ID: 920409868

View in Genome Browser
Species Human (GRCh38)
Location 1:205750563-205750585
Sequence GAGGATTTTCAAGGTGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 183}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920409868_920409873 1 Left 920409868 1:205750563-205750585 CCTTGATCACCTTGAAAATCCTC 0: 1
1: 0
2: 1
3: 20
4: 183
Right 920409873 1:205750587-205750609 AATAGCAAAACCCGTGGGAGAGG 0: 1
1: 0
2: 1
3: 4
4: 104
920409868_920409877 22 Left 920409868 1:205750563-205750585 CCTTGATCACCTTGAAAATCCTC 0: 1
1: 0
2: 1
3: 20
4: 183
Right 920409877 1:205750608-205750630 GGCAGCAGATTCGTCACTGCGGG 0: 1
1: 0
2: 1
3: 6
4: 89
920409868_920409870 -5 Left 920409868 1:205750563-205750585 CCTTGATCACCTTGAAAATCCTC 0: 1
1: 0
2: 1
3: 20
4: 183
Right 920409870 1:205750581-205750603 TCCTCTAATAGCAAAACCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 81
920409868_920409878 23 Left 920409868 1:205750563-205750585 CCTTGATCACCTTGAAAATCCTC 0: 1
1: 0
2: 1
3: 20
4: 183
Right 920409878 1:205750609-205750631 GCAGCAGATTCGTCACTGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 45
920409868_920409872 -4 Left 920409868 1:205750563-205750585 CCTTGATCACCTTGAAAATCCTC 0: 1
1: 0
2: 1
3: 20
4: 183
Right 920409872 1:205750582-205750604 CCTCTAATAGCAAAACCCGTGGG 0: 1
1: 0
2: 0
3: 2
4: 41
920409868_920409876 21 Left 920409868 1:205750563-205750585 CCTTGATCACCTTGAAAATCCTC 0: 1
1: 0
2: 1
3: 20
4: 183
Right 920409876 1:205750607-205750629 AGGCAGCAGATTCGTCACTGCGG 0: 1
1: 0
2: 2
3: 10
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920409868 Original CRISPR GAGGATTTTCAAGGTGATCA AGG (reversed) Intergenic
905623204 1:39467063-39467085 CAGGATTTTCAAAGTTATAAAGG - Intronic
907810851 1:57868285-57868307 GAGCATTTTCAGGGTGTTCTAGG + Intronic
908456195 1:64307211-64307233 AAGGATTTTCAAGGTCAATAAGG + Intergenic
909432980 1:75611338-75611360 GATTATTTTAAAGGTAATCATGG - Intergenic
911020933 1:93387020-93387042 CAGTTTTTTCAAGGTGATAACGG - Intergenic
913677529 1:121155581-121155603 GAGGATTTTTAAGGTGTAAAAGG - Intergenic
914029362 1:143943210-143943232 GAGGATTTTTAAGGTGTAAAAGG - Intergenic
914160087 1:145124740-145124762 GAGGATTTTTAAGGTGTAAAAGG + Intergenic
916347790 1:163813679-163813701 GAGGAATGTCAAGATGATTAAGG + Intergenic
917734242 1:177906160-177906182 GGGTAATTTCAATGTGATCAAGG - Intergenic
918151377 1:181800284-181800306 GGGCATGTTCAAGGTGAACAGGG - Intronic
918262352 1:182807385-182807407 AAGGATTCCCAAGGTCATCATGG - Intronic
919406918 1:197196760-197196782 GAGTGGTTTCAAGGTGGTCAGGG - Intronic
920004528 1:202823339-202823361 GGGGATTTTCAAAGTGATGAAGG - Exonic
920409868 1:205750563-205750585 GAGGATTTTCAAGGTGATCAAGG - Intergenic
920464834 1:206174095-206174117 GAGGATTTTTAAGGTGTAAAAGG - Intergenic
922421375 1:225463022-225463044 TGGGATTTTTAAGGGGATCATGG - Intergenic
923842856 1:237692779-237692801 GAGTATTATCAAGGAGGTCAGGG - Intronic
1062860001 10:803565-803587 GAGGAGCTTCAAGGTGAGAAAGG - Intergenic
1063937103 10:11089328-11089350 TAGGATTTTGAAGGTGAAAAGGG + Intronic
1064117950 10:12595034-12595056 CATGATCTTCAAGGTGATCTGGG + Intronic
1065593059 10:27285185-27285207 CAGGTTTTTCAAGATGATGATGG - Intergenic
1065657313 10:27965095-27965117 CAGGTTTTTCAAGATGATGATGG + Intronic
1068742078 10:60484989-60485011 GATGATTCTCATGGTCATCAAGG - Intronic
1069946809 10:71992265-71992287 GGGCATTGCCAAGGTGATCAGGG - Intronic
1070980894 10:80646218-80646240 GATGATTTTCAAGGTGTTGGAGG + Exonic
1071361599 10:84851741-84851763 TAGGGTTTTTAAGGGGATCATGG - Intergenic
1072266373 10:93732196-93732218 GAAGGTTTTCAAGATGATCCTGG - Intergenic
1072910546 10:99497134-99497156 TAGGATCTTCAAGGAAATCAGGG + Intergenic
1074864453 10:117536814-117536836 GACGAGTTTCAACGTGATGAAGG + Intergenic
1074895589 10:117774691-117774713 AAGTATATTCAAGGTTATCAAGG - Intergenic
1076279978 10:129238216-129238238 GATGAATTTCAAGGTGTCCATGG - Intergenic
1076877073 10:133221187-133221209 GAGGGGTTTCAAGGGGAGCAGGG - Intronic
1077727975 11:4695600-4695622 GAGGATTTTCAGAGTCATTAGGG - Intronic
1078389619 11:10925619-10925641 GAGGATTTTGAAGGCAAGCAAGG - Intergenic
1080975736 11:37337925-37337947 GAAAATTTTCATGGTTATCATGG + Intergenic
1084919350 11:72456712-72456734 GTGGGTTATCAAGGTAATCAAGG + Intergenic
1088580181 11:111308072-111308094 GAGGAATTTGAAGGTGATCCTGG - Exonic
1090160662 11:124491243-124491265 TAGGTTCTTTAAGGTGATCATGG + Intergenic
1090528121 11:127559849-127559871 GAGGAGTCTCAAGGAGATGAAGG + Intergenic
1093062434 12:14621115-14621137 GAGGATTTCCAAGGCCATCTTGG + Exonic
1094116041 12:26914211-26914233 AAGGATTTTAAAGATTATCATGG + Intronic
1094715028 12:33005214-33005236 GAGGATATTCAAGCTTATGAAGG - Intergenic
1096273876 12:50189239-50189261 GTGGATTTAAAAGGTGAGCAAGG - Intronic
1098764106 12:74462910-74462932 AAGGATTTTCAACCTAATCATGG + Intergenic
1099113652 12:78595171-78595193 AATGATTTTCCAAGTGATCAAGG - Intergenic
1102638609 12:114346485-114346507 GAGGACTTGGAAGGTGATCTCGG + Intergenic
1103231558 12:119335164-119335186 AAGGATTTTTAAGATGACCAAGG + Exonic
1112880831 13:104104621-104104643 AAGCATTTTCACTGTGATCAAGG - Intergenic
1113012779 13:105789528-105789550 AAGGATTTTTAAGGTTATCTAGG - Intergenic
1114741568 14:25103678-25103700 GTGGATTTAAAAGGTGAACAGGG - Intergenic
1118114563 14:62761013-62761035 GAGGGATTTCAAGGTGTTTATGG - Intronic
1121676435 14:95757051-95757073 GAGAATTTTCTAGCTGATTAGGG + Intergenic
1124012441 15:25849623-25849645 GAGGAATTTAACCGTGATCAAGG + Intronic
1124198012 15:27650217-27650239 TAGGGTTTTTAAGGGGATCATGG + Intergenic
1125822640 15:42645848-42645870 TAGGATTTTCAGAGTGATAATGG + Intronic
1127028418 15:54834044-54834066 GAGGAATGTAAAGGTGATCAAGG - Intergenic
1130538366 15:84802902-84802924 GAGGAGGGGCAAGGTGATCAAGG - Exonic
1133849863 16:9492633-9492655 TAGGGTTTTTAAGGGGATCATGG + Intergenic
1133917751 16:10124586-10124608 GAGGTTTTTCCAGGTGGTCCAGG + Intronic
1134179927 16:12039323-12039345 GAGGATTTTCAGGCTTAGCATGG + Intronic
1135306672 16:21373090-21373112 GAGGATTTTCAGGCTTAGCATGG + Intergenic
1136303414 16:29352232-29352254 GAGGATTTTCAGGCTTAGCATGG + Intergenic
1138490618 16:57374140-57374162 GAGGACTTCCAAGGTGAGCCTGG - Intronic
1140611587 16:76606152-76606174 AAGAATTTTCAAGGTAAGCATGG + Intronic
1140652537 16:77104690-77104712 GGGGATTTTCAAGGTCATGGTGG - Intergenic
1140898424 16:79346584-79346606 AAGGATTTTGAAGGTGATGATGG + Intergenic
1142758451 17:2029303-2029325 GTGGATTCTAAAGGTGATAAAGG + Intergenic
1143065636 17:4244984-4245006 GAGGAGTTTCAAGGGGATGGTGG - Intronic
1143168273 17:4910132-4910154 GAGGATTTTCAGGGAGGGCAGGG + Intergenic
1143901257 17:10176441-10176463 AAGGATTTTGAAGGTGATGGTGG - Intronic
1146064877 17:29626511-29626533 AGGGATCTTCAAGGTGATTAAGG + Exonic
1146773889 17:35595238-35595260 GAGGATTTTAAAGGTTCTCCAGG + Intronic
1148151469 17:45398817-45398839 GAGGATTTGAAAGCTGATCATGG + Intronic
1148395846 17:47307546-47307568 GAGGAGTTTCCAGATGAGCAGGG - Exonic
1150310333 17:64123271-64123293 GAGGTATTTCAGGGTGCTCATGG + Intronic
1153294723 18:3534533-3534555 GAGAATTTTCCAGATTATCATGG + Exonic
1153299605 18:3581267-3581289 GAGGAGGGCCAAGGTGATCAAGG - Intronic
1153912127 18:9713644-9713666 GAGCATTTTCAAGCTTCTCATGG + Intronic
1155085896 18:22457700-22457722 GAGGAATTTCAAGAGGGTCATGG + Intergenic
1156168207 18:34449703-34449725 GAAGAGCTTCAAGGAGATCAGGG + Intergenic
1158283976 18:55858230-55858252 GAGGGCTTTCAAAGTGACCACGG - Intergenic
1158684264 18:59598790-59598812 GAGGGTTTTCAAAAAGATCATGG - Intronic
1159627555 18:70712453-70712475 GGGGATTTACAAGGAAATCAAGG - Intergenic
1160461363 18:79041456-79041478 CAGGATTTCAGAGGTGATCATGG + Intergenic
1160461382 18:79041558-79041580 CAGGATTTCAGAGGTGATCATGG + Intergenic
1161611859 19:5247720-5247742 GAGGAGGTTCAAGGGGATAAAGG + Intronic
1166323044 19:42031158-42031180 GATTATTGTCAACGTGATCAGGG - Intronic
1166816726 19:45550771-45550793 GAGGAGCTGCAAGGTGATGAAGG - Intronic
1167979987 19:53267341-53267363 GAGTGTCTTCCAGGTGATCACGG - Exonic
1167985898 19:53315442-53315464 GAGTGTCTTCCAGGTGATCACGG + Intergenic
926137026 2:10343557-10343579 GAGGATTTTTAGGGTGGGCATGG + Intronic
927004288 2:18831993-18832015 GAGGATTTGCAAGTTGTTTAAGG + Intergenic
927435721 2:23064573-23064595 GAGGATCCTCATGGTGGTCAGGG - Intergenic
927480124 2:23447053-23447075 AAGGATTTTCAAGCTGATACAGG + Intronic
927783897 2:25959214-25959236 GAGCAATTTCAAGGGGATCAGGG - Intronic
928118425 2:28564532-28564554 GAGTATCTTCAAGGAGACCAGGG - Intronic
929228328 2:39533441-39533463 GAGGATTTGCAAGGTGCTGGTGG + Intergenic
929848192 2:45555077-45555099 TAGGATTTTTAAGGGGATCGTGG - Intronic
929894727 2:45949337-45949359 GAATATTTTAAAGGTAATCAGGG - Intronic
932292522 2:70594568-70594590 GATCATTTTCCAGGTGTTCAGGG + Intergenic
933373735 2:81451161-81451183 GAGAGTTTTCAAGGAGGTCATGG + Intergenic
943099782 2:183473859-183473881 CTGGATTTTCAAGGAGATCAAGG - Intergenic
944835802 2:203578535-203578557 GAGTAGTTTCAAGGTTTTCAAGG - Intergenic
948251240 2:236531615-236531637 GACCATTTTCCAGGTGATCAAGG - Intergenic
1168915879 20:1486822-1486844 AAGGTTTTTCAAGTTGATAAGGG + Intronic
1170072870 20:12387829-12387851 GAGGAGTTTCAAACTGACCATGG + Intergenic
1171519055 20:25761759-25761781 GAGAATGTTGAAGGTGAGCATGG + Intergenic
1172395417 20:34600520-34600542 GAGGAAGATCAAGATGATCAAGG - Intronic
1173110714 20:40185932-40185954 TAGGATTTTCAACATAATCATGG + Intergenic
1174484116 20:50850904-50850926 GAGGATTTTCAAGGCTGTAAGGG + Intronic
1176335362 21:5592930-5592952 CAGGATTTTCAAGGTTTCCAGGG + Intergenic
1176392395 21:6228018-6228040 CAGGATTTTCAAGGTTTCCAGGG - Intergenic
1176469024 21:7088156-7088178 CAGGATTTTCAAGGTTTCCAGGG + Intergenic
1176492585 21:7469934-7469956 CAGGATTTTCAAGGTTTCCAGGG + Intergenic
1176508057 21:7668449-7668471 CAGGATTTTCAAGGTTTCCAGGG - Intergenic
1184237215 22:43189322-43189344 CAGGATTTACAAAGTGAGCATGG - Intergenic
1184452951 22:44593680-44593702 GAGGTCTTTCAAGGTGACCTAGG - Intergenic
1184854118 22:47137171-47137193 GAGGATTTTCAGGGCAAACATGG + Intronic
954217192 3:49131226-49131248 GAGGTCTTTCAAGGTGACCTTGG - Intronic
954373042 3:50179266-50179288 TAGGATTTTCACGGCTATCAAGG - Intronic
957216813 3:77330710-77330732 GAGGTTTTACAAGGTCTTCAAGG + Intronic
957642561 3:82875492-82875514 TGGGATTTTCAAGGAGGTCATGG + Intergenic
959100552 3:102004516-102004538 GAGGAATGTCCAGGTGATGAAGG - Intergenic
963530816 3:146470910-146470932 GAGGATTTTTATGATGATTAAGG + Intronic
964544653 3:157820607-157820629 GAGTATTTTCCAGGTAAACATGG + Intergenic
965121108 3:164558768-164558790 GTGGATTTTCATGCTGCTCAGGG - Intergenic
965334658 3:167421506-167421528 CAGCATTTTAAGGGTGATCATGG - Intergenic
968819286 4:2837575-2837597 GAGGCTTTTGAGGGTGATCCAGG + Exonic
970280148 4:14445983-14446005 GAGAAATTTCAAGATCATCAAGG + Intergenic
971477012 4:27081913-27081935 GTGGATTTCCAAGGGGATGAAGG - Intergenic
972678933 4:41287061-41287083 GAGGATGTTGAAGGTCATCTGGG + Intergenic
974002549 4:56526128-56526150 TAGGTTTTCTAAGGTGATCAGGG + Intergenic
979978936 4:127230928-127230950 GAGGATTCTCAGGGTGGTCTTGG - Intergenic
980402034 4:132303183-132303205 GAAGATTTTCTAGGTCTTCAGGG - Intergenic
982107644 4:152024628-152024650 GAGCATTTACAAGATGGTCAGGG - Intergenic
982275643 4:153634810-153634832 GAGCATTTTCCAGTTGACCAGGG - Intronic
982525325 4:156470800-156470822 AAGGATTTTGCAGCTGATCAAGG + Intergenic
987847735 5:23308141-23308163 GAAGATTTTCAAATTGATCCTGG - Intergenic
993163102 5:84315128-84315150 GAGTATTTTCAATTGGATCATGG - Intronic
993358945 5:86949143-86949165 GAGCATTTTTAGGGTGATAAAGG - Intergenic
996589977 5:125135979-125136001 AAGGATTTTCAGTTTGATCATGG + Intergenic
997640912 5:135448414-135448436 GAGGATTTTCTCGGTGAACAAGG - Exonic
999847590 5:155501703-155501725 GAGGATCTTCCATGTGATAAAGG + Intergenic
1000735744 5:164897865-164897887 TCAGATTTTCAAGGTGATCATGG - Intergenic
1000998582 5:167983483-167983505 GAGGATTTTCCTGTTGTTCACGG + Intronic
1005001971 6:21250516-21250538 GAGCATTGTCAAGGTGAGGAAGG + Intergenic
1006890063 6:37419419-37419441 GTTGTTTTTCAAGGTGAGCATGG + Intergenic
1008454400 6:51692158-51692180 GGGGATTTTCAATGTGAACATGG - Intronic
1010837447 6:80607726-80607748 GAGGACATTCATGGTGATTAGGG + Intergenic
1013145974 6:107392452-107392474 GAGAATTTTAAAGATGAACATGG - Intronic
1017258377 6:152360179-152360201 GAGGATTTTCCACTTGATCCCGG - Intronic
1023132970 7:37021623-37021645 GAGGAATTTTAAGGTGATCAAGG - Intronic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1024866891 7:53913528-53913550 TGGGATTTTTAAGGGGATCATGG + Intergenic
1025738191 7:64173620-64173642 GGGGATCTTCAAGCTGATTAAGG + Intronic
1029213947 7:98931629-98931651 GAAGAGTGTCACGGTGATCATGG + Exonic
1029900545 7:104034767-104034789 TAGGGTTTTTAAGGGGATCATGG - Intergenic
1030587646 7:111440634-111440656 TAGGATTTTCAGAGTGGTCAAGG + Intronic
1031310232 7:120187227-120187249 GTGGATTTTCTAGGAGATCCAGG + Intergenic
1032602150 7:133309135-133309157 AAAGAAGTTCAAGGTGATCATGG - Intronic
1038007179 8:23442165-23442187 GATGATTTTACAGGTTATCAGGG - Intronic
1038072046 8:24028038-24028060 GAGTATTTATAAAGTGATCATGG + Intergenic
1038262463 8:26008355-26008377 GAGGCTTCTCACAGTGATCAAGG - Intronic
1038469869 8:27806029-27806051 GGGGATGTACAAGGTGATCTAGG - Intronic
1039223954 8:35367140-35367162 GAGCATTTCCAACTTGATCATGG + Intronic
1039416911 8:37403030-37403052 GAGGATTGTCCAGGAGTTCAAGG + Intergenic
1041936761 8:63340608-63340630 TAGGGTTTTTAAGGGGATCATGG + Intergenic
1043398030 8:79857554-79857576 GTGGATTGGCAAGGTGAGCAAGG - Intergenic
1044104746 8:88189749-88189771 TAGGATTCTCAGGGTGAACAAGG - Intronic
1044824692 8:96184787-96184809 GAGAATTTTTAAAGTTATCATGG - Intergenic
1050527673 9:6560192-6560214 GATGATTTTCAGGGTAATCATGG - Intronic
1052190734 9:25658562-25658584 GAAGATTTGTAAGGTGAGCATGG + Intergenic
1052806107 9:33014718-33014740 GAGGACTGTCTTGGTGATCATGG - Intronic
1055773945 9:79747789-79747811 GAGGGATTTCAAGGTGGTAATGG - Intergenic
1057287695 9:93773484-93773506 TGGGATTTTAAAGGGGATCATGG + Intergenic
1058092462 9:100820453-100820475 GAGGACTTTAATGGTGTTCAGGG + Intergenic
1058105999 9:100972752-100972774 GAGGATTGACAAGGTAATAAAGG + Intergenic
1058309979 9:103487555-103487577 GACAATTTTCTAGGTGATCCAGG - Intergenic
1058606865 9:106732245-106732267 GAGGACTTACAAAGTGCTCAGGG - Intergenic
1059789202 9:117621706-117621728 TAAGATTTACAATGTGATCAGGG - Intergenic
1203426276 Un_GL000195v1:41988-42010 CAGGATTTTCAAGGTTTCCAGGG - Intergenic
1186122656 X:6380726-6380748 GAAGATTTTCAGGGTCTTCATGG + Intergenic
1186169460 X:6861583-6861605 CAAGATTTTCAAGCTGATCTTGG - Intergenic
1186224173 X:7379560-7379582 TAGGAATGTCAAGGTGATTAGGG - Intergenic
1186909001 X:14141655-14141677 GATGATTTCCAAGTTCATCATGG + Intergenic
1187372401 X:18720909-18720931 GGGGCTTTTCCAGGTGACCATGG - Intronic
1188037951 X:25339347-25339369 GTGTATTTTCAATGTTATCAGGG - Intergenic
1188440820 X:30214288-30214310 TGGGATTTGCAAGGAGATCATGG + Intergenic
1188753350 X:33930336-33930358 GAGGAATTTCAAAGAGATGAAGG + Intergenic
1189549213 X:42075787-42075809 AGAGATGTTCAAGGTGATCAGGG + Intergenic
1190030238 X:46965373-46965395 GAAGATTTTCAAAGAGATAAAGG + Intronic
1190366493 X:49699313-49699335 GAGGACTTTAAAGGTTATCCAGG - Intergenic
1194146673 X:90274610-90274632 CAGGCTTTTCAAGGTCATCATGG - Intergenic
1195077623 X:101342534-101342556 GAGGACTTTGAATGTCATCAGGG + Intergenic
1196120185 X:112041661-112041683 TAGGATCTTCAAGGTCACCAGGG - Intronic
1197423333 X:126265196-126265218 GAGGCCTATCAAGGGGATCAGGG - Intergenic
1198882893 X:141300474-141300496 CAGGATGTTGAAGGAGATCAAGG - Intergenic
1200492418 Y:3843789-3843811 CAGGCTTTTCAAGGTCATCATGG - Intergenic
1201794576 Y:17881198-17881220 GAGGATTTTCAAGGGAAGCAGGG - Intergenic
1201806979 Y:18024787-18024809 GAGGATTTTCAAGGGAAGCAGGG + Intergenic
1202340447 Y:23859039-23859061 GAGGATTTTCAAGGGAAGCAAGG - Intergenic
1202355949 Y:24048978-24049000 GAGGATTTTCAAGGGAAGCAGGG - Intergenic
1202514829 Y:25621131-25621153 GAGGATTTTCAAGGGAAGCAGGG + Intergenic
1202530319 Y:25811043-25811065 GAGGATTTTCAAGGGAAGCAAGG + Intergenic