGGCCCTACCTCGTGGG - Intronic
1007493145 6:42239983-42240005 CCCAAGGGGCCACACCCTCTTGG - Intronic
1008943260 6:57070338-57070360 CACAAGGGGCACCACCTGCTGGG - Intergenic
1009491612 6:64299460-64299482 CACACGAGGCACCACCTGCTGGG - Intronic
1010234889 6:73567086-73567108 ACCAGGAAGCCCCACCTCCCGGG - Intergenic
1010245373 6:73657344-73657366 CCCTGTAGGCTCCACCTCCTGGG + Intergenic
1013810696 6:114041416-114041438 TGCAAGAGGCCACACCTCCAGGG - Intergenic
1014661396 6:124177666-124177688 CCCAAATGGCCCCAGCTCCTTGG - Intronic
1017940753 6:159050886-159050908 CCCAAGCGGCCCCTGCTCCTCGG + Intergenic
1018743665 6:166748512-166748534 CCATGGGGGCCCCACCTCCTCGG + Intronic
1018745936 6:166762166-166762188 CCAAAGAGGCCACACATCCCAGG + Intronic
1018909931 6:168096071-168096093 CCCAAGAGCTCCCATCTCCGGGG + Intergenic
1019424846 7:969675-969697 CCCAAGAGGCCCCAGGCCTTAGG - Intronic
1022502697 7:30892578-30892600 GCCAAGAGGTCCCTCCTCCTTGG - Intergenic
1023942851 7:44781114-44781136 CCCAAGAGGAACCACCACCCAGG - Intergenic
1025204666 7:56985339-56985361 CCCAGAAGGCCCCGTCTCCTGGG - Intergenic
1025667271 7:63591596-63591618 CCCAGAAGGCCCCGTCTCCTGGG + Intergenic
1027031035 7:74889038-74889060 CCCCAGGGTCACCACCTCCTAGG - Intergenic
1029883552 7:103843021-103843043 CCCAAGATTCCACAACTCCTTGG - Intronic
1032461670 7:132116111-132116133 CCCAAGAGTCATCACCTCCCAGG - Intergenic
1032472630 7:132189587-132189609 CCCAACATGCCCCAAGTCCTGGG + Intronic
1032849987 7:135785977-135785999 CCCATGAGGCCCCTACTCCTAGG - Intergenic
1033044758 7:137951912-137951934 CACTAGAGCCTCCACCTCCTGGG - Intronic
1035180968 7:157089381-157089403 ACCCAGAGCCCCCACATCCTGGG - Intergenic
1036187379 8:6635739-6635761 CCCCAGAGGACCCACTTCCTGGG + Intronic
1036635917 8:10549381-10549403 CCCTACAGGCCACCCCTCCTAGG - Intronic
1037887686 8:22603497-22603519 CCCAAGATGCCGCAGCTCCAGGG + Exonic
1040060288 8:43097828-43097850 CCCCACAGGCCCCTCCTCCAGGG - Intronic
1040489466 8:47906269-47906291 CCCTAAAGCCTCCACCTCCTGGG - Intronic
1040829335 8:51660374-51660396 ACCAGGAGGCCCCACCTCACTGG - Intronic
1041194647 8:55388663-55388685 TCCCAAAGGCCCCACTTCCTAGG + Intronic
1042224198 8:66502920-66502942 CACTACAGCCCCCACCTCCTGGG + Intronic
1042722943 8:71844081-71844103 TCCAAGAGGCCGCCCCTCCGCGG - Exonic
1045217580 8:100163497-100163519 CCAAAGAGGCCCCAGCACTTTGG - Intronic
1049460532 8:142725637-142725659 CCCAAAAGGCCACCCCTCCCTGG + Intergenic
1049644530 8:143730121-143730143 CCCAAGATGGCGCACCTGCTGGG + Exonic
1049688832 8:143949985-143950007 CCCATGTGGCCCCTCCTCCTCGG - Intronic
1049999219 9:1058455-1058477 CTCAAGGGGCTCCACCTCCCAGG + Intergenic
1050271653 9:3952353-3952375 CCCCAGAGGCACCACCACCCAGG + Intronic
1050845394 9:10210512-10210534 TGCAAGAAGCCCCCCCTCCTTGG - Intronic
1051427504 9:16948317-16948339 CACCAGAAGCTCCACCTCCTGGG + Intergenic
1051495875 9:17722163-17722185 CCCAAAAAGCCACACTTCCTGGG - Intronic
1051627273 9:19110259-19110281 CTCAAGTGGTCCAACCTCCTTGG + Intronic
1052840731 9:33289439-33289461 GCCAGGGGGCACCACCTCCTGGG - Intergenic
1055876114 9:80943568-80943590 CCCAAGAGAGACCACATCCTGGG + Intergenic
1056685061 9:88752428-88752450 CCCAAGAGGGCCCACTACCATGG + Intergenic
1056773513 9:89496390-89496412 CCTAAGCGGCCCACCCTCCTGGG + Intronic
1056976525 9:91261270-91261292 CCCAAAAGGATCCACCTGCTTGG - Intronic
1057074548 9:92130653-92130675 CACTACAGGCTCCACCTCCTGGG + Intergenic
1057705722 9:97393611-97393633 ACCAGGAAGCCCCAACTCCTTGG + Intergenic
1058551017 9:106115219-106115241 CACAATAGACTCCACCTCCTAGG - Intergenic
1058754998 9:108075897-108075919 CCTCTGATGCCCCACCTCCTCGG + Intergenic
1060105199 9:120868985-120869007 CCCCCGAGGCCCCACCCCCGCGG + Intronic
1061612565 9:131756903-131756925 CACTAGAACCCCCACCTCCTGGG - Intergenic
1061684138 9:132260734-132260756 CACAATCGCCCCCACCTCCTGGG - Intergenic
1061849185 9:133404644-133404666 CCCAGGAGGCCCCATCAGCTTGG - Intronic
1061865161 9:133488269-133488291 CCCAAGGGGCCCCTGCTCCCTGG - Intergenic
1062209996 9:135358363-135358385 CCCCGGCAGCCCCACCTCCTAGG - Intergenic
1062274898 9:135726028-135726050 CCTGACAGGCCCCTCCTCCTGGG - Intronic
1062522410 9:136963816-136963838 CCCAGCCGGCCCCATCTCCTGGG - Intergenic
1062589732 9:137268107-137268129 CTAAAGAGGCCCCATCTCCCAGG - Intronic
1185644656 X:1608448-1608470 CACAGGATGCCCCAGCTCCTGGG - Intergenic
1185979164 X:4757222-4757244 CCCAGGAAGCTCCACCTCCCGGG + Intergenic
1187249698 X:17585682-17585704 CAGAGGAGGCCCCACCTCCCAGG + Intronic
1187633178 X:21197466-21197488 CCCATAAAGCCCCACCTCCTGGG + Intergenic
1187842644 X:23504926-23504948 CCCAGGACTCCCCACCTCCAGGG - Intergenic
1188542941 X:31269879-31269901 CCACAGAGGTCCAACCTCCTGGG - Intronic
1190268908 X:48847245-48847267 CACAACAACCCCCACCTCCTGGG - Intergenic
1195853734 X:109309033-109309055 CCCAAGAGGCACCTCCTGCAGGG - Intergenic
1201182014 Y:11357950-11357972 TCCAAAATGCCCCACCTCTTAGG - Intergenic
1201948567 Y:19538630-19538652 CCCCAGAAGCTCCGCCTCCTGGG - Intergenic